TMEM86A targeting siRNA and application thereof

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) targeting TMEM86A and application thereof, and relates to the technical field of biology, the siRNA comprises the following positive-sense strands and antisense strands: siRNA-001: a positive-sense strand: 5 '-GAAGAGCGAAGGACCCAAATT-3'; according to the tumor-associated macrophage, TMEM86A has a positive-sense strand of 5 '-TTTGGGTCCTTCGCTTCT-3', an antisense strand of 5 '-TTTGGGTCCTGTCGCTTCT-3', siRNA-002 has a positive-sense strand of 5 '-GGCTCATGGTTCGGTTTT-3', and an antisense strand of 5 '-AAACCGAACCCATGAGCCT-3'. According to the tumor-associated macrophage, single cell sequencing analysis finds that TMEM86A is highly expressed in tumor-associated macrophages, and the development of tumors is inhibited by designing siRNA of TMEM86A to target the tumor-associated macrophages in a colon cancer tumor microenvironment.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a TMEM86A-targeting siRNA and an application thereof. Background Art

[0002] Colon cancer is one of the most common malignancies. Approximately 25% of colon cancer patients have metastasized at initial diagnosis, and the mortality rate due to liver metastasis now exceeds 80%. Although various treatments are currently available to improve patient prognosis, the lack of relatively effective therapeutic targets remains a pressing issue.

[0003] Therefore, it is necessary to propose a siRNA targeting TMEM86A and its application to solve the above problems. Summary of the Invention

[0004] The purpose of the present invention is to solve the problems raised in the background technology.

[0005] In order to achieve the above-mentioned purpose, the present invention specifically adopts the following technical solutions:

[0006] An siRNA targeting TMEM86A, comprising the following sense and antisense strands:

[0007] siRNA-001:

[0008] Sense strand: 5′-GAAGAGCGAAGGACCCAAATT-3′;

[0009] Antisense strand: 5′-TTTGGGTCCTTCGCTCTTCTT-3′.

[0010] siRNA-002:

[0011] Sense strand: 5′-GGCTCATGGTGTTCGGTTTTT-3′;

[0012] Antisense strand: 5'-AAACCGAACACCATGAGCCTT-3'.

[0013] An application of an siRNA targeting TMEM86A, comprising the application of the above-mentioned siRNA targeting TMEM86A in any of the following:

[0014] a: The siRNA is used to prepare a reagent for inhibiting macrophage M2 polarization;

[0015] b: Preparation of reagents for activating the LPS response pathway in macrophages;

[0016] c: Preparation of drugs for treating tumors.

[0017] Furthermore, the macrophages are mammalian bone marrow-derived macrophages.

[0018] Furthermore, the drug includes siRNA molecules and a pharmaceutically acceptable carrier.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. The present invention found that TMEM86A is highly expressed in tumor-associated macrophages through single-cell sequencing analysis. By designing TMEM86A siRNA to target tumor-associated macrophages in the tumor microenvironment of colon cancer, the development of the tumor is inhibited.

[0021] 2. This invention reveals for the first time that TMEM86A gene knockdown regulates the immune microenvironment by inhibiting M2 polarization (CD206 is significantly reduced) and activating the LPS pathway.

[0022] 3. In the present invention, TMEM86A siRNA is used as a drug for treating tumors. The siRNA-based therapy targets tumor-associated macrophages, inhibits their M2 polarization or reshapes the immune microenvironment. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The SiTMEM86A of the present invention significantly knocked down TMEM86A expression in BMDM (about 95% or more).

[0024] Figure 2 The present invention detected by flow cytometry that knocking down TMEM86A inhibited macrophage M2 polarization.

[0025] Figure 3 The anti-tumor effect of SiTmem86a was tested in the CT26 subcutaneous tumor model.

[0026] Figure 4 The figure is the agarose gel electrophoresis result of the present invention.

[0027] Figure 5 This is the volcano plot of TMEM86A knockdown in the present invention.

[0028] Figure 6 The upregulated genes after knocking down TMEM86A in the present invention were significantly enriched in the LPS response pathway. DETAILED DESCRIPTION

[0029] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0030] See also Figures 1 to 6 , a siRNA targeting TMEM86A and its application

[0031] 1. Design target: Gene information:

[0032] Target gene name species Gene ID TMEM86A Mouse 67893

[0033] The target sequence was determined for the mRNA of the mouse TMEM86A gene (gene ID: 67893); according to the mRNA sequence of the mouse TMEM86A gene:

[0034]

[0035] Table 1 siRNA sequences and control sequences

[0036]

[0037] 2. Cell extraction and induction of mouse bone marrow-derived macrophages (BMDM): Under sterile conditions, take the femur and tibia of 6-week-old Bala / c female mice, remove the muscle tissue, place them in pre-cooled PBS, and cut the two ends of the bone (knee and hip joint sides) with scissors to expose the bone marrow cavity. Use a syringe (25G needle) to absorb PBS and rinse the bone marrow into a centrifuge tube. Repeat until the bone turns white. Use a pipette to blow the cell suspension and pass it through a 70μm cell sieve to remove broken bones and tissues. Add red blood cell lysis buffer at a ratio of 3:1, place at room temperature for 15 minutes, and then centrifuge (300×g, 5 minutes) and discard the supernatant. Add complete culture medium (containing M-CSF) to resuspend the cells and count them. Press 2×10 6 Cells were seeded at a density of 100 cells / well in a 6-well plate. After 3 days of culture, the complete medium (containing M-CSF) was replaced again. After 5 days of culture, half of the complete medium (containing M-CSF) was replaced. Subsequent siRNA transfection experiments were performed after 7 days of culture.

[0038] 3. Cell Transfection: Prepare a siRNA mixture by diluting 5 nmol of siRNA with 125 μL of serum-free RPMI-1640 medium and gently mixing. Simultaneously, prepare the transfection reagent by diluting 5 μL of Lipofectamine™ 3000 with 125 μL of serum-free RPMI-1640 medium. Mix the siRNA mixture and transfection reagent and let it stand at room temperature for 5-10 minutes. Then, slowly add the mixture to a six-well plate seeded with BMDM. Supplement with 740 μL of serum-free RPMI-1640 medium and incubate in a 37°C, 5% CO2 incubator for 18-48 hours.

[0039] 4. Validation of SiTMEM86A knockdown efficiency by QPCR. Total RNA from BMDM 48 hours after transfection was extracted using the Trizol method, and reverse transcription was performed using the UE All in One Reverse Transcription Kit to obtain cDNA. Based on the mouse TMEM86A mRNA sequence, TMEM86A primers were designed and synthesized (Table 2), and the qPCR kit from Yisheng Bio was used for detection. The reaction system is as follows (Table 3), and the relevant results are shown in Figure 1 , SiTMEM86A significantly knocked down TMEM86A expression in BMDM (about more than 95%).

[0040] Table 2 qPCR primers

[0041]

[0042] Table 3 Reaction system

[0043]

[0044] 5. Flow cytometry was used to detect the effect of macrophage M2 polarization after TMEM86A interference. BMDM were extracted according to the above method and 2×10 6 Cells were seeded at a density of 1 / 6-well plate and subsequently induced. After 7 days, SiRNA transfection was performed. After 96 hours, cells were collected with a cell scraper, washed 1-3 times with PBS, and centrifuged at 350g for 10 minutes at room temperature. FVS700 dead / alive dilution (1:1000) was prepared, the cell pellet was taken, 100 μL was added for resuspending, and staining was performed at room temperature for 10 minutes. After washing the cells 1-3 times with PBS again, Cd11b (PerCP-Cy5.5), F4 / 80 (APC), and CD206 (BV421) flow cytometry antibodies were added for staining at room temperature for 30 minutes. After staining, the cells were washed 1-3 times with PBS and tested on the machine. The results showed that after interfering with TMEM86A expression, the M2 polarization of macrophages was significantly reduced ( Figure 2 ).

[0045] 6. To further test the anti-tumor effect of SiTMEM86A, a CpG sequence targeting tumor-associated macrophages (TCCATGACGTTCCTGATGCT) was added, and a CT26 subcutaneous tumor model (2*10^6 / mouse) was constructed and injected into the right subcutaneous part of 6-week-old female Bala / c mice. After 10 days, the mice were divided into PBS, SiNC-CpG, SiTMEM86A-001-CpG, and SiTMEM86A-002-CpG groups. Each group was injected with the corresponding siRNA (5nmol / mouse) for a total of 1 injection. The mice were killed 22 days later to calculate the tumor volume. The results showed that compared with the SiNC-CpG group, the tumors in the SiTMEM86A-001-CpG and 002-CpG groups were significantly reduced ( Figure 3 ).

[0046] 7. Transcriptome sequencing was used to detect the enrichment of macrophage pathways after TMEM86A interference. Total RNA was extracted from mouse bone marrow-derived macrophages (BMDM) 48 hours after transfection according to the above method and quality control was performed (Table 4, Figure 4 ), and then by mRNA Purification Kit (GenSeq, Inc., Shanghai, China) was used to enrich mRNA. The enriched mRNA was fragmented into ~300 nt length and then Directional RNA Library Prep Kit (GenSeq, Inc., Shanghai, China) was used to construct the sequencing library. First, the first-strand cDNA was synthesized using reverse transcriptase and random primers, and the second-strand was synthesized in a mixture containing dUTP for chain-specific labeling. The double-stranded cDNA fragments were end-repaired, adapters were added, and the cDNA with adapters was PCR amplified and purified to obtain the sequencing library. Finally, 150bp double-end sequencing was performed on the sequencer. The results showed that interference with TMEM86A led to the downregulation of 184 genes and the upregulation of 163 genes, and the upregulated genes were significantly enriched in the LPS response pathway that induces M1 polarization ( Figure 5 、 Figure 6 ).

[0047] Table 4 RNA purity and concentration detection

[0048] Sample ID Sample name Abbreviation 0D260 / 280 0D260 / 230 Concentration (ng / μl) 1 SiNC-1 N1 1.83 1.82 363.91 2 SiNC-2 N2 1.88 1.83 369.25 3 SiNC-3 N3 1.86 1.85 391.13 4 SiTMEM86A-001-1 T1 1.89 1.82 437.50 5 SiTMEM86A-001-2 T2 1.87 1.83 431.59 6 SiTMEM86A-001-3 T3 1.85 1.86 382.90

[0049] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. The scope of patent protection of the present invention shall be based on the claims. Any equivalent structural changes made using the description and drawings of the present invention should also be included in the scope of protection of the present invention.

Claims

1. A siRNA targeting TMEM86A, characterized in that: Contains the following sense and antisense strands: siRNA-001: Sense strand: 5′-GAAGAGCGAAGGACCCAAATT-3′; Antisense strand: 5′-TTTGGGTCCTTCGCTCTTCTT-3′. siRNA-002: Sense strand: 5′-GGCTCATGGTGTTCGGTTTTT-3′; Antisense strand: 5'-AAACCGAACACCATGAGCCTT-3'.

2. A use of an siRNA targeting TMEM86A, comprising the use of the siRNA targeting TMEM86A according to claim 1 in any of the following: a: Preparation of reagents to inhibit macrophage M2 polarization; b: Preparation of reagents for activating the LPS response pathway in macrophages; 3. The use of siRNA targeting TMEM86A according to claim 2, characterized in that: The macrophages are mammalian bone marrow-derived macrophages.

4. The use of siRNA targeting TMEM86A according to claim 2, characterized in that: The siRNA targeting TMEM86A is also used to prepare a drug for treating tumors, which includes an siRNA molecule and a pharmaceutically acceptable carrier.

Images