Flavone-4 '-O-methyltransferase mutant as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of synthetic biology and enzyme engineering, and particularly relates to a flavone 4 '-O-methyltransferase mutant as well as a preparation method and application thereof. Specifically, wild type methyltransferase as shown in SEQ ID NO.1 is subjected to mutation modification, and a series of mutants with improved enzyme activity are obtained. The mutant enzyme is obtained by respectively performing point mutation and superposition mutation on a plurality of amino acid sites of a wild-type methyltransferase amino acid sequence, so that the capability of synthesizing icaritin by the methyltransferase is remarkably enhanced, and the highest yield is 11.4 times of that of the wild-type methyltransferase. Certain support is provided for industrial fermentation production of icaritin, and therefore the icaritin has good practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of synthetic biology and enzyme engineering, and particularly relates to a flavone 4'-O-methyltransferase mutant and a preparation method and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Icariin is a plant-derived flavonoid compound. Research suggests it holds promise for treating diseases such as cancer, osteoporosis, and atherosclerosis. Icariin soft capsules for the treatment of liver cancer have been approved for marketing in China. Currently, the primary method for obtaining icariin is plant extraction, but yields are low, and chemical synthesis is complex and involves toxic substances. Microorganisms, however, offer significant advantages in natural product synthesis due to their ease of cultivation, rapid reproduction, and ease of genetic manipulation. De novo synthesis of icariin has been achieved in Saccharomyces cerevisiae or Yarrowia lipolytica, but yields remain low and cannot meet the needs of industrial production.

[0004] The de novo synthesis of icariin requires the participation of multiple plant-derived enzymes, including 4′-O-methyltransferase, the last step in the icariin synthesis pathway. However, the current 4′-O-methyltransferase MpOMT4, which has a relatively high conversion rate, has problems such as low catalytic efficiency and poor substrate specificity. Although it can catalyze the methylation of 8-isopentenylkaempferol to icariin, its catalytic efficiency is low. In addition, it also has catalytic ability for the intermediate products of the synthesis pathway, naringenin and kaempferol, resulting in the consumption of precursors and the accumulation of large amounts of by-products, limiting the increase in icariin production. Summary of the Invention

[0005] To address the challenges of the existing technology, the present invention provides a flavonoid 4′-O-methyltransferase mutant, its preparation method, and its application. Specifically, through protein engineering, the present invention successfully obtained a series of flavonoid 4′-O-methyltransferase mutants that significantly enhance their catalytic activity toward 8-isopentenylkaempferol, thereby promoting the biosynthesis of icariin. Based on these research findings, the present invention was completed.

[0006] Specifically, the present invention relates to the following technical solutions:

[0007] In a first aspect, the present invention provides a flavone 4′-O-methyltransferase mutant, wherein the flavone 4′-O-methyltransferase mutant is a wild-type flavone 4′-O-methyltransferase, wherein one or more of the following sites are mutated:

[0008] mutations at positions 91, 112, 114, 134, 150, 161, 166, 176, 182, 197, 198, 200, 205, 209, 232, 247, 258, 277, and 336 to any of alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, lysine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine;

[0009] The amino acid sequence of the wild-type flavonoid 4′-O-methyltransferase is shown in SEQ ID NO.1.

[0010] Furthermore, the flavone 4′-O-methyltransferase mutant is a wild-type flavone 4′-O-methyltransferase, wherein one or more of the following sites are mutated:

[0011] (I) mutation of tyrosine at position 150 to alanine, cysteine, aspartic acid, glutamic acid, glycine, phenylalanine, arginine, serine, threonine, valine, or tryptophan;

[0012] (II) mutation of glycine at position 112 to alanine, cysteine, isoleucine, methionine, asparagine, arginine, threonine, valine, or tyrosine;

[0013] (III) mutation of leucine at position 114 to alanine, isoleucine, lysine, methionine, asparagine, glutamine, serine, or valine;

[0014] (IV) mutation of isoleucine at position 134 to cysteine, leucine, asparagine, or valine;

[0015] (V) Tyrosine at position 91 mutated to proline; Alanine at position 176 mutated to glutamic acid; Glycine at position 182 mutated to tyrosine; Alanine at position 200 mutated to lysine; Valine at position 205 mutated to isoleucine; Serine at position 209 mutated to valine; Phenylalanine at position 232 mutated to methionine; Isoleucine at position 247 mutated to valine; Methionine at position 260 mutated to leucine; Aspartic acid at position 277 mutated to glutamic acid;

[0016] (VI) Alanine at position 161 mutated to cysteine; threonine at position 166 mutated to isoleucine; lysine at position 197 mutated to isoleucine; leucine at position 198 mutated to isoleucine; glutamic acid at position 258 mutated to lysine; and glutamic acid at position 336 mutated to glutamine.

[0017] The second aspect of the present invention provides a polynucleotide molecule encoding the flavone 4′-O-methyltransferase mutant described in the first aspect.

[0018] The third aspect of the present invention provides a recombinant expression vector, which contains the polynucleotide molecule described in the second aspect.

[0019] The fourth aspect of the present invention provides a host cell, which contains the vector described in the third aspect or the chromosome integrated with the polynucleotide molecule described in the second aspect, or is capable of expressing the flavonoid 4'-O-methyltransferase mutant described in the first aspect.

[0020] The fifth aspect of the present invention provides a method for preparing the above-mentioned flavonoid 4′-O-methyltransferase mutant, comprising the steps of: culturing the host cell described in the fourth aspect to express the flavonoid 4′-O-methyltransferase mutant; and isolating and purifying the flavonoid 4′-O-methyltransferase mutant.

[0021] The sixth aspect of the present invention provides the use of the flavonoid 4′-O-methyltransferase mutant described in the first aspect, the polynucleotide molecule described in the second aspect, the recombinant expression vector described in the third aspect, and the host cell described in the fourth aspect in the synthesis of icariin.

[0022] In the present invention, the icariin synthesis can be biosynthesized, and the chassis used include but are not limited to the following hosts, such as Escherichia coli, Saccharomyces cerevisiae, Yarrowia lipolytica and filamentous fungi for biosynthesis.

[0023] The seventh aspect of the present invention provides a method for screening methyltransferase mutants that synthesize icariin, the method comprising: expressing a flavonoid 4′-O-methyltransferase mutant in a host cell, and synthesizing icariin by adding a substrate or de novo.

[0024] Beneficial technical effects of one or more of the above technical solutions:

[0025] The above technical solution provides a flavonoid 4'-O-methyltransferase mutant, its preparation method, and application. Using the promotion of icariin biosynthesis as a key indicator for identifying excellent enzyme properties, the present invention uses rationally designed enzyme engineering to modify the methyltransferase MpOMT4 from peppermint (Mentha x piperita), obtaining a series of flavonoid 4'-O-methyltransferase mutants. Experimental verification and screening have yielded flavonoid 4'-O-methyltransferase mutants that significantly increase icariin production.

[0026] During the screening process, the above technical solution not only provides a de novo biosynthetic method for preparing icariin, thereby screening for methyltransferase mutants, but also, considering the high price of icariin's precursor 8-isopentenylkaempferol, to reduce experimental costs, the above technical solution also provides a method for screening methyltransferase mutants, namely, expressing 8-isopentenyltransferase and methyltransferase in host cells (such as Escherichia coli), adding the substrate kaempferol to the culture medium, and synthesizing icariin through a two-step catalytic process. The mutants are then screened by directly detecting the icariin production by HPLC. Furthermore, to ensure an adequate supply of the isopentenyl donor dimethylallyl pyrophosphate (DMAPP), a heterologous mevalonate pathway is expressed in E. coli, thereby successfully screening for ideal flavonoid 4′-O-methyltransferase mutants, thus having great practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0028] Figure 1 This is a diagram showing the molecular docking results in Example 2 of the present invention.

[0029] Figure 2 This is a graph showing the icariin yield of the alanine scanning mutant fermented in Example 3 of the present invention; wherein, a is the result of the first round of alanine scanning fermentation, and b is the result of the second round of alanine scanning fermentation.

[0030] Figure 3 This is a graph showing the icariin yield of the fermentation of the 150-position tyrosine saturation mutant in Example 3 of the present invention.

[0031] Figure 4 This is a graph showing the icariin yield of the fermentation of the glycine 112 saturation mutant in Example 3 of the present invention.

[0032] Figure 5 This is a graph showing the icariin yield of the fermentation of the leucine saturation mutant at position 114 in Example 3 of the present invention.

[0033] Figure 6 This is a graph showing the icariin yield of the fermentation of the 134-isoleucine saturation mutant in Example 3 of the present invention.

[0034] Figure 7 This is a graph showing the icariin yield from fermentation of the PROSS designed point mutants in Example 3 of the present invention. DETAILED DESCRIPTION

[0035] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0036] It should be noted that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. In the following specific embodiments, if the experimental methods of specific conditions are not specified, they are generally in accordance with the conventional methods and conditions of molecular biology within the art, and such techniques and conditions are fully explained in the literature. See, for example, Sambrook et al., the techniques and conditions described in "Molecular Cloning: A Laboratory Manual", or in accordance with the conditions recommended by the manufacturer.

[0037] In a typical embodiment of the present invention, a flavone 4′-O-methyltransferase mutant is provided. The flavone 4′-O-methyltransferase mutant is a wild-type flavone 4′-O-methyltransferase, wherein one or more of the following sites are mutated:

[0038] mutations at positions 91, 112, 114, 134, 150, 161, 166, 176, 182, 197, 198, 200, 205, 209, 232, 247, 258, 277, and 336 to any of alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, lysine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine;

[0039] The amino acid sequence of the wild-type flavonoid 4′-O-methyltransferase is shown in SEQ ID NO.1.

[0040] Furthermore, the flavone 4′-O-methyltransferase mutant is a wild-type flavone 4′-O-methyltransferase, wherein one or more of the following sites are mutated:

[0041] (I) mutation of tyrosine at position 150 to alanine, cysteine, aspartic acid, glutamic acid, glycine, phenylalanine, arginine, serine, threonine, valine, or tryptophan;

[0042] (II) mutation of glycine at position 112 to alanine, cysteine, isoleucine, methionine, asparagine, arginine, threonine, valine, or tyrosine;

[0043] (III) mutation of leucine at position 114 to alanine, isoleucine, lysine, methionine, asparagine, glutamine, serine, or valine;

[0044] (IV) mutation of isoleucine at position 134 to cysteine, leucine, asparagine, or valine;

[0045] (V) Tyrosine at position 91 mutated to proline; Alanine at position 176 mutated to glutamic acid; Glycine at position 182 mutated to tyrosine; Alanine at position 200 mutated to lysine; Valine at position 205 mutated to isoleucine; Serine at position 209 mutated to valine; Phenylalanine at position 232 mutated to methionine; Isoleucine at position 247 mutated to valine; Methionine at position 260 mutated to leucine; Aspartic acid at position 277 mutated to glutamic acid;

[0046] (VI) Alanine at position 161 mutated to cysteine; threonine at position 166 mutated to isoleucine; lysine at position 197 mutated to isoleucine; leucine at position 198 mutated to isoleucine; glutamic acid at position 258 mutated to lysine; and glutamic acid at position 336 mutated to glutamine.

[0047] The amino acid sequence of the wild-type flavonoid 4′-O-methyltransferase is shown in SEQ ID NO.1.

[0048] In another specific embodiment of the present invention, the amino acid sequence of the flavonoid 4′-O-methyltransferase mutant has at least 80% homology to SEQ ID NO.1; more preferably, it has at least 90% homology; most preferably, it has at least 95% homology; such as at least 95%, 96%, 97%, 98%, 99% homology.

[0049] In another embodiment of the present invention, the number of mutation sites in the flavone 4′-O-methyltransferase mutant is 1-18, further 1-10, further 1-7, such as 1, 2, 3 or 7.

[0050] After testing, the seven-fold mutant FMA (Y150T / G112M / L114N / R91P / A176E / G182R / M260L) was found to have the best effect in promoting the synthesis of icariin, with an icariin production of 4.34 mg / L, which is 11.4 times that of the wild type.

[0051] In another embodiment of the present invention, a polynucleotide molecule is provided, wherein the polynucleotide molecule encodes the above-mentioned flavone 4′-O-methyltransferase mutant.

[0052] In another embodiment of the present invention, a recombinant expression vector is provided, wherein the recombinant expression vector contains the above-mentioned polynucleotide molecule of the present invention.

[0053] In another specific embodiment of the present invention, the recombinant expression vector is obtained by effectively linking the above-mentioned polynucleotide molecule to an expression vector, and the expression vector is any one or more of a viral vector, a plasmid, a phage, a phagemid, a cosmid or an artificial chromosome; the viral vector may include an adenoviral vector, a retroviral vector or an adeno-associated viral vector, and the artificial chromosome includes a bacterial artificial chromosome, a phage P1-derived vector, a yeast artificial chromosome or a mammalian artificial chromosome; preferably, the expression vector is a plasmid, and in a specific embodiment of the present invention, the plasmid is pET-28a(+).

[0054] In another specific embodiment of the present invention, a host cell is provided, which contains the vector described in the third aspect of the present invention or the chromosome integrated with the above-mentioned polynucleotide molecule, or is capable of expressing the flavonoid 4′-O-methyltransferase mutant.

[0055] The host cell can be a prokaryotic cell or a eukaryotic cell.

[0056] In another embodiment of the present invention, the host cell is any one or more of a bacterial cell and a fungal cell;

[0057] wherein the bacterial cell is any species within the genus Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas or Staphylococcus;

[0058] In another embodiment of the present invention, the bacterial cell is Escherichia coli, Agrobacterium tumefaciens, Agrobacterium rhizogenes, Lactococcus lactis, Bacillus subtilis, Bacillus cereus or Pseudomonas fluorescens.

[0059] The fungal cells include yeast (such as Saccharomyces cerevisiae, Pichia pastoris and Yarrowia lipolytica) and filamentous fungi.

[0060] In another specific embodiment of the present invention, a method for preparing the above-mentioned flavonoid 4′-O-methyltransferase mutant is provided, comprising the steps of: culturing the above-mentioned host cell of the present invention to express the flavonoid 4′-O-methyltransferase mutant; and isolating and purifying the flavonoid 4′-O-methyltransferase mutant.

[0061] In another embodiment of the present invention, there is provided the use of the above-mentioned flavonoid 4′-O-methyltransferase mutant, polynucleotide molecule, recombinant expression vector, and host cell in the synthesis of icariin.

[0062] In the present invention, the icariin synthesis can be biosynthesized, and the chassis used include but are not limited to the following hosts, such as Escherichia coli, Saccharomyces cerevisiae, Yarrowia lipolytica and filamentous fungi for biosynthesis.

[0063] In another embodiment of the present invention, a method for screening methyltransferase mutants that synthesize icariin is provided, the method comprising: expressing the above-mentioned flavonoid 4′-O-methyltransferase mutant in a host cell, and synthesizing icariin by adding a substrate (kaempferol) or de novo.

[0064] The present invention is further explained by the following examples, but is not intended to limit the present invention. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention.

[0065] Example 1

[0066] 1. Construction of plasmid pACYCDuet-1-EsPT2-MVAE-MVAE

[0067] The prenyltransferase gene PT2 from Epimedium sagittatum was codon-optimized and synthesized by Nanjing GenScript Biotech Co. (the optimized nucleotide sequence is shown in SEQ ID NO. 2) and inserted into the pACYCDuet-1 vector. The acetyl-CoA transacetylase / 3-hydroxy-3-methylglutaryl-CoA reductase gene mvaE (GenBank: AAG02439.1) and 3-hydroxy-3-methylglutaryl-CoA synthase gene mvaS (GenBank: AAG02438.1) from Enterococcus faecalis were codon-optimized and synthesized by Nanjing GenScript Biotech Co., Ltd. and constructed on the plasmid pET-28a(+). The optimized nucleotide sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0068] The mvaE gene was linearized with primers 1 (GAAGGAGATATACATATGAAAACAGTTGTAATAATTGATGCTCTAC) and 2 (ATGATCTCCCTCCTAGATCCTTACTGTTTCCTCAAGTCGTTGAG), the mvaS gene was linearized with primers 3 (TAGGAGGGAGATCATATGACAATTGGAATAGATAAAATATCATTTTTCG) and 4 (GCCGATATCCAATTGTTAGTTACGATAAGAACGAACCGTG), and the pACYCDuet-1 vector carrying the PT2 gene was linearized with primers 5 (ATGTATATCTCCTTCTTATACTTAACTAATATACTAAG) and 6 (CAATTGGATATCGGCCGG). The resulting fragments were ligated using ABclonal 2×MultiF Seamless Assembly Mix and transformed into Trelief (Qingke Biotech). 5α competent cells were plated on chloramphenicol plates. Plasmids were extracted from the screened positive clones and sequenced by Qingke Biotechnology (Qingdao) to obtain the recombinant plasmid pACYCDuet-1-EsPT2-MVAE-MVAE.

[0069] 2. Construction of plasmid pCDFDuet-1-MK-PMK-MVD1-IDI1

[0070] The following genes were synthesized by Nanjing GenScript Biotech Co., Ltd. The codon-optimized Methanosarcina mazei mevalonate kinase gene MK (GenBank: MH084473.1) from Escherichia coli and the phosphomevalonate kinase gene PMK (NCBI Gene ID: 855260) from Saccharomyces cerevisiae were constructed in a multiple cloning site of the plasmid pCDFDuet-1, with the genes linked by the RBS sequence ggatctaggagggagatcat. The mevalonate diphosphate decarboxylase 1 gene MVD1 (NCBI Gene ID: 855779) and the isopentenyl diphosphate delta isomerase 1 gene IDI1 (NCBI Gene ID: 855986) were linked by the RBS sequence ggatctaggaggtaatgata on the plasmid pCDFDuet-1.

[0071] MVD1 and IDI1 were linearized using primers 7 (GAAGGAGATATACATATGACCGTTTACACAGCATC) and 8 (TTTACCAGACTCGAGTTATAGCATTCTATGAATTTGCCTGTC). The pCDFDuet-1 vector carrying the MK and PMK genes was linearized at a separate multiple cloning site using primers 9 (CTCGAGTCTGGTAAAGAAACC) and 10 (ATGTATATCTCCTTCTTATACTTAACTAATATACTAAG). The fragments were ligated and transformed into competent cells, which were then plated on streptomycin plates. Plasmids were extracted and sequenced to obtain the plasmid pCDFDuet-1-MK-PMK-MVD1-IDI1.

[0072] Example 2

[0073] 1. Construction of wild-type methyltransferase strain

[0074] The wild-type methyltransferase gene (GenBank: AY337461.1) was codon-optimized and synthesized by GenScript Biotech and constructed on the plasmid pET-28a(+) to generate the recombinant plasmid pET-28a(+)-MpOMT4. The pACYCDuet-1-EsPT2-MVAE-MVAE and pCDFDuet-1-MK-PMK-MVD1-IDI1 plasmids constructed in Example 1, along with the pET-28a(+)-MpOMT4 plasmid carrying the wild-type methyltransferase gene, were co-transformed into BL21 Star (DE3) competent cells from Qingke Biotech. The cells were plated on chloramphenicol-streptomycin-kanamycin triple-resistance LB plates. Positive colonies that emerged were the wild-type methyltransferase strains.

[0075] 2. Homology modeling and molecular docking of methyltransferases

[0076] Homology modeling of the wild-type methyltransferase was performed using AlphaFold2, and molecular docking with the small molecule 8-isopentenylkaempferol was performed using AutoDock Vina, v1.1.2. Key amino acids around the active center were selected for mutation.

[0077] Figure 1 The molecular docking results show that the substrate small molecule 8-isopentenylkaempferol binds to the active pocket of the methyltransferase and forms hydrogen bonds with glutamine at position 110, serine at position 115, and aspartic acid at position 250.

[0078] 3. Construction of methyltransferase single-point mutant strains

[0079] Based on the results of molecular docking, an alanine scanning mutagenesis experiment was first performed. Using the recombinant plasmid pET-28a(+)-MpOMT4 obtained in Example 1 as a template, inverse PCR was performed using primers with 15bp homology arms encompassing the mutation site. The primer sequences are shown in Table 1. The PCR product was treated with Dpn I to remove the template, resulting in a recombinant plasmid carrying a single-point mutant of the methyltransferase. This recombinant plasmid was co-transformed into BL21Star (DE3) competent cells with the pACYCDuet-1-EsPT2-MVAE-MVAE and pCDFDuet-1-MK-PMK-MVD1-IDI1 plasmids from Example 1 to obtain the corresponding single-point mutant strain.

[0080] Table 1 Alanine scanning primer sequences

[0081]

[0082]

[0083]

[0084] 4. Construction of saturated mutants of amino acids at positions 150, 112, and 114 of methyltransferase

[0085] Based on the fermentation results of alanine scanning, saturation mutations were performed on positions 150, 112, and 114 of the methyltransferase. The primers used are shown in Table 2-4.

[0086] Table 2 Primer sequences for saturation mutation of amino acid position 150

[0087]

[0088]

[0089] Table 3 Primer sequences for amino acid 112 saturation mutation

[0090]

[0091]

[0092] Table 4 Primer sequences for saturation mutation of amino acid position 114

[0093]

[0094]

[0095] 5. PROSS design of methyltransferase

[0096] The sequence and predicted structure information of MpOMT4 were uploaded to the PROSS platform for automated design, and 10 point mutations were selected for construction.

[0097] The combined mutant MD1 (R91P / A176E / G182R / A200K / V205I / S209V / F232M / I247V / M260L / D277E) was obtained by combining the 10 point mutations designed by PROSS. Then, using MD1 as a template, another 6 point mutations (A161C, T166I, K197I, L198I, E258K, E336Q) were superimposed. The primers are shown in Table 5.

[0098] Table 5 Primer sequences for PROSS point mutation design

[0099]

[0100]

[0101] 6. Construction of methyltransferase combination mutants

[0102] Mutants with increased icariin production were gradually combined. The primers used are shown in Table 2-6. A series of combined mutants containing 2-3 mutation sites were obtained. Six double mutants were obtained by combining forward mutations at positions 150 and 112, and eight triple mutants were obtained by combining forward mutations at positions 150, 112, and 114. The best triple mutant, MpOMT4, was selected. Y150T / G112M / L114N As a template, the seven-fold mutant MpOMT4 was obtained by combining the four forward mutants designed in PROSS: R91P, A176E, G182R and M260L. Y150T / G112M / L114N / R91P / A176E / G182R / M260L , strains expressing methyltransferase combination mutants were obtained according to the same transformation method.

[0103] Table 6 Combination mutant primer sequences

[0104]

[0105]

[0106] Example 3

[0107] 1. Icariin fermentation production

[0108] Three replicates of each strain obtained in Example 2 were inoculated into 1 mL of LB liquid and cultured overnight at 37°C and 200 rpm. The next day, the bacterial solution was inoculated into 20 mL of TB medium at a ratio of 1%, and cultured under the same conditions for 1 hour and 40 minutes. The culture temperature was then lowered to 25°C and cultured for another 20 minutes until the culture OD reached 0. 600When the pH value reached the range of 0.4-0.8, the inducer IPTG was added at a final concentration of 0.2 mM and the substrate kaempferol was added at a final concentration of 100 mg / L, and the fermentation was continued for 72 hours.

[0109] 2. Extraction of fermentation products

[0110] Pipette 600 μL of fermentation broth and extract with 900 μL of ethyl acetate. Vortex at 3000 rpm for 20 minutes. Centrifuge at 13500 rpm for 10 minutes. Pipette 600 μL of the ethyl acetate layer, blow dry with high-purity nitrogen, and reconstitute the sample with 300 μL of methanol. Filter the methanol solution through a 0.22 μm filter membrane into the inner tube of a sample injection vial for direct HPLC analysis or store in a -20°C refrigerator.

[0111] 3. HPLC detection of icariin production level

[0112] HPLC analysis was performed using a Shimadzu LC-20A equipped with an SPD detector and a Shim-pack GIST C18 column (5 μm, 4.6 × 150 mm). Mobile phase A consisted of 0.1% formic acid in water, and mobile phase B consisted of acetonitrile. The column oven was set at 30°C. The time program was as follows: 50% at 0-8 min; 80% at 10-22 min; and 50% at 24-29 min. Fermentation products were detected at a wavelength of 360 nm.

[0113] Figure 2 a shows the results of the first round of alanine scanning fermentation. After the tyrosine at position 150 and the leucine at position 114 were mutated to alanine, the yield of icariin increased from 0.38 mg / L of the wild type to 0.54 mg / L and 0.47 mg / L respectively; in the second round of alanine scanning ( Figure 2 b) When glycine at position 112 was mutated to alanine, the icariin production increased from 0.39 mg / L in the wild type to 0.54 mg / L.

[0114] Figure 3 The results of saturation mutation of tyrosine at position 150 are shown. When tyrosine is mutated to alanine, phenylalanine, serine, and threonine, the icariin production increases from 0.39 mg / L of the wild type to 0.51 mg / L, 0.45 mg / L, 0.57 mg / L, and 0.82 mg / L, respectively. Figure 4 According to the results, after the glycine at position 112 was mutated to cysteine, isoleucine, methionine, threonine and valine, the icariin production was 0.73 mg / L, 0.74 mg / L, 0.60 mg / L, 0.68 mg / L and 0.86 mg / L, respectively, which was higher than the wild type of 0.42 mg / L. Figure 5It showed that the mutation of leucine at position 114 to lysine, methionine, asparagine, serine and valine increased the icariin production by more than 30%, from 0.40 mg / L of the wild type to 0.53 mg / L, 0.59 mg / L, 0.74 mg / L, 0.61 mg / L and 0.55 mg / L.

[0115] The results of PROSS point mutations are shown in Figure 6 The icariin yields of the point mutations R91P, A176E, G182L, and M260L were 0.54 mg / L, 0.68 mg / L, 0.53 mg / L, and 0.66 mg / L, respectively, representing increases of 31.7%, 65.8%, 29.3%, and 61.0%, respectively, compared to the wild type. Combining the E336Q mutation with the MD1 mutant resulted in an icariin yield of 0.71 mg / L, a 73.2% increase compared to the wild type.

[0116] By combining forward mutations at position 150 tyrosine and position 112 glycine, six double mutants were obtained, among which MpOMT4 Y150T / G112M It can produce 2.25mg / L of icariin, which is 492.1% higher than the wild type. Y150T / G112M Based on the above, a triple mutant was constructed by combining the forward mutation of leucine at position 114, the mutant MpOMT4 Y150T / G112M / L114N The highest icariin production was 3.83 mg / L, which was 9.6 times that of the wild type and 65.1% higher than that of the parent double mutant. Y150T / G112M / L114N / R91P / A176E / G182R / M260L ), the icariin production reached 4.34 mg / L, which was 11.4 times that of the wild type.

[0117] Amino acid / nucleotide sequence information involved in the present invention

[0118] OMT4

[0119] MVADEEVRVRAEAWNNAFGYIKPTAVATAVELGLPDILENHDGPMSLLELSAATDCPAEPLHRLMRFLVFHGIFKKTAKPPLSNEAVYYARTALSRLFTRDELGDFMLLQTGPLSQHPAGLTASSLRTGKPQFIRSVNGEDSWTDPVNGYHMKVFSDAMAAHARETTAAIVRYCPAAFEGIGTVVDVGGRHGVALEKLVAAFPWVRGISFDLPEIVAKAPPRPGIEFVGGSFFESVPKGDLVLLMWILHDWSDESCIEIMKKCKEAIPTSGKVMIVDAIVDEDGEGDDFAGARLSLDLIMMAVLARGKERTYREWEYLLREAGFTKFVVKNINTVEFVIEAYP(SEQ ID NO.1)

[0120] PT2

[0121]

[0122] mvaE

[0123]

[0124] mvaS

[0125]

[0126] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A flavonoid 4'-O-methyltransferase mutant, characterized in that: The flavone 4'-O-methyltransferase mutant is a wild-type flavone 4'-O-methyltransferase, wherein one or more of the following sites are mutated: mutations at positions 91, 112, 114, 134, 150, 161, 166, 176, 182, 197, 198, 200, 205, 209, 232, 247, 258, 277, and 336 to any of alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, isoleucine, lysine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and tyrosine; The amino acid sequence of the wild-type flavonoid 4'-O-methyltransferase is shown in SEQ ID NO.

1.

2. The flavone 4'-O-methyltransferase mutant according to claim 1, wherein The flavone 4'-O-methyltransferase mutant is a wild-type flavone 4'-O-methyltransferase, wherein one or more of the following sites are mutated: (I) mutation of tyrosine at position 150 to alanine, cysteine, aspartic acid, glutamic acid, glycine, phenylalanine, arginine, serine, threonine, valine, or tryptophan; (II) mutation of glycine at position 112 to alanine, cysteine, isoleucine, methionine, asparagine, arginine, threonine, valine, or tyrosine; (III) mutation of leucine at position 114 to alanine, isoleucine, lysine, methionine, asparagine, glutamine, serine, or valine; (IV) mutation of isoleucine at position 134 to cysteine, leucine, asparagine, or valine; (V) Tyrosine at position 91 mutated to proline; Alanine at position 176 mutated to glutamic acid; Glycine at position 182 mutated to tyrosine; Alanine at position 200 mutated to lysine; Valine at position 205 mutated to isoleucine; Serine at position 209 mutated to valine; Phenylalanine at position 232 mutated to methionine; Isoleucine at position 247 mutated to valine; Methionine at position 260 mutated to leucine; Aspartic acid at position 277 mutated to glutamic acid; (VI) Alanine at position 161 mutated to cysteine; threonine at position 166 mutated to isoleucine; lysine at position 197 mutated to isoleucine; leucine at position 198 mutated to isoleucine; glutamic acid at position 258 mutated to lysine; and glutamic acid at position 336 mutated to glutamine.

3. A polynucleotide molecule, characterized in that The polynucleotide molecule encodes the flavone 4'-O-methyltransferase mutant according to claim 1 or 2.

4. A recombinant expression vector, characterized in that: The recombinant expression vector contains the polynucleotide molecule according to claim 3.

5. A host cell, characterized in that The host cell contains the recombinant expression vector according to claim 4 or has the polynucleotide molecule according to claim 3 integrated into its chromosome, or is capable of expressing the flavonoid 4'-O-methyltransferase mutant according to any one of claims 1-2.

6. The host cell according to claim 5, wherein The host cell is a prokaryotic cell or a eukaryotic cell.

7. The host cell according to claim 6, wherein The host cell is any one or more of a bacterial cell and a fungal cell; The bacterial cell is any species within the genus Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas or Staphylococcus; The bacterial cell is Escherichia coli, Agrobacterium tumefaciens, Agrobacterium rhizogenes, Lactococcus lactis, Bacillus subtilis, Bacillus cereus or Pseudomonas fluorescens; The fungal cells include yeast and filamentous fungi; further, the yeast include but are not limited to Saccharomyces cerevisiae, Pichia pastoris and Yarrowia lipolytica.

8. A method for preparing the flavonoid 4'-O-methyltransferase mutant according to any one of claims 1 to 2, characterized in that: The method comprises the steps of: culturing the host cell according to any one of claims 5 to 7 to express the flavonoid 4'-O-methyltransferase mutant; and isolating and purifying the flavonoid 4'-O-methyltransferase mutant.

9. Use of the flavonoid 4'-O-methyltransferase mutant according to any one of claims 1-2, the polynucleotide molecule according to claim 3, the recombinant expression vector according to claim 4, or the host cell according to any one of claims 6-7 in the synthesis of icariin; Furthermore, the icariin synthesis is biosynthesis.

10. A method for screening methyltransferase mutants for synthesizing icariin, characterized in that: The method comprises: expressing the flavonoid 4'-O-methyltransferase mutant according to claim 1 or 2 in a host cell, and synthesizing icariin by adding a substrate or de novo.

Images