A multi-copy plasmid of rhodotorula mucilaginosa, rhodotorula mucilaginosa transformation, high-efficiency overexpression of a target gene in a rhodotorula mucilaginosa strain and a construction method thereof

By developing multi-copy plasmids and genetic manipulation methods for Rhodotorula glutinis, and utilizing genetic mycotoxin resistance markers and electroporation transformation technology, the problem of low gene introduction efficiency in Rhodotorula glutinis was solved, achieving efficient overexpression of the target gene and enhancing the research and application potential of Rhodotorula glutinis.

CN119570835BActive Publication Date: 2025-12-12HUBEI UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411841303.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-13
Publication Date
2025-12-12
Estimated Expiration
2044-12-13

AI Technical Summary

Technical Problem

Existing technologies lack efficient and reproducible genetic manipulation methods and molecular tools for Rhodotorula glutinis, making it difficult to achieve efficient overexpression of target genes.

Method used

A multi-copy plasmid for Rhodotorula glutinis and a corresponding genetic manipulation method were developed. Using genimycin as an resistance marker, the multi-copy plasmid was efficiently introduced into Rhodotorula glutinis cells via PCR amplification and electroporation transformation. Transformation conditions were optimized to improve gene delivery efficiency.

Benefits of technology

It significantly improved the efficiency of gene delivery in Rhodotorula glutinis, achieved efficient overexpression of target genes, provided more flexible genome modification tools, and promoted the development of Rhodotorula glutinis in the fields of nutrition and health products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570835B_ABST
    Figure CN119570835B_ABST
Patent Text Reader

Abstract

The application provides a multi-copy plasmid of Rhodotorula mucilaginosa, Rhodotorula mucilaginosa transformation, a Rhodotorula mucilaginosa strain with efficient overexpression of a target gene and a construction method of the Rhodotorula mucilaginosa strain, and relates to the technical field of genetic engineering. The construction method of the plasmid comprises the following steps: screening geneticin as a resistance marker of wild Rhodotorula mucilaginosa; taking plasmid YEp352 as a template and P1-F / R as primers to amplify a linearized plasmid fragment; taking a DNA sequence of a geneticin resistance expression box with a homologous arm as a template and G1-F / R as primers to obtain a target gene fragment with a homologous sequence; assembling the linearized plasmid fragment and the target gene fragment with the homologous sequence, and then transforming into an E. coli competent cell; and finally, positive colony identification is performed. The multi-copy plasmid provided by the application has multiple cloning sites and a selection marker, so that the genome modification in the Rhodotorula mucilaginosa is more flexible and convenient, and the target gene can be stably and efficiently expressed.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular, relates to a Rhodotorula mucilaginosa multi-copy plasmid, a Rhodotorula mucilaginosa transformation, a Rhodotorula mucilaginosa strain for efficient overexpression of a target gene and a construction method thereof. BACKGROUND

[0002] In modern biotechnology, Rhodotorula mucilaginosa has attracted extensive attention due to its ability to synthesize abundant carotenoids, especially in the food and pharmaceutical industries. However, the genetic manipulation methods for Rhodotorula mucilaginosa are still limited, especially in the efficient overexpression of target genes. The existing technology mainly focuses on other yeast or microbial models, resulting in challenges in genetic modification in Rhodotorula mucilaginosa.

[0003] Currently, there is no systematic, efficient, and repeatable genetic manipulation method for Rhodotorula mucilaginosa (including preparation of competent cells and transformation method), and there is no molecular tool specifically used for high expression of target genes in Rhodotorula mucilaginosa. With the continuous improvement of the application value of Rhodotorula mucilaginosa, it is urgent to develop efficient genetic manipulation methods and molecular tools to conduct molecular level research and metabolic modification on Rhodotorula mucilaginosa strains. Therefore, developing an efficient and repeatable genetic manipulation method is of great significance to improve the function and application potential of Rhodotorula mucilaginosa. SUMMARY

[0004] The purpose of the present application is to provide a genetic manipulation method for overexpression of target genes in Rhodotorula mucilaginosa cells and a multi-copy plasmid. The genetic manipulation method has high transformation efficiency and is simple. The multi-copy plasmid has stable expression and high copy number, and is suitable for popularization and application.

[0005] To solve the above technical problems, the technical scheme adopted by the present application is as follows:

[0006] In a first aspect, the present application provides a Rhodotorula mucilaginosa multi-copy plasmid for efficient expression of Rhodotorula mucilaginosa genes, and the specific sequence is SEQ ID NO. 2.

[0007] In a second aspect, the present application provides a construction method of a Rhodotorula mucilaginosa multi-copy plasmid, comprising the following steps:

[0008] S1, screening geneticin as a resistance marker for wild Rhodotorula mucilaginosa;

[0009] S2, using plasmid YEp352 as a template and P1-F / P1-R as primers, performing PCR amplification on the plasmid YEp352 to obtain a linearized plasmid fragment; wherein the sequence of P1-F is SEQ ID NO. 3, and the sequence of P1-R is SEQ ID NO. 4;

[0010] S3, taking the DNA sequence of the synthetic geneticin resistance expression cassette with homologous arms as a template, the sequence being SEQ ID NO. 1, and taking G1-F / G1-R as primers to perform amplification to obtain a target gene fragment with homologous sequences; wherein the sequence of G1-F is SEQ ID NO. 5, and the sequence of G1-R is SEQ ID NO. 6;

[0011] S4, assembling the linearized plasmid fragment and the target gene fragment with homologous sequences, and then transforming into E. coli Top10 competent cells, and finally performing positive colony identification.

[0012] In a third aspect, the present application provides a method for transforming Rhodotorula, comprising the following steps:

[0013] SA, picking a single colony of Rhodotorula in YPD medium for culture, and then obtaining competent cells after collection, centrifugation, washing and resuspension;

[0014] SB, transforming the prepared multicopy plasmid into the competent cells by electroporation, coating on YRD agar plates containing geneticin after recovery treatment, and culturing to obtain positive single colonies.

[0015] In a fourth aspect, the present application provides a preparation method of a Rhodotorula strain with high efficient overexpression of a target gene, comprising the following steps:

[0016] SI, synthesizing a gene fragment with homologous arms for any target gene in Rhodotorula;

[0017] SII, performing PCR amplification with pYE-TNC as a template and P2-F / P2-R as primers to obtain a linearized plasmid fragment; wherein the sequence of P2-F is SEQ ID NO. 7, and the sequence of P2-R is SEQ ID NO. 8;

[0018] SIII, matching and assembling the gene fragment with homologous arms and the linearized plasmid fragment, and then transforming into E. coli Top10 competent cells, and performing colony PCR verification after single colonies grow on the screening plate to obtain correct transformants, i.e. the Rhodotorula multicopy gene overexpression plasmid with a gene expression cassette;

[0019] SIV, transforming the plasmid into Rhodotorula by electroporation to obtain a Rhodotorula strain with high efficient overexpression of a target gene.

[0020] Compared with the prior art, the embodiments of the present application have at least the following advantages or beneficial effects:

[0021] 1. The application determines that geneticin is a resistance marker available for wild-type Rhodotorula mucilaginosa, and optimizes the geneticin dosage used in the screening of engineered strains.

[0022] 2. The patent proposes a new multi-copy plasmid with a geneticin expression cassette that can be used for efficient gene expression in Rhodotorula mucilaginosa, as well as a method of electric shock transformation of Rhodotorula mucilaginosa. This transformation method can efficiently transfer plasmids and DNA fragments into Rhodotorula mucilaginosa cells. Compared with traditional methods, the application method significantly improves the efficiency of gene introduction by optimizing the transformation conditions and designing specific plasmid vectors. In addition, the developed plasmid system has multiple cloning sites and selection markers, making it more flexible and convenient for genome modification in Rhodotorula mucilaginosa. This innovative genetic manipulation method not only provides new tools for the study of Rhodotorula mucilaginosa, but also lays the foundation for its extensive potential in industrial applications. Through this technology, scientists can more deeply explore the metabolic pathways of Rhodotorula mucilaginosa and promote its development in the fields of nutrition, health products, and biological materials. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the application, the following will briefly introduce the drawings needed in the embodiments. It should be understood that the following drawings only show some embodiments of the application, and therefore should not be regarded as limiting the scope. For those skilled in the art, other related drawings can also be obtained without creative labor.

[0024] Figure 1 Figure for the resistance ability experiment of Rhodotorula mucilaginosa to different concentrations of geneticin and hygromycin;

[0025] Figure 2 Figure for the plasmid map of the multi-copy plasmid pYE-TNC;

[0026] Figure 3 Figure for the electric shock transformation process of competent Rhodotorula mucilaginosa and plasmid;

[0027] Figure 4 Figure for the multi-copy gene overexpression plasmid of Rhodotorula mucilaginosa with GLR1 expression cassette. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solutions and advantages of the embodiments of the application more clear, the technical solutions in the embodiments of the application will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. If the reagents or instruments used are not specified by the manufacturer, they are all conventional products that can be purchased on the market.

[0029] In the quantitative test in the following embodiments, three repeated experiments were set, and the average value was taken.

[0030] YPD medium: the medium is composed of solutes and solvents; the solutes are yeast powder, peptone and glucose, and the solvent is water; the concentrations of the solutes are as follows: 10 g / L of yeast powder, 20 g / L of peptone and 20 g / L of glucose; natural pH.

[0031] The solid medium is made by adding 20 g / L of agar powder, and the rest of the components and concentrations are the same as those of the liquid medium, and different concentrations and types of antibiotics are added as required.

[0032] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below with reference to specific embodiments.

[0033] A multiple copy plasmid of Rhodotorula mucilaginosa, which is used for efficient expression of Rhodotorula mucilaginosa genes, and the specific sequence is SEQ ID NO. 2.

[0034] A construction method of a multiple copy plasmid of Rhodotorula mucilaginosa, comprising the following steps:

[0035] S1, screening geneticin as a resistance marker of wild Rhodotorula mucilaginosa;

[0036] S2, using plasmid YEp352 as a template and P1-F / P1-R as primers, performing PCR amplification on the plasmid YEp352 to obtain a linearized plasmid fragment; the sequence of P1-F is SEQ ID NO. 3, and the sequence of P1-R is SEQ ID NO. 4;

[0037] S3, using the DNA sequence of the synthetic geneticin resistance expression cassette with a homologous arm as a template, and the sequence is SEQ ID NO. 1, using G1-F / G1-R as primers to perform amplification, to obtain a target gene fragment with a homologous sequence; the sequence of G1-F is SEQ ID NO. 5, and the sequence of G1-R is SEQ ID NO. 6;

[0038] S4, assembling the linearized plasmid fragment and the target gene fragment with a homologous sequence, and then transforming into E. coli Top10 competent cells, and finally performing positive colony identification.

[0039] In some embodiments of the present application, the PCR amplification system of the above S2 step is: PrimeSTAR Max Premix (2x) 25 μL, 1.5 μL of each of the upstream and downstream primers, 10 ng of plasmid YEp352, and deionized water is added to 50 μL, and mixed.

[0040] In some embodiments of the present application, the PCR reaction conditions are as follows: 98℃ / 3min, cycle 1; 98℃ / 10sec, 55℃ / 10sec, 72℃ / 30sec, 32 cycles; 72℃ / 5min.

[0041] In some embodiments of the present application, the S4 step is assembled and reacted at 50℃ for 1-4h.

[0042] A method for transforming a Rhodotorula, comprising the following steps:

[0043] SA, picking a single colony of Rhodotorula in YPD medium, and then obtaining competent cells after collection, centrifugation, washing and resuspension;

[0044] SB, transforming the multicopy plasmid into the competent cells by electroporation, and then culturing on a YRD agar plate containing geneticin after recovery treatment to obtain a positive monoclonal.

[0045] In some embodiments of the present application, the parameters of the electroporation in the SB step are set as 50μF, 100-129Ω, 1.5kV, and the pulse duration is 4-5ms.

[0046] A method for preparing a Rhodotorula strain with efficient overexpression of a target gene, comprising the following steps:

[0047] SI, selecting an arbitrary target gene in Rhodotorula to synthesize a gene fragment with a homologous arm;

[0048] SII, performing PCR amplification with pYE-TNC as a template and P2-F / P2-R as primers to obtain a linearized plasmid fragment; the sequence of P2-F is SEQ ID NO. 7, and the sequence of P2-R is SEQ ID NO. 8;

[0049] SIII, matching and assembling the above gene fragment with a homologous arm and the linearized plasmid fragment, and then transforming into E. coli Top10 competent cells, and then performing colony PCR verification after a single colony grows on a screening plate to obtain a correct transformant, i.e., a Rhodotorula multicopy gene overexpression plasmid with a gene expression cassette;

[0050] SIV, transforming the above plasmid into Rhodotorula by electroporation to obtain a Rhodotorula strain with efficient overexpression of a target gene.

[0051] In some embodiments of the present application, the target gene in the above SI step is the glutathione reductase encoding gene GLR1 of Rhodotorula glutinis, and the sequence of the gene fragment with homologous arms is SEQ ID NO. 9; the sequence of the Rhodotorula glutinis multicopy gene overexpression plasmid with the gene expression cassette in the SIII step is SEQ ID NO. 10.

[0052] The features and performances of the present application are further described in detail below in combination with examples.

[0053] Example 1

[0054] This example is a screening of the resistance marker of Rhodotorula glutinis, and the process is as follows:

[0055] Prepare 0 μg / ml, 25 μg / ml, 50 μg / ml, and 75 μg / ml YPD plates with geneticin resistance and 0 μg / ml, 25 μg / ml, 50 μg / ml, and 75 μg / ml YPD plates with hygromycin resistance respectively;

[0056] Picked the Rhodotorula glutinis single colony on the plate into a test tube containing 3 ml of YPD medium, and activated it in a shaking incubator at 28°C and 200 rpm for 24 h. Then, 30 μL of the activated bacterial solution was transferred into 3 ml of YPD medium, and cultured in a shaking incubator at 28°C and 200 rpm for 24 h. 1 ml of the bacterial solution was transferred into a 1.5 ml centrifuge tube, and the bacterial cells were enriched by centrifugation at 5000 x g for 5 min using a high-speed centrifuge. Then, 1 ml of sterile water was added, and the bacterial cells were enriched again by centrifugation at 5000 x g for 5 min. This washing process was repeated three times. Then, 1 ml of sterile water was added to the centrifuge tube containing the bacterial cells, and the Rhodotorula glutinis stock solution was obtained by blowing and sucking evenly. The stock solution was diluted by 10 -2 , 10 -3 , 10 -4 times respectively, and 5 μL of the three different concentrations of diluted bacterial solution was spotted onto 0 μg / ml, 25 μg / ml, 50 μg / ml, and 75 μg / ml YPD plates with geneticin resistance and 0 μg / ml, 25 μg / ml, 50 μg / ml, and 75 μg / ml YPD plates with hygromycin resistance respectively. The plates with the spotted bacterial solution were incubated in a constant temperature incubator at 28°C for 48 h. The results are shown in Figure 1 , wherein R. mucilaginosa represents Rhodotorula glutinis, S. cerevisiae represents Saccharomyces cerevisiae, geneticin represents geneticin, and hygromycin represents hygromycin. It can be seen from Figure 1 that 25 μg / L of geneticin and 50 μg / L of hygromycin can effectively inhibit the growth of Rhodotorula glutinis; therefore, geneticin is selected as the resistance marker of wild Rhodotorula glutinis in the present application.

[0057] Example 2

[0058] This example constructs a multi-copy plasmid, the process is as follows:

[0059] The plasmid YEp352 is used as a template (the construction method of YEp352 is described in the reference: Hill, J. E., Myers, A. M., Koerner, T. J., Tzagoloff, A. (1986) Yeast / E. coli shuttle vectors with multiple unique restriction sites. Yeast 2: 163-167.), and P1-F / P1-R is used as primers to amplify the plasmid YEp352 by PCR to obtain a linearized plasmid fragment. The sequence of P1-F is SEQ ID NO. 3: catcaggcgccattcgcc, and the sequence of P1-R is SEQ ID NO. 4: gctcttgttacccatcattgaattttgaac. The PCR amplification system is as follows: PrimeSTAR Max Premix (2x) 25 μL, 1.5 μL of each of the upstream and downstream primers, 10 ng of plasmid YEp352, and deionized water is added to 50 μL, and mixed well. The PCR reaction conditions are as follows: 98℃ / 3min, 1 cycle; 98℃ / 10sec, 55℃ / 10sec, 72℃ / 30sec, 32 cycles; 72℃ / 5min.

[0060] The DNA sequence of the geneticin resistance expression cassette with homologous arms is artificially synthesized by GenScript Company (SEQ ID NO. 1), and the DNA sequence of the geneticin resistance expression cassette with homologous arms is used as a template, and G1-F / G1-R is used as primers to amplify the sequence fragment to obtain the target gene fragment with homologous sequences; wherein the sequence of G1-F is SEQ ID NO. 5: cctgaatggcgaatggcgcctgatgGAATCCTTACATCACAC, and the sequence of G1-R is SEQ ID NO. 6: gatgggtaacaagagcttGCAAATTAAAGCCTTCG. The PCR amplification system is as follows: PrimeSTAR Max Premix (2x) 25 μL, 1.5 μL of each of the upstream and downstream primers, 10 ng of the DNA sequence of the geneticin resistance expression cassette with homologous arms, and deionized water is added to 50 μL, and mixed well. The PCR reaction conditions are as follows: 98℃ / 3min, 1 cycle; 98℃ / 10sec, 55℃ / 10sec, 72℃ / 30sec, 32 cycles; 72℃ / 5min.

[0061] The linear carrier and the target gene fragment with homologous sequence were assembled according to the system in the GenScript GenBuilder Cloning Kit User Manual kit instructions, and the reaction was carried out at 50°C for 1-4h. After the reaction was completed, it was directly transformed into E. coli Top10 competent cells. After a single colony grew on the screening plate, colony PCR verification was performed, and the correct transformant was obtained. The plasmid in which was named pYE-TNC, and the plasmid map thereof is shown in Figure 2 .

[0062] Example 3

[0063] This embodiment proposes a method for constructing a Rhodotorula mucilaginosa expression, including preparation of Rhodotorula mucilaginosa competent cells and electroporation process, specifically:

[0064] A single colony of Rhodotorula mucilaginosa was picked and cultured in 5ml YPD medium at 30°C, 200rpm shaking overnight. Then, 100ul of overnight culture was inoculated into 100ml YPD medium and continued to be cultured at 30°C, 200rpm for 8 hours. The cells were collected by centrifugation at 5000g for 5 minutes at 4°C. The cell pellet was washed with 100ml of pre-cooled sterile water, and then centrifuged at 5000g for 5 minutes. The cells were resuspended in 5ml of pre-cooled 1mol / L sorbitol solution and centrifuged at 5000g for 5 minutes. The final pellet was resuspended with 1ml of pre-cooled 1mol / L sorbitol solution to obtain Rhodotorula mucilaginosa competent cells;

[0065] 200ul of resuspended cells were mixed with 10ug of plasmid pYE-TNC (volume not more than 10ul) and transferred to a pre-cooled 0.2cm electroporation cup. Bio-Rad electroporator was used for electroporation, and the parameter settings were 50uF, 100-129Ω, 1.5kV, and pulse duration was 4-5 milliseconds. After electroporation, 1ml of pre-cooled sorbitol solution was immediately added to the electroporation cup, and the mixture was transferred to a 1.5ml microcentrifuge tube. The electroporation process is shown in Figure 3 .

[0066] The above mixture containing Rhodotorula mucilaginosa cells was placed in a 30°C constant temperature incubator for 3 hours, then centrifuged at 5000g for 5 minutes to remove the supernatant and obtain the bacterial pellet, which was resuspended with 50ul of sterile water and plated on YPD agar plates containing geneticin. The plate was incubated at 30°C for 48 hours, and a positive single colony was obtained.

[0067] Example 4

[0068] In order to verify the high copy function of the plasmid prepared in Example 2, the present example provides a method for preparing a Rhodotorula glutinis strain with efficient overexpression of a target gene, and the specific steps are as follows:

[0069] Any target gene is selected (in the present example, the glutathione reductase encoding gene GLR1 of Rhodotorula glutinis is selected), and the GLR1 expression cassette sequence with a homologous arm is artificially synthesized according to the nucleotide sequence of the glutathione reductase encoding gene GLR1 of Rhodotorula glutinis (GenBank: MF124332.1) and the TEF1 promoter and SUP4 terminator reported in GenBank, and the sequence is SEQ ID NO. 9;

[0070] The linearized plasmid fragment is obtained by PCR amplification with the multi-copy plasmid pYE-TNC prepared in Example 2 as the template and P2-F / P2-R as the primers, wherein the sequence of P2-F is SEQ ID NO. 7: gaattcgtaatcatggtcat, and the sequence of P2-R is SEQ ID NO. 8: gagctcgcatgcccg.

[0071] The PCR amplification system is as follows: PrimeSTAR Max Premix (2x) 25 μL, 1.5 μL of each of the upstream and downstream primers, 10 ng of plasmid pYE-TNC, and deionized water is added to 50 μL, and mixed well.

[0072] The PCR reaction conditions are as follows: 98℃ / 3min, 1 cycle; 98℃ / 10sec, 55℃ / 10sec, 72℃ / 30sec, 32 cycles; 72℃ / 5min.

[0073] The linearized plasmid fragment and the target gene fragment with a homologous sequence are assembled according to the system in the GenBuilder Cloning Kit User Manual kit instruction book of GenScript Company, and the reaction is carried out at 50℃ for 1-4h. After the reaction is completed, it is directly transformed into E. coli Top10 competent cells. After a single colony grows on the screening plate, colony PCR verification is performed, and the correct transformant is obtained, which is a Rhodotorula glutinis multi-copy gene overexpression plasmid with a gene expression cassette, named pYE-TNC-GLR1, and the structure is as shown in Figure 4 , and the sequence is SEQ ID NO. 10;

[0074] The Rhodotorula glutinis multi-copy gene overexpression plasmid with the GLR1 expression cassette is transformed into Rhodotorula glutinis Rm4 by the electric shock transformation method of Example 3, and the strain Rm4-TGS is obtained.

[0075] Two control groups were set in this example. Control group 1 was the G. liquefaciens Rm4 without the plasmid; and control group 2 was the G. liquefaciens strain Rm4-TNC with the plasmid pYE-TNC.

[0076] Rm4-TGS, Rm4 and Rm4-TNC were determined by the following method. Total RNA of the strains Rm4, Rm4-TNC and Rm4-TGS was extracted, and reverse transcription was performed by using a qRT-PCR kit (SYBR Green I). The corresponding cDNA was obtained, which was used as a template, and the expression level of GLR1 gene was relatively quantitatively analyzed by using primer pair R1-F / R through Quant two-step fluorescence quantitative qRT-PCR (SYBR Green I). The experimental data was collected by LightCycler96 software SW 1.1 (Roche); and the expression level difference of each gene was analyzed by using the ΔCT calculation method. The Saccharomyces cerevisiae ACT1 gene was used as a control, and finally normalized. Each experiment was set in triplicate. The results are shown in Table 1.

[0077] Table 1 Transcription level of GLR1 in different strains

[0078] Strains Rm4 Rm4-TNC Rm4-TGS GLR1 transcription level 1.00±0.10 1.09±0.12 6.70±0.38

[0079] As can be seen from Table 1, the expression level of GLR1 in the strain Rm4-TGS was 6.7 and 6.15 times that of the control strains Rm4 and Rm4-TNC, respectively, that is, compared with Rm4 and Rm4-TNC, the relative transcription level of GLR1 in the strain Rm4-TGS was significantly improved, indicating that GLR1 in the strain Rm4-TGS was enhanced expression. It is further proved that the multi-copy plasmid constructed in the present application can be used as a target gene overexpression plasmid of G. liquefaciens.

[0080] The above-described embodiments are part of the embodiments of the present application, rather than all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but only represents selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

Claims

1. A multi-copy plasmid of *Rhodotorula glutinis* for efficient gene expression in *Rhodotorula glutinis*, characterized in that, The sequence of the Rhodotorula glutinis multicopy plasmid is SEQ ID NO.2; The method for constructing the Rhodotorula glutinis multicopy plasmid includes the following steps: S1. Screening for genimycin as a resistance marker for wild-type Rhodotorula glutinis; S2. Using plasmid YEp352 as a template and P1-F / P1-R as primers, plasmid YEp352 was amplified by PCR to obtain linearized plasmid fragments; the sequence of P1-F is SEQ ID NO.3 and the sequence of P1-R is SEQ ID NO.

4. S3. Using the DNA sequence of the artificially synthesized genetic mycotoxin resistance expression cassette with homologous arms as a template (SEQ ID NO.1), amplification was performed using G1-F / G1-R primers to obtain the target gene fragment with homologous sequences; wherein the sequence of G1-F is SEQ ID NO.5 and the sequence of G1-R is SEQ ID NO.

6. S4. The linearized plasmid fragments are assembled with the target gene fragments containing homologous sequences, then transformed into E. coli Top10 competent cells, and finally positive colony identification is performed.

2. The Rhodotorula glutinis multicopy plasmid according to claim 1 is used for high-efficiency expression of Rhodotorula glutinis genes, characterized in that, The PCR amplification system for step S2 is as follows: PrimeSTAR Max Premix (2x) 25 μL, forward and reverse primers 1.5 μL each, plasmid YEp352 10 ng, and deionized water is added to bring the system to 50 μL and mixed well.

3. The Rhodotorula glutinis multicopy plasmid according to claim 2 is used for high-efficiency expression of Rhodotorula glutinis genes, characterized in that, The PCR reaction conditions were as follows: 98℃ / 3 min, 1 cycle; 98℃ / 10 sec, 55℃ / 10 sec, 72℃ / 30 sec, 32 cycles; 72℃ / 5 min.

4. The multi-copy plasmid of *Rhodotorula glutinis* according to claim 1 is used for high-efficiency expression of *Rhodotorula glutinis* genes, characterized in that... After assembly in step S4, the mixture is reacted at 50°C for 1-4 hours.

5. A method for converting red yeast into invert gum, characterized in that, Includes the following steps: SA, select single colonies of Rhodotorula glutinis and culture them in YPD medium, then collect, centrifuge, wash and resuspend to obtain competent cells; SB. The multi-copy plasmid described in claim 1 is transformed into competent cells by electroporation, and after revival treatment, it is plated on YRD agar plates containing genimycin and cultured to obtain positive single clones.

6. The method for converting red yeast according to claim 5, characterized in that, The parameters for the electrical shock conversion in the SB step are set to 50 μF, 100-129 Ω, 1.5 kV, and the pulse duration is 4-5 ms.

7. A method for preparing a Rhodotorula glutinis strain with high-efficiency overexpression of a target gene, characterized in that, Includes the following steps: SI. Select any target gene in Rhodotorula glutinis and synthesize a gene fragment with a homologous arm. SII. Using pYE-TNC as a template and P2-F / P2-R as primers, PCR amplification was performed to obtain linearized plasmid fragments; the sequence of P2-F is SEQ ID NO.7 and the sequence of P2-R is SEQ ID NO.

8. SIII. The gene fragment with homologous arms and the linearized plasmid fragment are assembled in proportion and then transformed into E. coli Top10 competent cells. After single colonies grow on the screening plate, colony PCR is performed to verify the correct transformant, which is the Rhodotorula glutinis multicopy gene overexpression plasmid with gene expression cassette. SIV. The above plasmids were transformed into Rhodotorula glutinis by electroporation to obtain Rhodotorula glutinis strains that efficiently overexpress the target gene.

8. The method for preparing the Rhodotorula glutinis strain with high-efficiency overexpression of the target gene according to claim 7, characterized in that, The target gene in step SI is the glutathione reductase encoding gene GLR1 of *Rhodotorula glutinis*, and the gene fragment sequence with homologous arms is SEQ ID NO.9; the sequence of the *Rhodotorula glutinis* multi-copy gene overexpression plasmid with gene expression cassette in step SIII is SEQ ID NO.10.