Preparation method of DNA molecular weight standard based on self-assembly
The DNA molecular weight standards are prepared by self-assembly and enzyme ligation, which solves the problems of high preparation cost and difficult modification of single-stranded small fragment DNA molecular weight standards. It realizes low-cost and efficient preparation of multiple DNA molecular weight standards with equidistantly increasing sequence lengths, and is particularly suitable for chemically modified DNA molecular weight standards in the range of 20-100nt.
Patent Information
- Application Number
- CN202511121075.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-12
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-08-12
AI Technical Summary
In the prior art, single-stranded small fragment DNA molecular weight standards have high preparation costs, are difficult to modify, and lack simple and efficient preparation methods, especially small fragment single-stranded or double-stranded DNA molecular weight standards.
The DNA molecular weight standard is prepared by a self-assembly method. Two single-stranded DNAs of equal but incomplete complementarity are chemically synthesized, and directed self-assembly is performed using base complementary pairing. Multiple DNA molecular weight standards with increasing sequence lengths are formed by ligase. A three-step inactivation method is combined to ensure complete elimination of enzyme activity.
It achieves low-cost and efficient preparation of multiple DNA molecular weight standards with equidistantly increasing sequence lengths. It is suitable for single-stranded or double-stranded DNA, especially chemically modified DNA molecular weight standards in the range of 20-100nt, solving the problems of high preparation cost and difficult modification.
Smart Images

Figure CN120608126A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a method for preparing a DNA molecular weight standard based on self-assembly. Background Art
[0002] DNA molecular weight standards are a series of reagents containing a mixture of DNA fragment standards of varying molecular weights. In molecular biology, DNA molecular weight standards are used to calibrate the molecular weights of DNA fragments to be measured. The specific calibration method involves running the DNA molecular weight standards and the DNA fragments to be measured on the same agarose gel or polyacrylamide gel for electrophoresis. The DNA fragments of known lengths in the DNA molecular weight standards form a gradient of bands, which indicate the size and distribution of the unknown DNA fragments to be measured.
[0003] In molecular biology experiments, DNA molecular weight standards are essential reagents that are used frequently and consumed in large quantities. Therefore, there is a great demand for their preparation, requiring low production costs, high indication accuracy, and high diversity.
[0004] In the prior art, there are two main methods for preparing DNA molecular weight standards: PCR amplification and enzyme-digested plasmids. The principle of PCR amplification is to design primers, amplify the desired length using template DNA, purify the fragments after amplification, and finally mix the resulting DNA fragments. The principle of enzyme-digested plasmids is to design a pair of primers, amplify the template, and obtain DNA fragments. However, there is a lack of simple and efficient methods for preparing specially modified DNA molecular weight standards, such as fluorescent markers or single-stranded DNA molecular weight standards. In particular, for small single-stranded or double-stranded DNA molecular weight standards, such as a 20 nt DNA molecular weight standard, PCR amplification is costly due to their small fragment length, while enzyme-digested plasmids often produce unwanted bands, hindering subsequent purification and limiting their large-scale production. Currently available small single-stranded DNA molecular weight standards or fluorescently modified DNA molecular weight standards are expensive to purchase, and fluorescently modified single-stranded DNA molecular weight standards are not yet available. Summary of the Invention
[0005] The purpose of the present invention is to provide a method for preparing a DNA molecular weight standard based on self-assembly, thereby solving the technical bottleneck of high preparation cost and difficult modification of single-stranded small fragment DNA molecular weight standards in the prior art.
[0006] In order to solve the above problems, the present invention adopts the following technical solutions:
[0007] According to a first aspect of the present invention, a method for preparing a self-assembly-based DNA molecular weight standard is provided, comprising the following steps: S1: chemically synthesizing two single-stranded DNAs of equal but incompletely complementary lengths, each consisting of two sequences: one being a complementary sequence and the other being a self-assembled complementary sequence; S2: mixing the two single-stranded DNAs in a reaction buffer, and adding a ligase after the two single-stranded DNAs undergo directed self-assembly through complementary base pairing; S3: reacting at room temperature for 0.5-10 min, regulating the number of self-assemblies by controlling the reaction time, adding a number of bases equal to the number of single-stranded DNA bases each time to form a plurality of DNA molecular weight standards with equidistantly increasing sequence lengths; S4: placing the system after the reaction at high temperature to heat-inactivate the ligase; and S5: adding an electrophoresis loading buffer of corresponding concentration to the system to prepare a DNA molecular weight standard, which is then stored at low temperature.
[0008] According to the present invention, the two single-stranded DNAs have an equal number of bases, and the number of bases determines the difference in sequence length of the DNA molecular weight standards prepared therefrom.
[0009] Preferably, the lengths of the two single-stranded DNAs are between 20 and 100 nt. More preferably, 20 nt DNA1-P and DNA2 are used as raw materials for preparing single-stranded DNA molecular weight standards. It should be understood that this sequence is merely illustrative of a preferred embodiment and is not intended to be limiting. The sequence length is preferably between 20 and 100 nt, which can ensure high efficiency of self-assembly while ensuring high accuracy and low cost during synthesis.
[0010] According to the present invention, when preparing a single-stranded DNA molecular weight standard, the 5' end of one DNA strand is modified with a phosphate group; when preparing a double-stranded DNA molecular weight standard, the 5' ends of both DNA strands are modified with a phosphate group.
[0011] According to the present invention, the ligase is an enzyme having DNA ligation function, selected from: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, TaqDNA ligase, 9°N DNA Ligase, E. coli DNA ligase, SplintR ligase, 5´ AppDNA / RNA thermostable ligase, T4 RNA ligase, T4 RNA ligase 2, or RtcB ligase.
[0012] According to one embodiment of the present invention, the final concentration of T4 DNA ligase is 20 U / μL.
[0013] According to the method of the present invention, the concentration of the DNA ligase and the reaction time jointly determine the number of self-assembly cycles. However, the above-mentioned concentration and reaction time are preferred conditions used in this experiment and are not intended to be limiting.
[0014] It should also be understood that according to the present method, there is no limit on the concentration of the single-stranded DNA, and there is no limit on the mixing ratio. Preferably, in step S2, the concentration of the two single-stranded DNAs is 0.01-100 μM, and the mixing ratio is adjusted according to the target product.
[0015] Preferably, in step S4, a three-step inactivation process is performed, sequentially heating at 65°C for 10 minutes, quenching in an ice bath, and chelating with EDTA, to ensure complete deactivation of the enzyme. This present invention employs this three-step inactivation method for the first time, ensuring complete deactivation and product stability. Heating at 65°C for 10 minutes denatures the protein structure of the DNA ligase, quenching in an ice bath rapidly fixes the enzyme's inactivated state and prevents renaturation, and EDTA chelation removes metal ions required for the DNA ligase active center by binding to them, further ensuring complete deactivation of the enzyme.
[0016] According to the present invention, DNA molecular weight standards can be modified with different functional groups or different numbers of functional groups during the synthesis process. These functional groups can be selected from the group consisting of Cy3, Cy5, azide, methylation, digoxigenin, or methylene blue, to produce differently modified DNA molecular weight standards. For example, modification with fluorescent groups such as Cy3 and Cy5 facilitates detection and tracking in fluorescence detection experiments; methylation modification may affect certain biological activities of DNA, providing different application value for specific experimental requirements.
[0017] The reaction buffer includes, but is not limited to, 66 mM Tris-HCl buffer (pH 7.6) containing 6.6 mM MgCl2, 1 mM ATP, and 10 mM DTT. It should be understood that buffers of other concentrations and pHs, such as PBS, D-PBS, and potassium phosphate buffer, as long as they maintain enzyme activity, can be used in the present invention, as well as buffers with varying concentrations of 0.1-10 mM ATP. It should be understood that this reaction buffer is a preferred condition used in the experiment and is not intended to be limiting; any buffer suitable for the ligase can be used in the present invention.
[0018] According to a second aspect of the present invention, there is provided a DNA molecular weight standard prepared by the preparation method, comprising a plurality of DNA molecular weight standards with equidistantly increasing sequence lengths.
[0019] According to a preferred embodiment of the present invention, a method for preparing a DNA molecular weight standard based on controlled DNA self-assembly is provided, comprising the following steps:
[0020] Directed self-assembly control: 0.01-100 μM 5-terminal phosphorylated DNA1-P was mixed with complementary strand DNA2 at a 1:1 molar concentration to form a self-assembled structure in 66 mM Tris-HCl buffer (pH 7.6) containing 6.6 mM MgCl2, 1 mM ATP, and 10 mM DTT;
[0021] Molecular weight gradient generation: Add T4 DNA ligase to a final concentration of 20 U / μL. Control the reaction time (0.5-10 min) to precisely regulate the number of self-assemblies, adding a fixed number of bases each time to form an arithmetic gradient.
[0022] Product stabilization treatment: A three-step inactivation method (heating at 65°C for 10 min → ice bath cooling → EDTA chelation) was used to ensure complete elimination of enzyme activity.
[0023] Product storage: Dilute the product to the appropriate concentration and add the corresponding volume of electrophoresis loading buffer to the system to prepare a DNA molecular weight standard, which is stored at 4°C.
[0024] According to the preparation method of DNA molecular weight standard provided by the present invention, combined with Figure 1 As shown in the figure, its working principle is as follows: Two single-stranded DNAs of equal length but not completely complementary, each composed of two sequences: one complementary sequence and the other a self-assembled complementary sequence, can self-assemble through base pairing. DNA ligase then connects the 5-terminal phosphorylated DNA1 to each other, adding the same number of bases each time, forming a gradient of DNA fragments, the single-stranded DNA molecular weight standard. Similarly, when preparing double-stranded DNA molecular weight standards, two single-stranded DNAs with both 5-terminal phosphorylated modifications are used as raw materials for directed self-assembly, and DNA ligase is used to connect DNA1 and DNA2 respectively. When preparing modified DNA molecular weight standards, single-stranded DNA raw materials with corresponding modifications are used.
[0025] In this context, self-assembly refers to the process by which two single-stranded DNA strands spontaneously form a specific spatial structure through the principle of complementary base pairing. Specifically, each single-stranded DNA strand contains two components: a complementary sequence and a self-assembly complementary sequence. These two components recognize and bind to each other through base pairing (e.g., AT and CG pairing), thereby enabling the two strands of DNA to assemble together in a directional manner, forming a stable composite structure. The complementary sequence facilitates the initial directional approach of the two strands during the self-assembly process, while the self-assembly complementary sequence determines the specificity and stability of the resulting self-assembled structure.
[0026] This self-assembly is the basis for the subsequent function of DNA ligase. The assembled structure provides a recognizable connection site for the ligase, enabling the enzyme to connect adjacent DNA chains, and then generate DNA molecular weight standards with increasing lengths (such as 20nt, 40nt, 60nt, etc.) by controlling conditions such as reaction time.
[0027] According to the present invention, the complementary sequence of the two single-stranded DNAs and the self-assembly complementary sequence have variable lengths, and the two single-stranded DNAs have the same number of bases (the number of which determines the difference in sequence length of the molecular weight standard), which provides a basis for the flexibility and gradient control of self-assembly.
[0028] Although self-assembly and enzyme ligation are existing technologies, the innovation of the present invention lies mainly in the precise control of gradients and the versatility of raw materials. The method of the present invention overcomes the high preparation cost and high complexity of the preparation process of traditional single-stranded DNA molecular weight standards. Through a simple reaction process, multiple DNA molecular weight standards with equidistantly increasing sequence lengths can be prepared.
[0029] Compared with the prior art, the advantages of the technical solution of the present invention mainly lie in the following aspects:
[0030] Directed self-assembly control: Utilizing the self-assembly properties of 5'-end phosphorylated DNA and complementary chains, directional connection is achieved through base complementary pairing, which is different from the random fragment generation of traditional enzyme digestion or PCR;
[0031] Precise gradient control: By controlling the reaction time of T4 ligase, an arithmetic gradient with a fixed number of bases added per ligation is achieved, solving the problem of irregular gradient intervals in existing technologies.
[0032] Three-step inactivation method: Through a combination of heating, ice bath, and EDTA chelation treatment, the enzyme activity is completely eliminated and the product stability is improved. Existing technologies may only use single heating inactivation, which has relatively limited effects.
[0033] Versatility of raw materials: Using short-chain DNA (such as 20 nt) as raw materials can extend to long fragments through self-assembly, reducing synthesis costs. Traditional chemical methods are expensive to synthesize long fragments.
[0034] In summary, the method for preparing a self-assembled DNA molecular weight standard provided by the present invention can prepare DNA molecular weight standards of different gradients, with a simple process and low preparation cost. The method can also prepare DNA molecular weight standards with different modifications, such as fluorescent molecule modification, cholesterol modification, etc. It is particularly suitable for preparing DNA molecular weight standards with chemical modification functions within the range of 20-100 nt, and is not limited to single-stranded or double-stranded DNA molecular weight standards. It solves the technical bottleneck of high preparation cost and difficult modification of single-stranded small fragment DNA molecular weight standards in the prior art. The present invention adopts a one-pot method to quickly prepare DNA molecular weight standards, which has the advantages of simple process, low production cost, strong scalability, etc., and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 A schematic diagram showing the principle of preparing a DNA molecular weight standard by controlled self-assembly of two single-stranded DNAs according to the method of the present invention;
[0036] Figure 2 This figure compares a DNA molecular weight standard prepared using 20 nt single-stranded DNA as raw material and a commercial DNA molecular weight standard from a certain company. Band 1 is a commercial DNA molecular weight standard from a certain company, and band 2 is a DNA molecular weight standard prepared using this method.
[0037] Figure 3 This is a gel image of a DNA molecular weight standard prepared using 20 nt single-stranded DNA as raw material and a single-stranded DNA with a known length of 42 nt; among them, band 1 is the DNA molecular weight standard prepared using 20 nt single-stranded DNA as raw material, and band 2 is the 42 nt single-stranded DNA chain;
[0038] Figure 4 This is a gel image of a DNA molecular weight standard prepared using 25 nt single-stranded DNA as raw material and a DNA with a known length of 42 nt; among them, band 1 is a DNA molecular weight standard prepared using 25 nt single-stranded DNA as raw material, and band 2 is a 42 nt single-stranded DNA chain;
[0039] Figure 5 This is the assembly effect of DNA molecular weight standards prepared by ligating 20 nt single-stranded DNA using DNA ligase at different ligation times; among them, band 1 is the product obtained by ligation for 0.5 min, band 2 is the product obtained by ligation for 1 min, band 3 is the product obtained by ligation for 2 min, band 4 is the product obtained by ligation for 3 min, band 5 is the product obtained by ligation for 4 min, band 6 is the product obtained by ligation for 5 min, band 7 is the product obtained by ligation for 6 min, band 8 is the product obtained by ligation for 7 min, band 9 is the product obtained by ligation for 8 min, band 10 is the product obtained by ligation for 9 min, and band 11 is the product obtained by ligation for 10 min;
[0040] Figure 6 The figure shows the assembly effect of DNA molecular weight standards prepared at different concentrations using 20 nt single-stranded DNA as the raw material; band 1 is a commercial DNA molecular weight standard, band 2 is the 0.1 μM product, band 3 is the 0.5 μM product, band 4 is the 1 μM product, band 5 is the 2 μM product, band 6 is the 4 μM product, band 7 is the 6 μM product, band 8 is the 8 μM product, and band 9 is the 10 μM product;
[0041] Figure 7 The results show that 20 nt single-stranded DNA was used as the raw material and different concentrations of different types of DNA ligase were used to prepare the assembly effect of DNA molecular weight standards. Band 1 is the product of 15 U / μL T3 DNA ligase, band 2 is the product of 75 U / μL T3 DNA ligase, band 3 is the product of 150 U / μL T3 DNA ligase, band 4 is the product of 225 U / μL T3 DNA ligase, band 5 is the product of 300 U / μL T3 DNA ligase, band 6 is the product of 1.75 U / μL T4 DNA ligase, band 7 is the product of 8.75 U / μL T4 DNA ligase, band 8 is the product of 17.5 U / μL T4 DNA ligase, band 9 is the product of 26.25 U / μL T4 DNA ligase, band 10 is the product of 35 U / μL T4 DNA ligase, and band 11 is the product of 15 U / μL T7 The products obtained by DNA ligase, band 12 is the product obtained by 75 U / μL T7 DNA ligase, band 13 is the product obtained by 150 U / μL T7 DNA ligase, band 14 is the product obtained by 225 U / μL T7 DNA ligase, and band 15 is the product obtained by 300 U / μL T7 DNA ligase. DETAILED DESCRIPTION
[0042] The present invention will be further described below with reference to specific examples. It should be understood that the following examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Unless otherwise specified, the techniques used in the examples are conventional in the art, or according to the experimental methods recommended by the kit and instrument manufacturers. The reagents and materials used in the examples are commercially available unless otherwise specified.
[0043] Table 1 DNA sequences used in this specification
[0044] name 5’-3’ DNA1-P (20 nt) P-GGCACACACTTGAAAACCGG DNA2 (20 nt) GTGTGTGCCCCGGTTTTCAA DNA1-P (25 nt) P-GGCACACACACAATAAAACCGGAAG DNA2 (25 nt) TATTTTGGCCTTCCCGTGTGTGT
[0045] Example 1: Preparation of DNA molecular weight standards using 20 nt single-stranded DNA as raw material
[0046] After mixing 5 μM of 20 nt DNA1-P and 20 nt DNA2, add T4 DNA ligase and react for 5 minutes; the reaction system is placed at 65°C for 10 minutes. After heat inactivation of the ligase, the DNA chain is diluted to 2 μM, and the same volume of 2× denaturation loading buffer is added to the system and stored at 4°C.
[0047] The results are as follows Figure 2 As shown, band 1 is a commercial DNA molecular weight standard produced by a certain company, and band 2 is the DNA molecular weight standard prepared in this example. It can be seen that 11 types of DNA molecular weight standards were successfully prepared by the method of this example after a reaction of 5 minutes.
[0048] The results are as follows Figure 3 As shown, band 1 is a DNA molecular weight standard prepared using 20 nt single-stranded DNA as raw material, and band 2 is a 42 nt single-stranded DNA chain. It can be seen that the DNA molecular weight standard prepared by the method of this example for 5 min is in line with expectations.
[0049] Example 2: Preparation of DNA Molecular Weight Standard Using 25 nt Single-stranded DNA as Raw Material
[0050] After mixing 5 μM of 25 nt DNA1-P and 25 nt DNA2, T4 DNA ligase was added and the reaction was allowed to proceed for 5 min. The reaction system was placed at 65°C for 10 min. After heat inactivation of the ligase, the DNA chain was diluted to 2 μM and the same volume of 2× denaturation loading buffer was added to the system. The system was stored at 4°C.
[0051] The results are as follows Figure 4 As shown, band 1 is a DNA molecular weight standard prepared using 25 nt single-stranded DNA as raw material, and band 2 is a 42 nt single-stranded DNA chain. It can be seen that the DNA molecular weight standard prepared by the method of this example for 5 min is in line with expectations.
[0052] Example 3: Preparation of 20 nt single-stranded DNA ladders with different ligation times
[0053] After mixing 5 μM of 20 nt DNA1-P and 20 nt DNA2, T4 DNA ligase was added, and different reaction times were used: 0.5 min, 1 min, 2 min, 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, and 10 min; the reaction system was placed at 65 °C for 10 min. After heat inactivation of the ligase, the DNA chain was diluted to 2 μM, and the same volume of 2× denaturation loading buffer was added to the system and stored at 4 °C.
[0054] The results are as follows Figure 5 As shown in the figure, the assembly effects of DNA molecular weight standards prepared by using 20 nt single-stranded DNA as raw material and connecting with DNA ligase for different connection times are different. As the reaction time increases, more molecular weight standards with higher molecular weights (such as 220nt and 200nt) are prepared.
[0055] Example 4: Preparation of DNA molecular weight standards using 20 nt single-stranded DNA at different concentrations
[0056] After mixing 20 nt DNA1-P and 20 nt DNA2 at different concentrations (0.1μM, 0.5μM, 1μM, 2μM, 4μM, 6μM, 8μM, 10μM), T4 DNA ligase was added and the reaction was carried out for 5 min; the reaction system was placed at 65°C for 10 min. After heat inactivation of the ligase, the DNA chain was diluted to 2μM, and the same volume of 2× denaturation loading buffer was added to the system and stored at 4°C.
[0057] The results are as follows Figure 6 As shown, band 1 is a commercial DNA molecular weight standard produced by a certain company, and bands 2-9 are the products obtained in this example. It can be seen that as the concentration of single-stranded DNA increases, more molecular weight standards with lower molecular weights (such as 40nt and 60nt) are prepared.
[0058] Example 5: Preparation of DNA molecular weight standards using 20 nt single-stranded DNA as raw material using different DNA ligases and different concentrations
[0059] After mixing 5 μM of 20 nt DNA1-P and 20 nt DNA2, different concentrations (0.1× - 2×) of DNA ligase (T3 DNA ligase, T4 DNA ligase, T7 DNA ligase) were added and the reaction was carried out for 5 min. The reaction system was placed at 65°C for 10 min. After heat inactivation of the ligase, the DNA chain was diluted to 2 μM, and the same volume of 2× denaturation loading buffer was added to the system and stored at 4°C.
[0060] The results are as follows Figure 7 As shown, the ligation effects of different DNA ligases are comparable. As the ligase concentration increases, more molecular weight standards with higher molecular weights are present.
[0061] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. Various modifications are possible. Any simple, equivalent changes and modifications made in accordance with the claims and description of the present invention are within the scope of protection of the patent claims. Anything not fully described in this invention is conventional technology.
Claims
1. A method for preparing a self-assembled DNA molecular weight standard, characterized in that: The following steps are involved: S1: Chemically synthesize two single-stranded DNAs of equal length but not completely complementary, each consisting of two sequences: one is a complementary sequence and the other is a self-assembled complementary sequence; S2: mixing the two single-stranded DNAs in a reaction buffer, and adding a ligase after the two single-stranded DNAs undergo directed self-assembly through complementary base pairing; S3: React at room temperature for 0.5-10 minutes. The number of self-assembly times is controlled by controlling the reaction time. Each connection adds a number of bases equal to the number of single-stranded DNA bases, forming multiple DNA molecular weight standards with increasing sequence lengths. S4: placing the reaction system under high temperature to heat-inactivate the ligase; S5: Add electrophoresis loading buffer of corresponding concentration to the system to prepare DNA molecular weight standard and store at low temperature.
2. The preparation method according to claim 1, characterized in that The two single-stranded DNAs have an equal number of bases, and this number of bases determines the difference in sequence length of the DNA molecular weight standards prepared therefrom.
3. The preparation method according to claim 1, characterized in that The lengths of the two single-stranded DNAs are between 20-100 nt.
4. The preparation method according to claim 1, characterized in that The sequence lengths of the two parts of the two single-stranded DNAs are not fixed.
5. The preparation method according to claim 1, characterized in that When preparing a single-stranded DNA molecular weight standard, the 5' end of one DNA strand is modified with a phosphate group; when preparing a double-stranded DNA molecular weight standard, the 5' ends of both DNA strands are modified with a phosphate group.
6. The preparation method according to claim 1, characterized in that The ligase is an enzyme with DNA ligation function, selected from: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, TaqDNA ligase, 9°N DNA Ligase, E. coli DNA ligase, SplintR ligase, 5´ AppDNA / RNA thermostable ligase, T4 RNA ligase, T4 RNA ligase 2, or RtcB ligase.
7. The preparation method according to claim 1, characterized in that In step S2, the concentrations of the two single-stranded DNAs are 0.01-100 μM, and the mixing ratio is adjusted according to the target product.
8. The preparation method according to claim 1, characterized in that In step S4, three steps of inactivation are performed, namely, heating at 65° C. for 10 min, sudden cooling in an ice bath, and chelation with EDTA, to ensure that the enzyme activity is completely eliminated.
9. The preparation method according to claim 1, characterized in that During the synthesis process, modifications with different functional groups or different numbers of functional groups are performed, wherein the functional groups are selected from: cy3, cy5, azide, methylation, digoxigenin, or methylene blue to prepare differently modified DNA molecular weight standards.
10. A DNA molecular weight standard prepared by the preparation method according to any one of claims 1 to 9, characterized in that: Includes multiple DNA molecular weight standards with increasing sequence lengths.
Citation Information
Patent Citations
Preparation method of 100bp DNA (deoxyribonucleic acid) molecular weight standard and primer group and application thereof
CN110714053A
Enzyme activity determination method of DNA ligase
CN113061645A
Method for preparing site-specific modified long-chain DNA
CN115605590A
DNA molecular weight standard preparation method based on palindromic sequence
CN116515954A
Detection method of self-assembly of oligonucleotide and quantitative analysis method of gene
JP2003164299A
Cited By
Single-stranded DNA molecular weight standard based on light-operated self-assembly and preparation method thereof
CN121087128A
A single-stranded DNA molecular weight standard based on light-controlled self-assembly and a preparation method thereof
CN121087128B