Detection primer and probe for large yellow croaker pyramidal worm and application of detection primer and probe
By designing specific fluorescent quantitative PCR detection primers and probes, combining Taqman-MGB probes and isothermal amplification technology, the problems of rapid, sensitive and specific detection of trypanosomes in large yellow croaker were solved, and efficient pathogen detection was achieved.
Patent Information
- Application Number
- CN202511105823.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2045-08-08
AI Technical Summary
Existing technologies make it difficult to detect trypanosomes in large yellow croaker quickly, sensitively and specifically, posing a serious threat to the large yellow croaker farming industry.
Specific fluorescence quantitative PCR detection primers and probes were designed, combined with Taqman-MGB probes and isothermal amplification technology to achieve rapid, sensitive and specific detection of trypanosomes in large yellow croaker.
The test was completed within 1 hour, with a sensitivity of 9.58 copies/reaction, and no cross-reaction with other aquatic pathogens, making it suitable for on-site diagnosis.
Smart Images

Figure CN120624693A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial detection, and particularly relates to a detection primer and probe for trypanosoma crocea and applications thereof. Background Art
[0002] Large yellow croaker is an important marine aquaculture fish with a large aquaculture yield. The frequent occurrence of various bacterial, viral, and parasitic diseases poses a major threat to the healthy development of the large yellow croaker aquaculture industry. As an emerging parasitic pathogen with a long epidemic period, trypanosomes cause extremely high mortality rates in large yellow croaker, resulting in huge economic losses to the large yellow croaker industry and are a major parasitic pathogen that endangers the large yellow croaker industry. Currently, detection of this pathogen mainly relies on microscopic examination or comparison analysis based on genetic nucleic acid sequences, which cannot meet the production requirements for sensitive and rapid diagnosis of pathogens. Quantitative PCR detection methods based on the SYBR Green I dye method have the technical defect of low specificity in application. Given the serious harm this pathogen poses to the large yellow croaker aquaculture industry, the establishment of sensitive, specific, and rapid molecular detection methods for this pathogen has become an urgent requirement for the healthy development of the industry. Summary of the Invention
[0003] The purpose of the present invention is to provide large yellow croaker ( Larimichthys crocea )Trypanosoma ( Trypanosoma sp.), and also provide application methods of the primers and probes.
[0004] The nucleotide sequences of the primers and probes for detecting trypanosoma crocea of the present invention are as follows: (1) Nucleotide sequences of four sets of fluorescent quantitative PCR detection primers and probes: Nucleotide sequences of the first set of primers and probes: 1) Primer 1: Tr _F: 5'-TTCGAATTTGGTGACCCAGG-3', as shown in SEQ ID NO: 1; 2) Primer 2: Tr _R: 5'-ACATGCGAAAATCAGGAAGG-3', as shown in SEQ ID NO: 2; 3) Probe: Tr _Probe: 5'-TCCGTGAACACATTCAGAA-3', as shown in SEQ ID NO: 3; The nucleotide sequences of the second set of primers and probes are: 1) Primer 1: Tr _F: 5′-CGGGCGCCTAGTTTTATCTG-3′, as shown in SEQ ID NO: 4; 2) Primer 2: Tr_R: 5'-TGCACCGAGAGGAAAAGACAA-3', as shown in SEQ ID NO: 5; 3) Probe: Tr _Probe: 5'-TACCGATGCAGGAGGGA-3', as shown in SEQ ID NO: 6; The nucleotide sequences of the third set of primers and probes are: 1) Primer 1: Tr _F: 5'-GTCGCCTTTGTGGGAAACC-3', as shown in SEQ ID NO: 7; 2) Primer 2: Tr _R: 5′-GCAGTGAGTTGAGGGAATGCA-3′, as shown in SEQ ID NO: 8; 3) Probe: Tr _Probe: 5'-TCGGCTTGTCTTTTC-3', as shown in SEQ ID NO: 9; The nucleotide sequences of the fourth set of primers and probes are: 1) Primer 1: Tr _F: 5'-TTATGGAGTTGTGCGACAAGC-3', as shown in SEQ ID NO: 10; 2) Primer 2: Tr _R: 5'-CTCCCTCCTGCATCGGTAC-3', as shown in SEQ ID NO: 11; 3) Probe: Tr _Probe: 5'-TATCTGGTGCCCGTCGC-3', as shown in SEQ ID NO: 12.
[0005] The first set of fluorescent quantitative PCR detection primers and probes were designed based on the highly conserved and species-specific 90bp nucleotide sequence of the SSUrRNA gene of Trypanosoma crocea, the nucleotide sequence of which is: TTCGAATTTTGGTGACCCAGGCCCTTGTGGTCCGTGAACACATTCAGAAACAAGAAACACGGGAGTGGTTCCCTTCCTGATTTTCGCATGT, as shown in SEQ ID NO: 13.
[0006] When using the fluorescent quantitative PCR detection primers and probes for detection, primers and probes can be used simultaneously or only primers can be used. When using the probe, the 5' end and 3' end of the probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group. Preferably, the probe can be a Taqman-MGB probe, with the 5' end modified with a fluorescent reporter group 6-carboxyfluorescein (6-FAM) and the 3' end modified with MGB (Minor groove binder)-NFQ (Nonfluorescent quencher); when not using the probe, in addition to the primers, Tr _F and Tr In addition, a chimeric fluorescent dye is added to the detection system.
[0007] The final concentrations of the primers and probes in the detection system are 0.1-0.8 μmol / L and 0.1-0.5 μmol / L, respectively, preferably 0.3 μmol / L and 0.2 μmol / L.
[0008] The reaction program of fluorescence quantitative PCR is as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s; 58-63°C (preferably 60°C) for 30-34 s, for 40 cycles.
[0009] Test result interpretation: In the absence of contamination in the negative control, positive samples will exhibit an amplification curve in fluorescent quantitative PCR using the probe; in fluorescent quantitative PCR without the probe, positive samples will exhibit an amplification curve and a single-peak melting curve. For pathogen quantification, the pathogen load in the sample can be calculated based on the linear relationship between the logarithmic value (x) of the nucleic acid copy number of the constructed recombinant plasmid standard and its corresponding threshold cycle Ct value (y), as well as the Ct value of the test sample. For the first set of fluorescent quantitative PCR assays based on the Taqman-MGB probe, the linear expression is y = -3.169x + 39.784.
[0010] (2) Nucleotide sequences of two sets of isothermal amplification detection primers: The nucleotide sequence of the first set of isothermal amplification primers: 1) Primer 1: Tr _F3: 5′-AGGAGCAGCCTATGAGCT-3′, as shown in SEQ ID NO: 14; 2) Primer 2: Tr _B3: 5′-CATTCCTGGAAGCAGTGAGT-3′, as shown in SEQ ID NO: 15; 3) Primer 3: Tr _FIP: 5′-CCGCTTGTCGCACAACTCCATATTTTCCGTTTCGGCTTTTGTTGG-3′, as shown in SEQ ID NO: 16; 4) Primer 4: Tr _BIP: 5′-CCGTCGCCTTTGTGGGAAACCTTTTGGGAATGCACCGAGAGGA-3′, as shown in SEQ ID NO: 17; 5) Primer 5: Tr _LB: 5′-CCGTACCGATGCAGGAGGGA-3′, as shown in SEQ ID NO: 18; The nucleotide sequence of the second set of isothermal amplification primers: 1) Primer 1: Tr _F3: 5′-GCACTGGTATGTCCCGTTC-3′, as shown in SEQ ID NO: 19; 2) Primer 2: Tr _B3: 5′-CTCATAGGCTGCTCCTTTGT-3′, as shown in SEQ ID NO: 20; 3) Primer 3: Tr _FIP: 5'-AAGGGAACCACTCCCGTGTTTCTTTTACTTCGAATTTGGTGACCCA-3', as shown in SEQ ID NO: 21; 4) Primer 4: Tr _BIP: 5'-TCGCATGTCATGCATGCCAGGTTTTAAGTCGGATGACTGCTTTGG-3', as shown in SEQ ID NO: 22; 5) Primer 5: Tr _LF: 5′-TGTTCACGGACCACAAGGG-3′, as shown in SEQ ID NO: 23; 6) Primer 6: Tr _LB: 5′-GGGCGCCCGTGATTTTT-3′, as shown in SEQ ID NO: 24.
[0011] When using isothermal amplification detection primers for detection (Loop-mediated Isothermal Amplification, LAMP), the following primer combinations can be used: Tr _F3, Tr _B3,Tr _FIP and Tr_ BIP; Can also be Tr_ F3, Tr_ B3, Tr_ FIP, Tr_ BIP and Tr_ LF; Can also be Tr_ F3, Tr_ B3, Tr_ FIP, Tr_ BIP and Tr_ LB; You can also Tr_ F3, Tr_ B3, Tr_ FIP, Tr_ BIP, Tr_ LF and Tr_ LB.
[0012] The reaction temperature of LAMP was 60.0°C-68.0°C, and the reaction was repeated for 60 cycles, with each cycle lasting 1 min.
[0013] The LAMP detection reaction system includes the following components: 10×Isothermal amplification buffer 2.5μL, MgSO4 with a final concentration of 4.0-12.0mM, betaine with a final concentration of 0.1-1.4mM, dNTPs with a final concentration of 0.8-1.8mM, 20μmol / L Tr _FIP / Tr _BIP 2 μL, 10 μmol / L Tr _F3 / Tr _B3 0.5μL, 20μmol / L Tr _LF / Tr _LB 1μL, final concentration is 0.128-0.576U / uL Bst 2.0 WarmStart ® DNA polymerase (8000U / mL, New England BioLabs), 1μL of DNA template of large yellow croaker trypanosoma, and EvaGreen with a final concentration of 0.5-2.5μmol / L can also be added to the above system. ® Dye (Biotium), the detection system was finally filled with water to 25 μL.
[0014] When adding EvaGreen ®When using Dye, the test is placed in a quantitative PCR instrument. Based on the comprehensive consideration of factors such as the lower Ct value in the test and the cost of the reagent to be optimized, the detection temperature of the detection reaction and the amount of reagent used in the system are determined. In the quantitative analysis of pathogen detection, the pathogen load in the sample can be calculated based on the linear relationship between the template amount and the Ct value. When EvaGreen is not added, the detection temperature and the amount of reagent used in the system are determined. ® When dyeing, the test can be performed in a PCR instrument or under simple constant temperature conditions (such as a metal bath or water bath). The detection temperature and reagent dosage in the system are determined based on a comprehensive consideration of factors such as the brightness of the ladder-like bands on the electrophoresis product and the cost of the reagents to be optimized. In addition to using the electrophoresis results for judgment, the color change of the reaction product after adding the chimeric fluorescent dye to the test product can also be used for visual diagnosis of the test sample.
[0015] The primers and probes for detecting trypanosoma spp. of the present invention can be used for the detection and quantitative analysis of trypanosoma spp. for non-disease diagnosis and treatment purposes, including for preparing detection reagents or kit products.
[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. Short detection time, high sensitivity and strong specificity: The fluorescent quantitative PCR based on the Taqman-MGB probe of the present invention can complete the reaction within 1 hour, with a detection sensitivity of 9.58 copies / reaction; there is no cross-reaction with a variety of different trypanosomes and fishery aquaculture pathogens during the detection; the primers used for isothermal amplification of the present invention can complete the reaction within 15-60 minutes.
[0017] 2. The test can be applied to on-site diagnosis: The isothermal amplification detection primer provided by the present invention can complete the detection under simple constant temperature conditions (such as a water bath or metal bath, etc.). After the detection reaction is completed, a chimeric fluorescent dye such as SYBR Green or GeneFinder is added to the reaction tube. TM Etc., or adding self-luminous fluorescent dyes such as calcein or hydroxynaphthol blue, etc., can realize on-site rapid diagnosis of pathogens through the color change of the reaction tube. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The Taqman-MGB fluorescence quantitative PCR amplification curve of the large yellow croaker trypanosoma in Example 4, wherein 1-10: 9.58×10 9 -9.58×10 0 copies / μL, 11: negative control; Figure 2This is the standard curve of Taqman-MGB fluorescence quantitative PCR for Trypanosoma crocea in Example 4; Figure 3 This is a graph showing the specific amplification curve of the Taqman-MGB fluorescent quantitative PCR detection of trypanosoma croaker in Example 5, wherein 1: plasmid standard, 2-15: other pathogens except trypanosoma in Table 2, 16: negative control, 17: blank control; Figure 4 This is the amplification curve of the large yellow croaker trypanosoma Taqman-MGB fluorescence quantitative PCR sample detection in Example 5, wherein 1: trypanosoma plasmid standard 9.58×10 5 copies / μL, 2: sample 20241211010, 3: sample 20241211037, 4: sample 20241211003, 5: sample 20241211030, 6: sample 20241211031, 7: sample 20241211026, 8: sample 20241211041, 9: sample 20241211011, 10: Trypanosomatid plasmid standard 9.58×10 2 copies / μL, 11-12: negative control, 13: blank control; Figure 5 This is the amplification curve of the specificity verification of the large yellow croaker trypanosoma Taqman-MGB fluorescence quantitative PCR in Example 5, wherein 1-2: trypanosoma plasmid standard 1.29×10 5 copies / μL, 3-5: blank control, 6-7: recombinant plasmid pUC57_T_86 (114 ng / μL); Figure 6 This is the amplification curve of the LAMP detection of trypanosomes from large yellow croaker, where 1-3: large yellow croaker trypanosome-positive samples 20240921001, 20240921002 and 20240921003, 4: sample 20250511001, 5: sample 20250516029, 6: sample 20250711006, 7: sample 20250711007, 8 and 9: blank controls. DETAILED DESCRIPTION
[0019] To further illustrate the method and effects of the present invention, the present invention is further described below with reference to the following examples. Unless otherwise specified, the drugs and materials used in the following examples are commercially available.
[0020] Example 1: Sample collection of large yellow croaker trypanosoma and design of primers and probes From 2024 to 2025, we collected over 200 samples of trypanosomes from large yellow croaker aquaculture cages in the waters of Ningde, Fujian Province. Based on the SSU rRNA gene sequence analysis results of the samples, four sets of fluorescent quantitative PCR primers and probes were designed. Their nucleotide sequences are as follows: Nucleotide sequences of the first set of primers and probes: 1) Primer 1: Tr _F:5'-TTCGAATTTGGTGACCCAGG-3', 2) Primer 2: Tr _R: 5'-ACATGCGAAAATCAGGAAGG-3', 3) Probe: Tr _Probe:5'-TCCGTGAACACATTCAGAA-3'; The nucleotide sequences of the second set of primers and probes are: 1) Primer 1: Tr _F: 5'-CGGGCGCCTAGTTTTATCTG-3', 2) Primer 2: Tr _R: 5'-TGCACCGAGAGGAAAAGACAA-3', 3) Probe: Tr _Probe:5'-TACCGATGCAGGAGGGA-3'; The nucleotide sequences of the third set of primers and probes are: 1) Primer 1: Tr _F: 5'-GTCGCCTTTGTGGGAAACC-3', 2) Primer 2: Tr _R: 5'-GCAGTGAGTTGAGGGAATGCA-3', 3) Probe: Tr _Probe:5'-TCGGCTTGTCTTTTTC-3'; The nucleotide sequences of the fourth set of primers and probes are: 1) Primer 1: Tr _F: 5'-TTATGGAGTTGTGCGACAAGC-3', 2) Primer 2: Tr _R: 5'-CTCCCTCCTGCATCGGTAC-3', 3) Probe: Tr _Probe:5'-TATCTGGTGCCCGTCGC-3'.
[0021] The first set of Taqman-MGB fluorescence quantitative PCR primers Tr _F / Tr _R corresponds to the nucleotide sequence shown in SEQ ID NO: 13 in the SSUrRNA gene of large yellow croaker trypanosoma. By sequencing the gene in the samples we collected and comparing it with the published nucleotide sequences of the gene, it was shown that the nucleotide sequence is highly conserved and species-specific, and can be used for the specific detection of large yellow croaker trypanosoma.
[0022] Taking the first set of Taqman-MGB fluorescence quantitative PCR detection primers and probes as an example, the application of them in the detection of trypanosomatids in large yellow croaker is further explained.
[0023] Example 2: Recombinant plasmid standard pMD18_ in the detection of trypanosoma spp. Tr Construction Design of standard primers based on the SSU rRNA gene of Trypanosoma crocea Tr_ P_F (5'-TCTGTTTCGGGTGGTGGG-3', as shown in SEQ ID NO: 25) and Tr_ P_R (5'-TTCGTCTTGGTGCGGTCT-3', as shown in SEQ ID NO: 26). PCR amplification was performed, and the PCR system of 25 μL was 10 μmol / L Tr_ P_F / Tr_ 0.5 μL of each PCR product, 12.5 μL of Premix Ex Taq Mix (TaKaRa, Dalian), 1 μL of template, and 10.5 μL of sterile water were used. The PCR program was 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 63°C for 30 s, and 72°C for 50 s, followed by an extension at 72°C for 8 min. A 997-bp PCR product was obtained, which was recovered by gel extraction and ligated into the pMD18-T vector (TaKaRa, Dalian) to obtain the recombinant plasmid standard, pMD18_. Tr The concentration of pMD18_ was determined by using a nucleic acid concentration meter (NanoDrop 2000c). Tr The concentration was then converted into the target gene copy number by calculation and stored at -20℃ for future use.
[0024] Example 3: Optimization of primer and probe concentrations for fluorescent quantitative PCR detection of trypanosoma spp. Using the first set of primers in fluorescent quantitative PCR Tr _F / Tr _R and probe Tr _Probe for testing.
[0025] Using Premix Ex Taq TM(Probe qPCR) kit (TakaRa, Dalian), the primers in the system Tr _F / Tr The final concentrations of _R were 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, and 0.8 μmol / L, respectively. Tr The final concentrations of _Probe were 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L, Premix Ex Taq (Probe qPCR) (2×) 10 μL, 0.2 μL ROXReference Dye II (50×), and 1 μL DNA template were added, and the mixture was filled to 20 μL with ddH2O. Quantitative PCR was performed in an Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific, USA). Reaction conditions included 40 cycles of initial denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, and detection at 60°C for 34 s. Based on factors such as the detection Ct value, fluorescence intensity increase (ΔRn), and reagent cost, the optimal primer and probe concentrations were determined to be 0.3 μmol / L and 0.2 μmol / L, respectively. These results were used in subsequent testing of this method.
[0026] Example 4: Standard curve, detection sensitivity and repeatability evaluation of fluorescent quantitative PCR method (1) Standard curve and detection sensitivity Use EASY Dilution (for Real Time PCR) to dilute the recombinant plasmid standard pMD18_ Tr Get 9.58×10 9 -9.58×10 0 copies / μL, using this as a template, the first set of Taqman-MGB fluorescent quantitative PCR primers and probes for large yellow croaker trypanosoma were used for amplification. The results showed that the detection sensitivity within 40 cycles was 9.58 copies / reaction ( Figure 1 ), the linear expression of the logarithmic value (x) of nucleic acid copy number and Ct value (y) is y=-3.169x+39.784, R 2 =1, E=106.822%( Figure 2 ).
[0027] (2) Repeatability evaluation 9.58×10 9 -9.58×10 0 copies / μL of pMD18_ TrThe first set of Taqman-MGB fluorescent quantitative PCR primers and probes for large yellow croaker trypanosoma was used as a template for intra- and inter-batch detection. Three replicates were set for each concentration. The intra- and inter-batch coefficients of variation (CV) calculated based on the mean Ct value and standard deviation (SD) were 0.02%-0.63% and 0.40%-1.22%, respectively (Table 1), indicating that the method can provide stable detection results within this template concentration range.
[0028] Table 1 Repeatability of Taqman-MGB fluorescence quantitative PCR for Trypanosoma spp.
[0029] Example 5: Specificity of large yellow croaker trypanosoma detection by fluorescence quantitative PCR Shrimp hepatocystis ( Enterocytozoon Hepatopenaei , EHP), Sarcospora ( Amesonportunus )、Epinephelus enterocolitica( Enterospora epinepheli )、Blood egg Whipworm( Hematodinium perezi ), White Spot Syndrome Virus (WSSV), Infectious myonecrosis virus (IMNV), Decapod iridescent virus 1 (DIV1), Vibrio harveyi ( Vibrio harveyi ), Vibrio parahaemolyticus ( V. parahaemolyticus ), Vibrio cannerii ( V. campbellii ) 、 Photobacterium mermaniformis subspecies mermaidii ( Photobacterium damselae subsp. damselae )、 Nocardia sp.、Neobenedenia sp.、 Aestabdella sp. and other aquatic animal pathogenic DNA as templates (Table 2), pMD18_ Tr The specificity analysis of the first set of Taqman-MGB fluorescence quantitative PCR method for large yellow croaker trypanosomes was performed using nucleic acid from healthy large yellow croaker tissue as a negative control and sterile enzyme-free water as a blank control. The test was repeated three times. The test results showed that the method can specifically detect large yellow croaker trypanosomes and has no cross-reaction with DNA from other common pathogens in aquatic products ( Figure 3 ), in actual sample testing, positive samples of trypanosomes can also be detected in the samples ( Figure 4 ).
[0030] Table 2 Pathogens used in specific detection
[0031] Specificity detection, another synthesis Trypanosoma The 86 bp nucleotide base sequence of sp. T _86 is as follows: TTCGAATTGGTGACCCAGGCCCTTGTGGTCCGTGAACATTCAGAAACAAGAAACACGGGAGTGGTTCCTTCCTGATTTTCGCATGT, as shown in SEQ ID NO: 27. This synthetic sequence is T.carassii (OL963935.1, OL963934.1, OQ130039.1, OQ130042.1, OL963926.1), T. remakii (OQ130040.1), T.ophiocephali (EU185634.1), T.siniperca (DQ494415.1), T. granulosum (AJ620551.1), T. cobitis (AJ009143.1) and T.murmanensis (DQ016616.1) and other trypanosomatids, but there are four inconsistent bases with the highly conserved and species-specific 90bp nucleotide sequence of the SSUrRNA gene of trypanosomatids from large yellow croaker as shown in SEQ ID NO: 13, two of which are located in the probe nucleotide sequence of the first set of fluorescent quantitative PCR detection primers and probes of the present invention. The above-mentioned synthetic sequence SEQ ID NO: 27 was ligated with the pUC57 vector and transformed into Escherichia coli ( Escherichia Coli ) TOP10, obtained pUC57_ T _86 recombinant plasmid, pUC57_ T _86 recombinant plasmid (114ng / μL) was used as template, and the first set of Taqman-MGB fluorescence quantitative PCR method for trypanosomes from yellow croaker was repeated three times with pUC57_ T _86 recombinant plasmid templates had no cross reaction ( Figure 5 ), the results show that the present invention has good detection specificity.
[0032] Example 6: Detection of large yellow croaker trypanosoma by fluorescent quantitative PCR in clinical samples pMD18- Tr As a positive control, the first set of Taqman-MGB fluorescent quantitative PCR primers and probes for trypanosomatids from yellow croaker were used to detect 44 blood samples of yellow croaker (collected from cage culture in Ningde waters of Fujian Province). The results are shown in Table 3. Among the 44 samples, 36 were positive and 8 were negative, with a positive rate of 81.82%, which was converted to a copy number of 3.23×10 3 -1.93×10 5 copies / μL.
[0033] Table 3 Clinical sample testing
[0034] Example 7: Design of primers for isothermal amplification of trypanosoma spp. Based on the conserved region of the SSUrRNA gene of the large yellow croaker trypanosomes we collected, two sets of detection primers for isothermal amplification were designed as follows: Composition and nucleotide sequence of the first set of isothermal amplification primers: 1) Primer 1 Tr _F3: 5'-AGGAGCAGCCTATGAGCT-3', 2) Primer 2 Tr _B3:5'-CATTCCTGGAAGCAGTGAGT-3', 3) Primer 3 Tr _FIP: 5'-CCGCTTGTCGCACAACTCCATATTTTCCGTTTCGGCTTTTGTTGG-3', 4) Primer 4 Tr _BIP: 5'-CCGTCGCCTTTGTGGGAAACCTTTTGGGAATGCACCGAGAGGA-3', 5) Primer 5 Tr _LB: 5'-CCGTACCGATGCAGGAGGGA-3'.
[0035] The composition and nucleotide sequence of the second set of isothermal amplification primers: 1) Primer 1 Tr _F3: 5'-GCACTGGTATGTCCCGTTC-3', 2) Primer 2 Tr _B3: 5'-CTCATAGGCTGCTCCTTTGT-3', 3) Primer 3 Tr _FIP: 5'-AAGGGAACCACTCCCGTGTTTCTTTTACTTCGAATTTGGTGACCCA-3', 4) Primer 4 Tr _BIP: 5'-TCGCATGTCATGCATGCCAGGTTTTAAGTCGGATGACTGCTTTGG-3', 5) Primer 5 Tr_LF:5'-TGTTCACGGACCACAAGGG-3', 6) Primer 6 Tr _LB:5'-GGGCGCCCGTGATTTTT-3'.
[0036] Example 8: Isothermal amplification detection of trypanosoma spp. The LAMP assay for Trypanosoma crocea was performed in a real-time fluorescence quantitative PCR instrument (Bio-Rad, USA). Taking the first set of isothermal amplification primers as an example: the 25 μL LAMP reaction system contained 2.5 μL of 10×Isothermal amplification buffer (containing 2.0 mM Mg 2+ ), 100mM MgSO41.0μL, 5.0M Betaine 1.0μL, 10mM dNTPs3.0μL, 20μM Tr_ FIP / BIP 2.0 μL, 10 μM Tr_ F3 / B3 0.5μL, 20μM Tr_ LB (1.0 μL), 8000 U / mL Bst2.0 WarmStart® DNA Polymerase (New England BioLabs, USA) (1.6 μL), 20× EvaGreen® Dye (25 μM, Biotium, USA) (0.75 μL), 1.0 μL DNA template, and RNase-free water were added to 25 μL. In the LAMP assay for Trypanosoma crocea, the DNA template was denatured at 95°C and added to the reaction system. Based on previous optimization results, the reaction temperature was 65°C. The assay was repeated for 60 cycles, each lasting 1 minute. After the reaction, the system was incubated at 80°C for 5 minutes to terminate the reaction.
[0037] In the specific detection, trypanosomes from large yellow croaker ( Trypanosoma sp.), Pseudomonas ayuminergicus ( Pseudomonas plecoglossicida ) 、 Vibrio harveyi ( V.harveyi )、 Neobenedenia sp.、 Aestabdella sp. and other aquatic animal pathogenic DNA as templates (Table 4), the first set of LAMP detection specificity analysis of large yellow croaker-derived trypanosomes based on isothermal amplification was performed. The test was repeated three times. The test results showed that the LAMP detection method based on isothermal amplification technology of the present invention can complete the specific detection of large yellow croaker-derived trypanosomes within 40 minutes ( Figure 6 ).
[0038] Table 4 Pathogens used in specific detection
Claims
1. A primer and probe for detecting trypanosoma spp., characterized in that: The nucleotide sequences of the primers and probes are as follows: (1) Nucleotide sequences of four sets of fluorescent quantitative PCR detection primers and probes: Nucleotide sequences of the first set of primers and probes: 1) Primer 1: Tr _F: 5’-TTCGAATTTGGTGACCCAGG-3’, 2) Primer 2: Tr _R: 5'-ACATGCGAAAATCAGGAAGG-3', 3) Probe: Tr _Probe:5'-TCCGTGAACACATTCAGAA-3'; The nucleotide sequences of the second set of primers and probes are: 1) Primer 1: Tr _F: 5'-CGGGCGCCTAGTTTTATCTG-3', 2) Primer 2: Tr _R: 5'-TGCACCGAGAGGAAAAGACAA-3', 3) Probe: Tr _Probe:5'-TACCGATGCAGGAGGGA-3'; The nucleotide sequences of the third set of primers and probes are: 1) Primer 1: Tr _F: 5'-GTCGCCTTTGTGGGAAACC-3', 2) Primer 2: Tr _R: 5'-GCAGTGAGTTGAGGGAATGCA-3', 3) Probe: Tr _Probe:5'-TCGGCTTGTCTTTTTC-3'; The nucleotide sequences of the fourth set of primers and probes are: 1) Primer 1: Tr _F: 5'-TTATGGAGTTGTGCGACAAGC-3', 2) Primer 2: Tr _R: 5'-CTCCCTCCTGCATCGGTAC-3', 3) Probe: Tr _Probe:5'-TATCTGGTGCCCGTCGC-3'; (2) Nucleotide sequences of two sets of isothermal amplification detection primers: The nucleotide sequence of the first set of isothermal amplification primers: 1) Primer 1: Tr _F3: 5'-AGGAGCAGCCTATGAGCT-3', 2) Primer 2: Tr _B3:5'-CATTCCTGGAAGCAGTGAGT-3', 3) Primer 3: Tr _FIP: 5'-CCGCTTGTCGCACAACTCCATATTTTCCGTTTCGGCTTTTGTTGG-3', 4) Primer 4: Tr _BIP: 5'-CCGTCGCCTTTGTGGGAAACCTTTTGGGAATGCACCGAGAGGA-3', 5) Primer 5: Tr _LB: 5'-CCGTACCGATGCAGGAGGGA-3'; The nucleotide sequence of the second set of isothermal amplification primers: 1) Primer 1: Tr _F3: 5'-GCACTGGTATGTCCCGTTC-3', 2) Primer 2: Tr _B3: 5'-CTCATAGGCTGCTCCTTTGT-3', 3) Primer 3: Tr _FIP: 5'-AAGGGAACCACTCCCGTGTTTCTTTTACTTCGAATTTGGTGACCCA-3', 4) Primer 4: Tr _BIP: 5'-TCGCATGTCATGCATGCCAGGTTTTAAGTCGGATGACTGCTTTGG-3', 5) Primer 5: Tr _LF: 5’-TGTTCACGGACCACAAGGG-3’, 6) Primer 6: Tr _LB:5'-GGGCGCCCGTGATTTTT-3'.
2. The detection primer and probe for Trypanosoma crocea as claimed in claim 1, wherein: The first set of fluorescent quantitative PCR detection primers and probes were designed based on the highly conserved and species-specific nucleotide sequence of the SSUrRNA gene of Trypanosoma crocea, and the nucleotide sequence was TTCGAATTTTGGTGACCCAGGCCCTTGTGGTCCGTGAACACATTCAGAAACAAGAAACACGGGAGTGGTTCCCTTCCTGATTTTCGCATGT.
3. Use of the primers and probes for detecting trypanosoma crocea according to claim 1 in the detection and quantitative analysis of trypanosoma crocea for non-disease diagnosis and treatment purposes.
4. The use according to claim 3, characterized in that: When the fluorescent quantitative PCR detection primers and probes are used for detection, the primers and probes are used simultaneously or only the primers are used.
5. The use according to claim 4, characterized in that: The 5' end of the probe is modified with a fluorescent reporter group 6-FAM, and the 3' end is modified with a fluorescent quencher group MGB-NFQ.
6. The use according to claim 4, characterized in that: The final concentrations of primers and probes in the detection system are 0.1-0.8 μmol / L and 0.1-0.5 μmol / L, respectively.
7. The use according to claim 3, characterized in that: When the isothermal amplification detection primers are used for detection, the primers used are Tr _F3, Tr _B3, Tr _FIP and Tr _BIP, or Tr _F3, Tr _B3, Tr _FIP, Tr _BIP and Tr _LF, or Tr _F3, Tr _B3, Tr _FIP, Tr _BIP and Tr _LB, or Tr _F3, Tr _B3, Tr_ FIP, Tr _BIP, Tr _LF and Tr _LB.
8. The use according to claim 7, characterized in that: The reaction temperature is 60.0-68.0℃, the concentration of MgSO4 in the reaction system is 4.0-12.0mM, the concentration of betaine is 0.1-1.4mM, the concentration of dNTPs is 0.8-1.8mM, Bst 2.0WarmStart ® The concentration of DNA polymerase is 0.128-0.576 U / μL.
9. The use according to claim 8, characterized in that: The reaction system also includes EvaGreen at a final concentration of 0.5-2.5 μmol / L ® Dye.
10. The use according to claim 3, characterized in that: Including products used to prepare detection reagents or test kits.
Citation Information
Patent Citations
Highly conserved genes and their use to generate species-specific, genus-specific, family-specific, group-specific and universal nucleic acid probes and amplification primers to rapidly detect and identify bacterial, fungal and parasitical pathogens from clinical specimens for diagnosis
CA2283458A1
Method for fast detecting trypanosome evansi by utilizing loop-mediated isothermal application technology
CN101892313A
Visual detection method of isothermal amplification products of nucleic acids
CN103725750A
SYBR Green I real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer for trypanosoma and kit of SYBR Green I real-time fluorescent quantitative PCR detection primer
CN119464511A
Visual detection primer probe set, kit and detection method for aquatic animal source trypanosomes
CN120272626A