Recombinant adeno-associated virus vector

Abstract

The present invention provides adeno-associated virus (rAAV) vectors, in particular rAAV vectors comprising gene constructs carrying genes encoding tyrosine receptor kinase B (TrkB) and brain derived neurotrophic factor (BDNF). The invention also extends to pharmaceutical compositions comprising said rAAV vectors, and the use of these vectors and compositions in gene therapy for the prevention or treatment of a range of optic nerve and cochlear disorders or for promoting nerve regeneration and / or survival. The invention also provides a method of producing the rAAV vector.

Description

Technical Field

[0001] The present invention relates to recombinant adeno-associated virus (rAAV) vectors, specifically rAAV vectors containing gene constructs encoding genes for tyrosine receptor kinase B (TrkB) and brain-derived neurotrophic factor (BDNF). The present invention also extends to pharmaceutical compositions comprising the rAAV vectors, and the use of these vectors and compositions in gene therapy for preventing or treating a range of optic nerve disorders and cochlear disorders or for promoting nerve regeneration and / or survival. The present invention also provides methods for producing rAAV vectors. Background Art

[0002] Retinal ganglion cells (RGCs) are cells used as the final pathway for transmitting all visual information processed by the retina to the brain. RGCs are cells primarily affected by optic neuropathy or optic neuritis, which include glaucoma (also referred to as glaucomatous optic neuropathy), hereditary optic nerve disorders, ischemic optic nerve disorders, and neurodegenerative diseases (Int. J. Mol. Sci., 2020. 21 (7): 2262; Hum. Mol. Genet., 2017. 26 (R2): p. R139-R150). RGCs have limited regenerative capacity, and therefore blindness after known optic nerve disorders is irreversible (Science. 2017. 356 (6342): p. 1031-1034).

[0003] Glaucomatous optic neuropathy is the most common optic nerve disorder. It is a progressive optic nerve degeneration characterized by damage to the axons of the retinas and the accompanying death of the retinas, leading to vision loss (Nat. Rev. Dis. Primers, 2016.2: p.16067; JAMA, 2014.311(18): p.1901-1911). Glaucoma includes open-angle glaucoma, normal-tension glaucoma, angle-closure glaucoma, congenital glaucoma, and secondary glaucoma. It is the leading cause of irreversible vision loss in the world. The incidence of glaucoma increases with age, and the global prevalence of glaucoma in people aged 40 to 80 years was estimated to be about 3.5%, or about 64.3 million cases, in 2013, and is expected to increase to about 76 million cases by 2020 and to 111.8 million cases by 2040 (Ophthalmology, 2014. 121(11): p. 2081-2090). Currently, the elderly population is rapidly increasing, and therefore glaucoma is a pressing social and medical problem.

[0004] Elevated intraocular pressure (IOP) is the most important risk factor for glaucoma (Surv. Ophthalmol., 2003. 48(Suppl 1): p. S3-S7). Currently, glaucoma treatment is based on lowering IOP with topical medications to prevent additional optic nerve damage (Lancet, 1999. 354(9192): p. 1803-1810). Five main classes of medications are used to lower IOP: β-adrenergic receptor antagonists, adrenergic receptor agonists, parasympathomimetics, prostaglandin analogs, and carbonic anhydrase inhibitors. While these medications have an IOP-lowering effect, they can cause severe side effects in some patients, negatively impacting their quality of life. Furthermore, compliance and adherence to the use of eye drops to lower IOP are low, particularly in patients who require multiple medications. When IOP reduction is insufficient and further reduction is needed, laser trabeculoplasty is occasionally performed; however, even this approach fails to lower IOP in many patients. Therefore, protecting RGCs and their axons in glaucoma is an important therapeutic approach used in addition to conventional IOP-lowering treatments and is particularly important for patients who do not benefit from conventional treatments (Eye (Lond), 2018. 32(5): p. 938-945).

[0005] Brain-derived neurotrophic factor (BDNF) is a member of the neurotrophin family of growth factors, along with nerve growth factor (NGF), neurotrophin-3 (NT-3) and neurotrophin-4 / 5 (NT-4 / 5) (Neuropathol. Appl. Neurobiol., 2003. 29(3): p.211-230; Nat. Rev. Neurosci., 2003. 4(4): p.299-309). Neurotrophins play an important role in the development, survival and function of a variety of neurons in the peripheral and central nervous systems. Neurotrophins bind to two families of cell surface receptors, namely the p75 neurotrophin receptor (p75 NTR ) and tropomyosin-related kinase (Trk) receptors. NGF mainly binds to TrkA and BDNF, NT-4 / 5 binds to TrkB, and NT-3 mainly binds to TrkC.

[0006] BDNF is one of the most effective neurotrophins that can prevent RGC death after axonal injury (Invest. Ophthalmol. Vis. Sci., 1996. 37(4): p. 489-500; Invest. Ophthalmol. Vis. Sci., 2001. 42(5): p. 966-974; Neurosci. Lett., 2001. 305(2): p. 139-142; J. Neurosci., 2000. 20(18): p. 6962-6967). BDNF is typically synthesized as a BDNF proprotein precursor (pre-proBDNF, pre-proBDNF) containing a signal peptide sequence (Nat. Rev. Neurosci., 2013. 14(1): p. 7-23). ​​Thereafter, the signal peptide is cleaved and removed to convert the BDNF proprotein precursor into the BDNF proprotein (proBDNF, proBDNF). The N-terminal sequence of the BDNF proprotein is cleaved intracellularly or extracellularly, thereby generating mature BDNF (mBDNF). mBDNF is known to activate TrkB receptors to maintain cell survival, while BDNF proprotein preferentially activates p75 NTR Receptors to induce cell death (Nat. Rev. Neurosci., 2005. 6(8): p. 603-614).

[0007] Animal models of glaucoma have demonstrated a decrease in BDNF in the retina after optic nerve compression or elevated IOP (Int. J. Mol. Sci., 2020. 21(17): 6262; Invest. Ophthalmol. Vis. Sci., 2000. 41(3): p. 764-774; Invest. Ophthalmol. Vis. Sci., 2000. 41(11): p. 3460-3466). In animal models of glaucoma, supplementation of intraocular BDNF by administration of recombinant protein or gene therapy increased the survival rate of RGCs compared to untreated cases (Invest. Ophthalmol. Vis. Sci., 2001. 42(5): p. 966-974; Neurosci. Lett., 2001. 305(2): p. 139-142; J. Neurosci., 2000. 20(18): p. 6962-6967; Int. J. Mol. Sci., 2020. 21(17): 6262). On the other hand, it has been shown that the protective effect of BDNF supplementation alone on RGCs is expected to be only transient due to downregulation of TrkB receptors (Int. J. Mol. Sci. 2019. 20(17): 4314). Under these circumstances, in order to successfully maintain the effects of BDNF in the retina over the long term, rAAV vectors have been prepared in which the CAG promoter drives the expression of both the TrkB gene and the BDNF gene.

[0008] However, the inventors of the present invention have observed that when producing prior art rAAV vectors designed according to the teachings of International Patent Publication No. WO 2017 / 072498 and Hum. Gene Ther., 2018.29(7): p.828-841, there are significant differences in yield. Specifically, the problem observed by the inventors is that the rAAV vectors containing the TrkB gene and the BDNF gene designed according to the teachings of the literature show genomic breakage (or truncation) of the rAAV genomic DNA during production. The occurrence of genomic DNA breakage significantly interferes with the efficient production of rAAV vectors containing the TrkB gene and the BDNF gene, resulting in reduced production efficiency and reduced yield of the rAAV vector.

[0009] Therefore, the present inventors set out to design and generate rAAV vectors containing both the TrkB gene and the BDNF gene, but which do not experience the problem of truncation or fragmentation of the genomic DNA. The present inventors observed that rAAV vectors having a cytomegalovirus (CMV) promoter operably linked to the TrkB gene and the mature BDNF gene showed reduced genomic DNA fragmentation and, as a result, observed higher efficiency of the rAAV vectors, resulting in better yields. Summary of the Invention

[0010] Therefore, according to a first aspect of the present invention, there is provided a recombinant adeno-associated virus (rAAV) vector comprising a gene construct comprising, in the 5' to 3' direction:

[0011] - Cytomegalovirus (CMV) promoter;

[0012] - a first coding sequence encoding tyrosine kinase receptor B (TrkB);

[0013] - a nucleotide sequence encoding a linker for producing TrkB and mature brain-derived neurotrophic factor (mBDNF) as separate proteins; and

[0014] - a second coding sequence encoding mBDNF,

[0015] Wherein a CMV promoter is operably linked to the first and second coding sequences.

[0016] Advantageously, the rAAV vector with the TrkB gene and the mature BDNF gene and the CMV promoter operably connected to these genes can reduce the truncation or breakage of genomic DNA during production. As such, the rAAV vector of the claimed invention can be produced with improved production efficiency. The pharmaceutical composition comprising the rAAV vector can be used to prevent or treat optic nerve disorders and / or retinal degenerative diseases related to retinal ganglion cell degeneration (retinal ganglion cell degeneration), such as glaucoma and glaucomatous optic neuropathy.

[0017] The CMV promoter is operably linked to a first coding sequence encoding tyrosine kinase receptor B (TrkB) and a second coding sequence encoding mature brain-derived neurotrophic factor (mBDNF). In this article, "operably linked" means that the promoter sequence is linked to the first and second coding sequences in a manner that enables the protein encoded by the coding sequences to be expressed in the host cell.

[0018] In one embodiment, the CMV promoter comprises a nucleotide sequence including a TATA box sequence derived from a CMVIE promoter and a sequence derived from CMV.

[0019] One embodiment of a nucleotide sequence encoding a CMV promoter is referred to herein as SEQ ID No: 1 and is shown below:

[0020]

[0021]

[0022] Therefore, in one embodiment, the CMV promoter comprises the nucleotide sequence shown in SEQ ID No: 1, or a fragment or variant thereof.

[0023] In one embodiment, the gene construct contained in the rAAV vector of the present invention comprises a first coding sequence encoding a naturally occurring TrkB or a variant thereof having the function thereof. It will be well understood by the skilled artisan that "naturally occurring" TrkB describes a gene that exists in its native form without the introduction of any non-natural mutations or modifications.

[0024] TrkB has the function of activating intracellular signal transduction molecules (e.g., extracellular signal-regulated kinase (ERK)) downstream of TrkB after binding to BDNF and neurotrophin-4 / 5 (NT-4 / 5). The function of TrkB can be evaluated by using methods known to those skilled in the art, such as ligand binding assays and detection of intracellular signal transduction molecule activity. In some embodiments, the nucleotide sequence encoding TrkB is a nucleotide sequence encoding mammalian TrkB, and in some embodiments, is a nucleotide sequence encoding human TrkB.

[0025] In one embodiment, TrkB comprises the amino acid sequence designated herein as SEQ ID No: 2 (Accession No. NP_001018074.1), as shown below:

[0026]

[0027]

[0028] Thus, in one embodiment, the first coding sequence encodes the amino acid sequence as shown in SEQ ID No: 2, or a fragment or variant thereof.

[0029] One embodiment of a nucleotide sequence encoding TrkB is referred to herein as SEQ ID No: 3 and is shown below:

[0030]

[0031]

[0032] Therefore, in one embodiment, the first coding sequence comprises the nucleotide sequence shown in SEQ ID No: 3, or a fragment or variant thereof.

[0033] The gene construct contained in the rAAV vector of the present invention may contain a second coding sequence encoding naturally occurring mature BDNF. The skilled artisan will well understand that "naturally occurring" mBDNF describes the gene in its native form without the introduction of any non-natural mutations or modifications.

[0034] BDNF is a ligand for TrkB and is known to exist in the form of BDNF proprotein precursor, BDNF proprotein, or mature BDNF (mBDNF). Specifically, BDNF is first synthesized as BDNF proprotein precursor, which is then transferred to the rough endoplasmic reticulum and converted into BDNF proprotein by cleavage of the signal peptide. BDNF proprotein is converted into mBDNF by cleavage of the N-terminal peptide sequence. Both BDNF proprotein and mBDNF are secreted extracellularly, with BDNF proprotein preferentially activating p75. NTR The function of BDNF proprotein or mBDNF can be evaluated using methods known to those skilled in the art, such as receptor binding assays and activity detection of intracellular signal transduction molecules downstream of the receptor.

[0035] In some embodiments, the nucleotide sequence encoding mBDNF is a nucleotide sequence encoding mammalian mBDNF, and in some embodiments, is a nucleotide sequence encoding human mBDNF. Therefore, in one embodiment, a nucleotide sequence encoding human mBDNF or a variant thereof having a function thereof can be used as the nucleotide sequence encoding human mBDNF.

[0036] In one embodiment, mBDNF comprises the amino acid sequence designated herein as SEQ ID No: 4 (amino acid sequence 129 to 247 of accession No. NP_001137277.1), as shown below:

[0037]

[0038]

[0039] Thus, in one embodiment, the second coding sequence encodes the amino acid sequence as shown in SEQ ID No: 4, or a fragment or variant thereof.

[0040] One embodiment of a nucleotide sequence encoding mBDNF is referred to herein as SEQ ID No: 5 and is shown below:

[0041]

[0042] Therefore, in one embodiment, the second coding sequence comprises the nucleotide sequence as shown in SEQ ID No: 5, or a fragment or variant thereof.

[0043] Since the rAAV vector of the present invention includes a gene construct encoding mBDNF, in some embodiments, the gene construct also encodes a signal peptide. Therefore, in some embodiments, the gene construct contained in the rAAV vector also includes a nucleotide sequence encoding a signal peptide.

[0044] The nucleotide sequence encoding the signal peptide is located at the 5' side of the nucleotide sequence encoding mBDNF. Therefore, the gene construct contained in the rAAV vector of the present invention includes the nucleotide sequence encoding the signal peptide and the nucleotide sequence encoding mBDNF in the 5' to 3' direction.

[0045] In one embodiment, the nucleotide sequence encoding the signal peptide is located 3' to the nucleotide sequence encoding the linker. Thus, in some embodiments, the gene construct contained in the rAAV vector of the present invention includes, in the 5' to 3' direction, a cytomegalovirus (CMV) promoter, a nucleotide sequence encoding TrkB, a nucleotide sequence encoding a linker, a nucleotide sequence encoding a signal peptide, and a nucleotide sequence encoding mBDNF.

[0046] Any nucleotide sequence encoding a signal peptide having a function of promoting the extracellular secretion of mBDNF is applicable without limitation as the nucleotide sequence encoding the signal peptide for use in the present invention, and examples thereof include WO 2017 / 072498, WO 2018 / 185468, Hum. Gene Ther., 2018.29(7): p.828-841 and Cell Death Dis., 2018.9: 1007. In one embodiment, the nucleotide sequence encoding the signal peptide is a nucleotide sequence encoding a natural amino acid sequence contained in the N-terminus of the BDNF protein and having a function of promoting the extracellular secretion of the BDNF proprotein and mBDNF. In one embodiment, the nucleotide sequence encoding the signal peptide is a nucleotide sequence encoding the following amino acid sequence, which is obtained by modifying the natural amino acid sequence included in the N-terminus of the BDNF protein and has a function of promoting the extracellular secretion of the BDNF proprotein and mBDNF.

[0047] In one embodiment, the nucleotide sequence encoding the signal peptide is a nucleotide sequence encoding a natural amino acid sequence, which is contained at the N-terminus of the BDNF protein and has the function of promoting the extracellular secretion of BDNF proprotein and mBDNF.

[0048] In some embodiments, the signal peptide comprises the amino acid sequence designated herein as SEQ ID No: 20 (BDNF Signal Peptide: SP), as shown below:

[0049] Met Thr Ile Leu Phe Leu Thr Met Val Ile Ser Tyr Phe Gly Cys Met LysAla

[0050] [SEQ ID No: 20]

[0051] Therefore, in one embodiment, the nucleotide sequence encoding the signal peptide encodes the amino acid sequence as shown in SEQ ID No: 20, or a fragment or variant thereof.

[0052] One embodiment of a nucleotide sequence encoding a signal peptide is referred to herein as SEQ ID No: 21 and is shown below:

[0053] atgaccatcc ttttccttac tatggttatttcatactttg gttgcatgaa ggct

[0054] [SEQ ID No: 21]

[0055] Therefore, in one embodiment, the signal peptide comprises the nucleotide sequence shown in SEQ ID No: 21, or a fragment or variant thereof.

[0056] In one embodiment, the nucleotide sequence encoding the signal peptide is a nucleotide sequence encoding a signal peptide modified by a natural amino acid sequence, which is contained at the N-terminus of the BDNF protein and has the function of promoting the extracellular secretion of BDNF proprotein and mBDNF.

[0057] In one embodiment, the signal peptide comprises the amino acid sequence designated herein as SEQ ID No: 6 (nv3 signal peptide: mSP), as shown below:

[0058]

[0059] Therefore, in one embodiment, the nucleotide sequence encoding the signal peptide encodes the amino acid sequence as shown in SEQ ID No: 6, or a fragment or variant thereof.

[0060] One embodiment of a nucleotide sequence encoding a signal peptide is referred to herein as SEQ ID No: 7 and is shown below:

[0061] atgcggatcc ttctgcttac tatggttatttcatactttg gttgcatgaa ggct

[0062] [SEQ ID No: 7]

[0063] Therefore, in one embodiment, the signal peptide comprises the nucleotide sequence shown in SEQ ID No: 7, or a fragment or variant thereof.

[0064] The gene construct also includes a nucleotide sequence encoding a linker to produce TrkB and mBDNF as independent proteins. The linker is located between the nucleotide sequence encoding TrkB and the nucleotide sequence encoding mBDNF. Thus, the gene construct contained in the rAAV vector of the present invention includes, in the 5' to 3' direction, a nucleotide sequence encoding TrkB, a nucleotide sequence encoding a linker to produce TrkB and mBDNF as independent proteins, and a nucleotide sequence encoding mBDNF.

[0065] As used herein, a "linker that produces TrkB and mBDNF as independent proteins" refers to a linker that allows the genes encoding the two proteins to be translated sequentially into two independent proteins in a host cell by ribosome jumping, or that, after the two proteins are translated into a single polypeptide, can then be released as independent proteins by digestion or cleavage of the linker portion in the host cell. In some embodiments, the linker can be digested or cleaved to produce TrkB and mBDNF as separate (independent) proteins.

[0066] The nucleotide sequence encoding the linker is a nucleotide sequence encoding a viral-derived peptide, specifically, a nucleotide sequence encoding a P2A peptide. The P2A peptide is a 2A peptide derived from porcine teschovirus-1.

[0067] In one embodiment, the nucleotide sequence encoding the linker can be a nucleotide sequence encoding a linker comprising a 2A peptide and other linker peptides. Therefore, in one embodiment, the nucleotide sequence encoding the linker includes a nucleotide sequence encoding a linker comprising a 2A peptide and another other linker peptide. Any linker peptide that allows the linker to produce TrkB and BDNF as two independent proteins is applicable as other linker peptides without restriction, and examples thereof include GSG (glycine-serine-glycine) sequences. Therefore, in one embodiment, the nucleotide sequence encoding the linker is a nucleotide sequence encoding a linker consisting of a 2A peptide and a GSG added to the N-terminus of the 2A peptide.

[0068] If the C-terminal amino acid of the polypeptide located at the N-terminus of the other linker peptide is G, SG (serine-glycine) can be added to the N-terminus of the 2A peptide as another linker peptide. Therefore, in one embodiment, the nucleotide sequence encoding the linker is a nucleotide sequence encoding a linker consisting of SG and a P2A peptide (also referred to herein as an "SG-P2A peptide").

[0069] In one embodiment, the linker comprises the amino acid sequence designated herein as SEQ ID No: 8, as shown below:

[0070]

[0071] Thus, in one embodiment, the nucleotide sequence encoding the linker encodes the amino acid sequence as shown in SEQ ID No: 8, or a fragment or variant thereof.

[0072] One embodiment of a nucleotide sequence encoding a linker is referred to herein as SEQ ID No: 9 and is shown below:

[0073] agcggcgcca caaatttctc cctgctgaag caggcaggcg acgtggagga gaaccctgga

[0074] cca

[0075] [SEQ ID No: 9]

[0076] Therefore, in one embodiment, the linker comprises the nucleotide sequence shown in SEQ ID No: 9, or a fragment or variant thereof.

[0077] In one embodiment, the gene construct contained in the rAAV vector of the present invention also includes a post-transcriptional regulatory element. In this article, "post-transcriptional regulatory element" refers to a non-coding sequence that regulates gene expression by post-transcriptional control. Any post-transcriptional regulatory element that can regulate gene expression by post-transcriptional control is applicable to the post-transcriptional regulatory element that can be used in the present invention without restriction, and its example includes woodchuck hepatitis virus (woodchuck hepatitis virus) post-transcriptional regulatory element (WPRE). Therefore, in one embodiment, the gene construct includes a nucleotide sequence encoding a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), which enhances the expression of two transgenes, i.e., TrkB receptor and mBDNF. In one embodiment, the WPRE coding sequence is located at 3' of the transgenic coding sequence, and in some embodiments, at 3' of the mBDNF coding sequence.

[0078] In some embodiments, the post-transcriptional regulatory element is WPRE, which is defined as a 247 bp long nucleotide sequence with a beta element deleted (SEQ ID No: 10) (hereinafter also referred to as WPRE(S)).

[0079] One embodiment of a nucleotide sequence encoding WPRE is referred to herein as SEQ ID No: 10 and is shown below:

[0080]

[0081] Therefore, in one embodiment, the WPRE comprises the nucleotide sequence as shown in SEQ ID No: 10, or a fragment or variant thereof.

[0082] In one embodiment, the gene construct contained in the rAAV vector contains a nucleotide sequence encoding a poly A signal sequence. In this article, a "poly A signal sequence" is a sequence known to those skilled in the art and is a DNA sequence located at the 3' end of a gene and allowing a polyadenosine (poly A) tail to be added to the 3' end of the mRNA transcribed from the gene. In one embodiment, the poly A signal sequence is a simian virus 40 (SV40) poly A signal sequence, a human beta globulin poly A signal sequence, a rabbit beta globulin poly A signal sequence, a bovine growth hormone poly A signal sequence, or a human growth hormone poly A signal sequence. In some embodiments, the poly A signal sequence is the SV40 poly A signal sequence.

[0083] In one embodiment, the poly A signal sequence is located 3' to the transgene coding sequence, and in some embodiments, is located 3' to the WPRE coding sequence.

[0084] One embodiment of a nucleotide sequence encoding a poly A signal sequence is referred to herein as SEQ ID No: 11 and is shown below:

[0085]

[0086]

[0087] Therefore, in one embodiment, the poly A signal sequence comprises the nucleotide sequence shown in SEQ ID No: 11, or a fragment or variant thereof.

[0088] Thus, in one embodiment, the rAAV vector comprises a gene construct comprising, in the 5' to 3' direction, a CMV promoter sequence, a first coding sequence encoding TrkB, a nucleotide sequence encoding a linker peptide, a nucleotide sequence encoding a signal peptide, a second coding sequence encoding mBDNF, and a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).

[0089] Thus, in another embodiment, the rAAV vector comprises a gene construct comprising, in the 5' to 3' direction, a CMV promoter sequence, a first coding sequence encoding TrkB, a nucleotide sequence encoding a linker peptide, a nucleotide sequence encoding a signal peptide, a second coding sequence encoding mBDNF, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and a simian virus 40 (SV40) poly A signal sequence.

[0090] Thus, in another embodiment, the rAAV vector comprises a gene construct comprising, in the 5' to 3' direction, a CMV promoter sequence, a first coding sequence encoding TrkB, a nucleotide sequence encoding a linker peptide (in some embodiments, a P2A peptide), a nucleotide sequence encoding a signal peptide, a second coding sequence encoding mBDNF, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and a simian virus 40 (SV40) poly A signal sequence.

[0091] In one embodiment, the rAAV vector comprises left and / or right terminal inverted repeats (ITRs). In one embodiment, each ITR is located at the 5' and / or 3' end of the AAV genome. In this article, "terminal inverted repeats (ITRs)" are sequences known to those skilled in the art, and refer to sequences present at each end of the genomic DNA of AAV and forming a hairpin loop. AAV is divided into different serotypes according to the capsid protein sequence, such as AAV1 and AAV2, and the AAV genomes of different serotypes contain different ITR sequences. However, the AAV genome containing ITRs derived from one serotype can be packaged into a capsid derived from another serotype. Each ITR can be a wild-type sequence or a variant with ITR function. In one embodiment, each ITR is an ITR derived from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV8, AAV9, etc., or a modified ITR therefrom. In some embodiments, each ITR is an ITR derived from AAV2.

[0092] One embodiment of a nucleotide sequence encoding a 5' ITR is referred to herein as SEQ ID No: 12 and is shown below:

[0093]

[0094] One embodiment of a nucleotide sequence encoding a 3' ITR is referred to herein as SEQ ID No: 13 and is shown below:

[0095]

[0096] Therefore, in one embodiment, the 5'ITR and the 3'ITR comprise the nucleotide sequence shown in SEQ ID No: 12 and the complementary sequence of the nucleotide sequence shown in SEQ ID No: 12 (the nucleotide sequence shown in SEQ ID No: 13), respectively.

[0097] Thus, in one embodiment, the rAAV vector comprises a gene construct comprising, in the 5' to 3' direction, a 5' ITR, a CMV promoter sequence, a first coding sequence encoding TrkB, a nucleotide sequence encoding a linker peptide (in one embodiment, a P2A peptide), a nucleotide sequence encoding a signal peptide, a second coding sequence encoding mBDNF, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), a simian virus 40 (SV40) poly A signal sequence, and a 3' ITR.

[0098] Depending on the promoter, host cell, etc. used, the rAAV vector of the present invention may further contain various expression regulatory elements (for example, see Goeddel, Gene Expression Technology, Methods in Enzymology, 1990. 185. Academic Press, San Diego), translation initiation codon, translation termination codon, Kozak sequence, splicing junction, etc.

[0099] The gene constructs contained in the rAAV vectors of the present invention can be synthesized based on the sequence information by using standard polynucleotide synthesis methods known in the art. Polynucleotide variants can be generated by introducing mutations at specific sites in a given polynucleotide using methods known to those skilled in the art, such as site-directed mutagenesis.

[0100] From the foregoing, the skilled person will understand the nucleotide sequence of the embodiment of the gene construct contained within the rAAV vector according to the first aspect, as well as the amino acid sequence of the encoded transgene. However, for the avoidance of doubt, in one embodiment, the rAAV vector of the present invention is a rAAV vector comprising a gene construct comprising the nucleotide sequence referred to herein as SEQ ID No: 14, as shown below:

[0101]

[0102]

[0103] Therefore, in one embodiment, the rAAV vector according to the first aspect comprises a gene construct comprising the nucleotide sequence as shown in SEQ ID No: 14, or a variant or fragment thereof.

[0104] The gene construct consisting of the nucleotide sequence shown in SEQ ID No: 14 (hereinafter also referred to as "CMV-hTrkB-P2A-mSP-hmBDNF") comprises, from 5' to 3' direction, in the order provided, a CMV promoter sequence consisting of the nucleotide sequence shown in SEQ ID No: 1, a nucleotide sequence encoding TrkB and consisting of the nucleotide sequence shown in SEQ ID No: 3, a nucleotide sequence encoding the SG-P2A peptide and consisting of the nucleotide sequence shown in SEQ ID No: 9, a nucleotide sequence encoding a signal peptide and consisting of the nucleotide sequence shown in SEQ ID No: 7, and a nucleotide sequence encoding mBDNF and consisting of the nucleotide sequence shown in SEQ ID No: 5.

[0105] In another embodiment, the rAAV vector of the present invention is a rAAV vector comprising a gene construct comprising the nucleotide sequence designated herein as SEQ ID No: 15, as shown below:

[0106]

[0107]

[0108] Therefore, in another embodiment, the rAAV vector according to the first aspect comprises a gene construct comprising the nucleotide sequence as shown in SEQ ID No: 15, or a variant or fragment thereof.

[0109] Herein, the gene construct consisting of the nucleotide sequence shown in SEQ ID No: 15 (hereinafter also referred to as "CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA") comprises the following gene constructs from 5' to 3' direction in the order provided: a CMV promoter sequence consisting of the nucleotide sequence shown in SEQ ID No: 1, a nucleotide sequence encoding TrkB and consisting of the nucleotide sequence shown in SEQ ID No: 3, a nucleotide sequence encoding the SG-P2A peptide and consisting of the nucleotide sequence shown in SEQ ID No: 9, a nucleotide sequence encoding a signal peptide and consisting of the nucleotide sequence shown in SEQ ID No: 7, a nucleotide sequence encoding mBDNF and consisting of the nucleotide sequence shown in SEQ ID No: 5, a WPRE consisting of the nucleotide sequence shown in SEQ ID No: 10, and an SV40 poly A signal sequence consisting of the nucleotide sequence shown in SEQ ID No: 11.

[0110] In another embodiment, the rAAV vector of the present invention is a rAAV vector comprising a gene construct comprising the nucleotide sequence designated herein as SEQ ID No: 16, as shown below:

[0111]

[0112]

[0113]

[0114] Therefore, in another embodiment, the rAAV vector according to the first aspect comprises a gene construct comprising the nucleotide sequence as shown in SEQ ID No: 16, or a variant or fragment thereof.

[0115] The gene construct consisting of the nucleotide sequence shown in SEQ ID No: 16 (hereinafter, also referred to as "ITR-CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA-ITR") is a gene construct comprising "CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA" (SEQ ID No: 15), and is provided with AAV2-derived ITRs (the nucleotide sequence shown in SEQ ID No: 12 and the nucleotide sequence shown in SEQ ID No: 13, respectively) on its 5' and 3' sides.

[0116] In another embodiment, the rAAV vector of the present invention is a rAAV vector comprising a gene construct comprising the nucleotide sequence designated herein as SEQ ID No: 17, as shown below:

[0117]

[0118]

[0119] Therefore, in another embodiment, the rAAV vector according to the first aspect comprises a gene construct comprising the nucleotide sequence as shown in SEQ ID No: 17, or a variant or fragment thereof.

[0120] The gene construct consisting of the nucleotide sequence shown in SEQ ID No: 17 (hereinafter, also referred to as "ITR-CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA-ITR(2)") is a gene construct comprising "CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA" (SEQ ID No: 15), and is provided with AAV2-derived ITRs (the nucleotide sequence shown in SEQ ID No: 12 and the nucleotide sequence shown in SEQ ID No: 13, respectively) on its 5' and 3' sides, and the nucleotide sequence between the 5' ITR and the CMV promoter of this gene construct is different from SEQ ID No: 16.

[0121] Any serotype of AAV that allows TrkB and BDNF to be expressed in host cells is applicable to the present invention without limitation, and AAV1, AAV2, AAV3, AAV4, AAV5, AAV8, AAV9, rAAV2.7m8 vector, rAAV2 Max vector, etc. can be used. Herein, the rAAV vector of the present invention derived from any of the above AAV serotypes is referred to as rAAV1 vector, rAAV2 vector, rAAV2.7m8 vector, rAAV2 Max vector, rAAV3 vector, rAAV4 vector, rAAV5 vector, rAAV8 vector or rAAV9 vector. The rAAV vector in the present invention may be a modified rAAV vector in which the amino acid sequence of the capsid protein is modified.

[0122] In some embodiments, the rAAV vector of the present invention is a rAAV2 vector. In one embodiment, the rAAV vector is a rAAV2.7m8 vector. The rAAV2.7m8 vector includes a retinal-specific 7m8 peptide insertion (N587_R588insLALGETTRPA) between amino acids 587 and 588, and has been shown to exhibit improved photoreceptor transduction after intravitreal injection compared to unmodified rAAV2. See WO2012 / 145601 and Reid et al., 2017. Improvement of photoreceptor targeting via intravitreal delivery in mouse and human retinausing combinatory rAAV2 capsid mutant vectors. Investigative ophthalmology & visual science, 58 (14), pp.6429-6439.

[0123] One embodiment of the amino acid sequence of the capsid of the rAAV2.7m8 vector is provided herein as SEQ ID No: 18, as shown below:

[0124] *

[0125] [SEQ ID No: 18]

[0126] One embodiment of the nucleotide sequence encoding the cap gene of the rAAV2.7m8 vector is provided herein as SEQ ID No: 22, as shown below:

[0127]

[0128] In another embodiment, the rAAV vector is an rAAV2 Max vector. The rAAV2 Max vector contains five point mutations: Y272F; Y444F; Y500F; Y730F; and T491V (derived from rAAV2 [QuadYF+TV; see WO2008 / 124724, WO2013 / 173512, and WO2015 / 126972), as well as a peptide insertion, N587_R588insLALGETTRPA (derived from rAAV2.7m8), and has been shown to demonstrate high transduction levels. See Reid et al., 2017. Improvement of photoreceptor targeting via intravitreal delivery in mouse and human retinausing combinatory rAAV2 capsid mutant vectors. Investigative ophthalmology & visual science, 58(14), pp.6429-6439.

[0129] One embodiment of the amino acid sequence encoding the capsid of the rAAV2 Max vector is provided herein as SEQ ID No: 19, as follows:

[0130] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHFFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYFLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKVSADNNNSEFSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNLALGETTRPARQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRFLTRNL*[SEQ ID No:19]

[0131] One embodiment of the nucleotide sequence encoding the cap gene of the rAAV2 Max vector is provided herein as SEQ ID No: 23 and is as follows:

[0132] ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACACTCTCTCTGAAGGAATAAGACAGTGGTGGAAGCT

[0133] CAAACCTGGCCCACCACCACCAAAGCCCGCAGAGCGGCATAAGGACGACAGCAGGGGTCTTGTGCTTCCTGGGT

[0134] ACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGAGAGCCGGTCAACGAGGCAGACGCCGCGGCCCTCGAG

[0135] CACGACAAAGCCTACGACCGGCAGCTCGACAGCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCGGA

[0136] GTTTCAGGAGCGCCTTAAAGAAGATACGTCTTTTGGGGGCAACCTCGGACGAGCAGTCTTCCAGGCGAAAAAGA

[0137] GGGTTCTTGAACCTCTGGGCCTGGTTGAGGAACCTGTTAAGACGGCTCCGGGAAAAAAGAGGCCGGTAGAGCAC

[0138] TCTCCTGTGGAGCCAGACTCCTCCTCGGGAACCGGAAAGGCGGGCCAGCAGCCTGCAAGAAAAAGATTGAATTT

[0139] TGGTCAGACTGGAGACGCAGACTCAGTACCTGACCCCCAGCCTCTCGGACAGCCACCAGCAGCCCCCTCTGGTC

[0140] TGGGAACTAATACGATGGCTACAGGCAGTGGCGCACCAATGGCAGACAATAACGAGGGCGCCGACGGAGTGGGT

[0141] AATTCCTCGGGAAATTGGCATTGCGATTCCACATGGATGGGCGACAGAGTCATCACCACCAGCACCCGAACCTG

[0142] GGCCCTGCCCACCTACAACAACCACCTCTACAAACAAATTTCCAGCCAATCAGGAGCCTCGAACGACAATCACt

[0143] tcTTTGGCTACAGCACCCCTTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTTTCACCACGTGACTGG

[0144] CAAAGACTCATCAACAACAACTGGGGATTCCGACCCAAGAGACTCAACTTCAAGCTCTTTAACATTCAAGTCAA

[0145] AGAGGTCACGCAGAATGACGGTACGACGACGATTGCCAATAACCTTACCAGCACGGTTCAGGTGTTTACTGACT

[0146] CGGAGTACCAGCTCCCGTACGTCCTCGGCTCGGCGCATCAAGGATGCCTCCCGCCGTTCCCAGCAGACGTCTTC

[0147] ATGGTGCCACAGTATGGATACCTCACCCTGAACAACGGGAGTCAGGCAGTAGGACGCTCTTCATTTTACTGCCT

[0148] GGAGTACTTTCCTTCTCAGATGCTGCGTACCGGAAACAACTTTACCTTCAGCTACACTTTTGAGGACGTTCCTT

[0149] TCCACAGCAGCTACGCTCACAGCCAGAGTCTGGACCGTCTCATGAATCCTCTCATCGACCAGTACCTGTATttc

[0150] TTGAGCAGAACAAACACTCCAAGTGGAACCACCACGCAGTCAAGGCTTCAGTTTTCTCAGGCCGGAGCGAGTGA

[0151] CATTCGGGACCAGTCTAGGAACTGGCTTCCTGGACCCTGTTACCGCCAGCAGCGAGTATCAAAGgtgTCTGCGG

[0152] ATAACAACAACAGTGAAttcTCGTGGACTGGAGCTACCAAGTACCACCTCAATGGCAGAGACTCTCTGGTGAAT

[0153] CCGGGCCCGGCCATGGCAAGCCACAAGGACGATGAAGAAAAGTTTTTTCCTCAGAGCGGGGTTCTCATCTTTGG

[0154] GAAGCAAGGCTCAGAGAAAACAAATGTGGACATTGAAAAGGTCATGATTACAGACGAAGAGGAAATCAGGACAA

[0155] CCAATCCCGTGGCTACGGAGCAGTATGGTTCTGTATCTACCAACCTCCAGAGAGGCAACctagcactcggcgaa

[0156] acaacaagacctgctAGACAAGCAGCTACCGCAGATGTCAACACACAAGGCGTTCTTCCAGGCATGGTCTGGCA

[0157] GGACAGAGATGTGTACCTTCAGGGGCCCATCTGGGCAAAGATTCCACACACGGACGGACATTTTCACCCCTCTC

[0158] CCCTCATGGGTGGATTCGGACTTAAACACCCTCCTCCACAGATTCTCATCAAGAACACCCCGGTACCTGCGAAT

[0159] CCTTCGACCACCTTCAGTGCGGCAAAGTTTGCTTCCTTCATCACACAGTACTCCACGGGACAGGTCAGCGTGGA

[0160] GATCGAGTGGGAGCTGCAGAAGGAAAACAGCAAACGCTGGAATCCCGAAATTCAGTACACTTCCAACTACAACA

[0161] AGTCTGTTAATGTGGACTTTACTGTGGACACTAATGGCGTGTATTCAGAGCCTCGCCCCATTGGCACCAGAttc

[0162] CTGACTCGTAATCTGTAA

[0163] [SEQ ID No:23]

[0164] The rAAV described herein can be used to treat optic nerve disorders and cochlear disorders, and more generally to promote nerve regeneration and survival. In one embodiment, the rAAV described herein can be used to treat optic nerve disorders and / or retinal degenerative diseases involving retinal ganglion cell degeneration.

[0165] Thus, according to a second aspect, there is provided a recombinant vector according to the first aspect for use as a medicament or for use in therapy.

[0166] According to a third aspect, there is provided the rAAV vector according to the first aspect for use in treating, preventing or ameliorating optic nerve disorders or cochlear disorders, or for promoting nerve regeneration and / or survival.

[0167] In one embodiment, a rAAV vector according to the first aspect is provided for treating, preventing or ameliorating optic nerve disorders and / or retinal degenerative diseases involving retinal ganglion cell degeneration.

[0168] According to a fourth aspect, there is provided a method for treating, preventing or ameliorating an optic nerve disorder or a cochlear disorder in a subject, or promoting nerve regeneration and / or survival in a subject, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of the rAAV vector according to the first aspect.

[0169] In one embodiment, a method of treating, preventing or ameliorating optic nerve disorders and / or retinal degenerative diseases involving retinal ganglion cell degeneration is provided, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of the rAAV vector according to the first aspect.

[0170] In some embodiments, the rAAV vector according to the present invention is used in gene therapy technology. BDNF encoded by the vector activates TrkB also encoded by the vector, thereby promoting the survival of retinal ganglion cells (RGCs) or cochlear cells.

[0171] As shown in the examples, the rAAV vectors according to the present invention are able to provide a protective effect on the thickness of the overall retinal nerve fiber layer (RNFL) composed of RGC axons and improve their photopic negative wave response (PhNR) associated with the function of RGCs and their axons. Therefore, in a preferred embodiment, the rAAV vectors according to the present invention protect the overall RNFL thickness composed of RGC axons. In another preferred embodiment, the rAAV vectors according to the present invention improve the PhNR associated with the function of RGCs and their axons (i.e., increase the PhNR amplitude).

[0172] In one embodiment, the rAAV for use according to the third aspect or the method according to the fourth aspect is used to prevent or treat glaucoma and glaucomatous optic neuropathy, hereditary optic neuropathies, ischemic optic neuropathy and neurodegenerative diseases involving retinal ganglion cell degeneration. In this article, glaucoma and glaucomatous optic neuropathy include open-angle glaucoma, normal-tension glaucoma, angle-closure glaucoma, congenital glaucoma and secondary glaucoma. In this article, hereditary optic neuropathies include Leber hereditary optic neuropathy and dominant hereditary optic atrophy. In this article, neurodegenerative diseases involving retinal ganglion cell degeneration include Alzheimer's disease, Parkinson's disease, Huntington's disease and multiple system atrophy.

[0173] In some embodiments, the optic nerve disorder and / or retinal degenerative disease involving retinal ganglion cell degeneration treated is glaucoma. In another embodiment, the optic nerve disorder and / or retinal degenerative disease treated is glaucomatous optic neuropathy.

[0174] In one embodiment, the cochlear disorder treated can be hearing loss (hearing loss) or deafness. Cochlear cells can be hair cells or neuronal spiral ganglion cells, which transmit auditory signals from the ear to the brainstem through their axons. Hair cells can be inner ear hair cells or outer ear hair cells.

[0175] In another embodiment, the vector can be used to promote nerve regeneration and / or survival.

[0176] According to a fifth aspect, a pharmaceutical composition is provided, comprising the recombinant rAAV vector according to the first aspect and a pharmaceutically acceptable vehicle.

[0177] According to a sixth aspect, there is provided a method for preparing the pharmaceutical composition according to the fifth aspect, the method comprising contacting the recombinant rAAV vector according to the first aspect with a pharmaceutically acceptable vehicle.

[0178] The pharmaceutical composition of the present invention can be prepared by using a diluent commonly used in the art, i.e., a diluent for a medicament, a carrier for a medicament, and the like. Examples of dosage forms of such pharmaceutical compositions include parenteral medicaments, such as injections and medicaments for infusion. In the preparation, according to such dosage form, diluents, carriers, excipients, etc. can be used in a pharmaceutically acceptable manner. The pharmaceutical composition according to the present invention can be prepared into a sustained-release preparation. In a certain embodiment, the pharmaceutical composition of the present invention is administered as an injection. In a certain embodiment, the pharmaceutical composition of the present invention can be administered by intraocular administration, subretinal administration, intravitreal administration, or suprachoroidal administration. When preparing the rAAV vector of the present invention, according to such dosage form, diluents, carriers, excipients, etc. can be used in a pharmaceutically acceptable manner.

[0179] The "subject" in the prevention or treatment method of the present invention is a human or non-human animal in need of such prevention or treatment, and in certain embodiments, is a human in need of such prevention or treatment. Examples of "administering" to a subject include intraocular administration, intravitreal administration, subretinal administration, and suprachoroidal administration.

[0180] The effective amount of the rAAV vector of the present invention can be appropriately optimized based on the severity of the disease, previous treatment, the general health and age of the subject, the method of administration, other diseases, etc. The dose of the rAAV vector of the present invention can also be expressed as the number of copies of the vector genome (vg) administered per eye (vg / eye). Vg can also be displayed as genome copies (GC). In a certain embodiment, the effective dose of the rAAV vector of the present invention is about 1×10 6 to 1×10 14 In one embodiment, the effective dose of the rAAV vector of the present invention is about 1×10 8 to 1×10 13 In another embodiment, the effective dose of the rAAV vector of the present invention is about 1×10 10 to 1×10 12 In another embodiment, the effective dose of the rAAV vector of the present invention is about 1×10 11 to 1×10 12 vg / eye.

[0181] The rAAV vectors of the present invention can be used in combination with therapeutic or prophylactic agents for a variety of diseases for which the therapeutic or prophylactic agent is expected to be effective. In combined use, administration can be performed simultaneously, sequentially, or at desired intervals in separate operations. The formulations for simultaneous administration can be a combination drug or separate products formulated separately.

[0182] The present inventors have also developed a method for producing the rAAV vector according to the first aspect.

[0183] Therefore, in a seventh aspect, the present invention also provides a method for producing the rAAV vector according to the first aspect, the method comprising:

[0184] (i) introducing a gene construct into rAAV vector production cells, said gene construct comprising in 5' to 3' direction:

[0185] - Cytomegalovirus (CMV) promoter;

[0186] - a first coding sequence encoding tyrosine kinase receptor B (TrkB);

[0187] - a nucleotide sequence encoding a linker for producing TrkB and mBDNF as separate proteins; and

[0188] - a second coding sequence encoding mature brain-derived neurotrophic factor (mBDNF), wherein a CMV promoter is operably linked to the first and second coding sequences; and

[0189] (ii) culturing the rAAV vector-producing cells, thereby producing the rAAV vector according to the first aspect.

[0190] In some embodiments, the method of producing rAAV includes: introducing a gene construct into rAAV vector-producing cells; culturing the rAAV vector-producing cells; and collecting culture fluid and / or lysate from the rAAV vector-producing cells, and purifying the rAAV vector from the culture fluid and / or lysate.

[0191] The method for producing rAAV vectors may include the step of introducing a gene construct into rAAV vector production cells. The step of introducing a gene construct into rAAV vector production cells may include, in addition to the gene construct, a step of introducing a plasmid comprising a Rep gene and a cap gene and a plasmid comprising genes of a helper virus source that promotes AAV replication (e.g., adenovirus VA, E2A, E4 genes) into the rAAV vector production cells. The capsid protein of AAV constitutes the external non-nucleic acid portion of the virus particle and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2 and VP3, which are necessary for the assembly of virus particles. The construction of rAAV virus particles has been described in, for example, US 5,173,414; US 5,139,941; US ​​5,863,541; US ​​5,869,305; US 6,057,152; and US 6,376,237; as well as Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003). The step of introducing the gene construct into rAAV vector production cells can be performed using methods known to those skilled in the art.

[0192] The method for producing rAAV vectors may include the step of collecting a culture fluid from rAAV vector-producing cells and / or a lysate from rAAV vector-producing cells. For example, a lysate may be obtained by treating rAAV vector-producing cells with a surfactant or ultrasonic waves.

[0193] The method for producing the rAAV vector may further comprise a step of purifying the rAAV vector. To purify the rAAV vector from the lysate, for example, ion exchange chromatography and / or hydrophobic interaction chromatography, cesium chloride density gradient centrifugation, sucrose gradient centrifugation, iodixanol density gradient centrifugation, ultrafiltration, diafiltration, affinity chromatography, polyethylene glycol precipitation, and ammonium sulfate precipitation may be used.

[0194] In an eighth aspect, the present invention provides an rAAV vector producing cell comprising the gene construct of the rAAV vector according to the first aspect.

[0195] Any cell known in the art and allowing to produce rAAV by introducing a construct can be selected as the rAAV vector production cell used in the present invention without restriction. The example of the rAAV vector production cell used in the present invention includes a variety of cells, which are included in normal cells commonly used in the technical field of the present invention and cells artificially established. The example of the rAAV vector production cell used in the present invention includes animal cells (for example, CHO cells, HEK293 cells, HeLa cells), insect cells (for example, Sf9 cells), bacteria (such as Escherichia coli (Escherichia coli)) and yeast (yeast species (Saccharomyces spp.), Pichia species (Pichia spp.)). In some embodiments, the rAAV vector production cell of the present invention is an animal cell. In some embodiments, the rAAV vector production cell of the present invention is a HEK293 cell or a cell derived therefrom (for example, HEK293T cell).

[0196] It will be understood that the present invention extends to any nucleic acid or peptide or variant, derivative or analog thereof, which substantially comprises the amino acid or nucleic acid sequence of any of the sequences mentioned herein, including variants or fragments thereof. The terms "substantially the amino acid / nucleotide / peptide sequence", "variant" and "fragment" may refer to a sequence having at least 40% sequence identity with the amino acid / nucleotide / peptide sequence of any of the sequences mentioned herein, for example, a sequence having 40% identity with a sequence identified as SEQ ID No: 1-26, etc.

[0197] Also contemplated are amino acid / polynucleotide / polypeptide sequences having greater than 65%, in some embodiments greater than 70%, in some embodiments greater than 75%, and in some embodiments greater than 80% sequence identity to any of the sequences mentioned. In some embodiments, the amino acid / polynucleotide / polypeptide sequence is at least 85% identical to any of the sequences mentioned, in some embodiments at least 90% identical, in some embodiments at least 92% identical, in some embodiments at least 95% identical, in some embodiments at least 97% identical, in some embodiments at least 98% identical, and in some embodiments at least 99% identical to any of the sequences mentioned herein.

[0198] The skilled person will understand how to calculate the percent identity between two amino acid / polynucleotide / peptide sequences. In order to calculate the percent identity between two amino acid / polynucleotide / peptide sequences, an alignment of the two sequences must first be prepared, and then the sequence identity value is calculated. The percent identity of two sequences can take different values ​​based on: (i) the method used to align sequences, e.g., ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or a structural alignment from a 3D comparison; and (ii) the parameters used by the alignment method, e.g., local vs global alignment, the pairing score matrix used (e.g., BLOSUM62, PAM250, Gonnet, etc.), and the gap penalty, e.g., functional form and constant value.

[0199] After alignment, there are a number of different ways to calculate the percent identity between two sequences. For example, the number of identities can be divided by: (i) the length of the shortest sequence; (ii) the length of the alignment; (iii) the average length of the sequences; (iv) the number of non-gap positions; or (iv) the number of equivalent positions excluding overhangs. Furthermore, it will be appreciated that percent identity is also strongly dependent on length. Thus, the shorter a pair of sequences is, the higher the chance of sequence identity can be expected to be.

[0200] Therefore, it will be appreciated that accurate alignment of protein or DNA sequences is a complex process. The popular multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, 4876-4882) is a method for generating multiple alignments of proteins or DNAs according to the present invention. Parameters suitable for ClustalW may be as follows: for DNA alignments: Gap Open Penalty = 15.0, Gap Extension Penalty = 6.66, and Matrix = Identity. For protein alignments: Gap Open Penalty = 10.0, Gap Extension Penalty = 0.2, and Matrix = Gonnet. For DNA and protein alignments: ENDGAP = -1, GAPDIST = 4. Those skilled in the art will appreciate that these and other parameters may need to be varied to obtain optimal sequence alignments.

[0201] In some embodiments, the calculation of the percent identity between two amino acid / polynucleotide / polypeptide sequences according to the alignment can then be calculated as (N / T)*100, where N is the number of positions at which the sequences share the same residue, and T is the total number of positions compared, including gaps but excluding overhangs. In some embodiments, overhangs are included in the calculation. Thus, a method for calculating the percent identity between two sequences comprises (i) preparing a sequence alignment using the ClustalW program using a suitable set of parameters, e.g., the parameters described above; and (ii) substituting the values ​​for N and T into the following formula: - Sequence Identity = (N / T)*100.

[0202] Alternative methods for identifying similar sequences will be known to those skilled in the art. For example, a substantially similar nucleotide sequence will be encoded by a sequence that hybridizes to the DNA sequence or its complement under stringent conditions. By stringent conditions, we mean that the nucleotides hybridize to the filter-bound DNA or RNA in 3× sodium chloride / sodium citrate (SSC) at about 45° C., followed by at least one wash in 0.2× SSC / 0.1% SDS at about 20-65° C. Alternatively, a substantially similar polypeptide may differ from, for example, the sequences shown in SEQ ID Nos: 3 and 5 by at least 1, but less than 5, 10, 20, 50, or 100 amino acids.

[0203] Due to the degeneracy of the genetic code, it is apparent that any of the nucleic acid sequences described herein can be altered or varied without substantially affecting the sequence of the protein encoded thereby, to provide functional variants thereof. Suitable nucleotide variants are those having sequences altered by substituting different codons encoding the same amino acid in the sequence, thereby producing a silent change. Other suitable variants are those having homologous nucleotide sequences but comprising all or part of the sequence altered by replacing different codons encoding amino acids with side chains having biophysical properties similar to the amino acid replaced, to produce conservative changes. For example, small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include serine, threonine, cysteine, asparagine, and glutamine. Positively charged (basic) amino acids include lysine, arginine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Thus, it will be understood which amino acids can be replaced by amino acids with similar biophysical properties, and the skilled artisan will know the nucleotide sequences encoding these amino acids.

[0204] All features described herein (including any accompanying claims, abstract, and drawings) and / or all steps of any disclosed method or process may be combined with any of the above-described aspects in any combination, except combinations where at least some of these features and / or steps are mutually exclusive. BRIEF DESCRIPTION OF THE DRAWINGS

[0205] For a better understanding of the invention, and to show how embodiments thereof may be effected, reference will now be made by way of example to the accompanying drawings, in which:-

[0206] Figure 1 A schematic diagram of the gene construct "ITR-CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA-ITR" (SEQ ID No: 16) is shown, which is contained in the rAAV according to the present invention and is referred to as "#036" throughout the examples.

[0207] Figure 2 Shows the use Figure 1 Results of immunoblot analysis of transgene expression (hmBDNF, TrkB) and the presence of activated TrkB (phospho-TrkB: pTrkB) in HEK293 cells 2 days after rAAV#036 transduction (n=2) are shown in the figure. In the figure, rAAV#036 is indicated as "#036" and hmBDNF is indicated as "BDNF."

[0208] Figure 3 The images were displayed at 3.0 × 10 per eye. 7 (3.0e7)vg / 1μL、9.0×10 7 (9.0e7)vg / 1μL or 2.7×10 8 (2.7e8) vg / 1 μL dose intravitreally administered Figure 1 ELISA results for the expression level of the transgene product (hmBDNF) in mouse retinal tissue 3 weeks after rAAV#036 administration are shown in the figure. The error bars in the figure represent the mean ± standard error of the mean for each group (n=8 or 9). In the figure, rAAV#036 is represented as "#036" and hmBDNF is represented as "BDNF".

[0209] Figure 4 The images were taken at 2.7 × 10 per eye. 8 (2.7e8) vg / 1 μL dose intravitreally administered Figure 1Results of immunoblot analysis of the expression of transgene products (hmBDNF, TrkB) and the presence of activated TrkB (pTrkB) in mouse retinal tissue 3 weeks after rAAV#036 administration (n=3) are shown in the figure. In the figure, rAAV#036 is indicated as "#036" and hmBDNF is indicated as "BDNF."

[0210] Figure 5 Shown are the results of alkaline agarose gel electrophoresis analysis of genomic DNA of rAAV#007 (sCAG-hTrkB-P2A-SP-hmBDNF-WPRE(S)-SV40pA), rAAV#008 (CMV-hTrkB-P2A-SP-hmBDNF-WPRE(S)-SV40pA), and rAAV#036 (CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA). The total genome lengths of rAAV#007, rAAV#008, and rAAV#036 are approximately 4.8 kb, approximately 4.6 kb, and approximately 4.6 kb, respectively.

[0211] Figure 6 The productivity of rAAV#007, rAAV#008, and rAAV#036 is shown. The vertical axis shows the relative titer (calculated using ITR primers) of vector genome concentrations of rAAV#008 compared to rAAV#007 and rAAV#036 compared to rAAV#008 in cell lysates.

[0212] Figure 7 The results of alkaline agarose gel electrophoresis analysis of genomic DNA of rAAV#036, rAAV2.Max#036, and rAAV2.7m8#036 are shown. The total genome length of rAAV#036, rAAV2.Max#036, and rAAV2.7m8#036 is approximately 4.6 kb.

[0213] Figure 8 The productivity of rAAV#036, rAAV2.Max#036, and rAAV2.7m8#036 is shown. The vertical axis shows the relative titer of the vector genome concentration of rAAV#036, rAAV2.Max#036, and rAAV2.7m8#036 in cell lysates (calculated using ITR primers).

[0214] Figure 9 The results were shown at 6.3×10 per eye. 10Vector copy number (copies / μg DNA) in monkey retinal tissue using real-time PCR 8 weeks after intravitreal administration of rAAV#036, rAAV2.Max#036, and rAAV2.7m8#036 at a dose of vg / 70 μL. Error bars in the graph represent the mean ± standard error of the mean for each group (n=3).

[0215] Figure 10 The results were shown at 6.3×10 per eye. 10 RNA expression levels of BDNF and TrkB corrected for GAPDH were measured in monkey retinal tissue using real-time PCR 8 weeks after intravitreal administration of rAAV#036, rAAV2.Max#036, and rAAV2.7m8#036 at a dose of 500 μg / 70 μL. Error bars in the graph represent the mean ± standard error of the mean for each group (n=3).

[0216] Figure 11 The images were taken at 6.0 × 10 10 (6.0e10)vg / 70μL or 3.0×10 11 Whole-body retinal nerve fiber layer (RNFL) thickness of the optic nerve head in non-laser-treated and laser-treated eyes using optical coherence tomography (OCT) annular scans after intravitreal administration of vehicle or rAAV2.7m8#036 at a dose of (3.0e11) vg / 70 μL. Error bars in the graph represent the mean ± standard error of the mean for each group (n = 3 to 5).

[0217] Figure 12 The images were taken at 6.0 × 10 10 (6.0e10)vg / 70μL or 3.0×10 11 Percent change in photopic negativity response (PhNR) amplitude relative to pre-administration using focal electroretinography over the fovea in non-laser-treated and laser-treated eyes after intravitreal administration of vehicle or rAAV2.7m8#036 at a dose of (3.0e11) vg / 70 μL. Error bars in the graph represent the mean ± standard error of the mean for each group (n = 3 or 5). DETAILED DESCRIPTION

[0218] Example

[0219] The present inventors have observed that when producing some rAAV vectors described in WO 2017 / 072498 and Hum.Gene Ther., 2018.29(7): p.828-841, there are significant differences in yield. Specifically, the present inventors have observed that the rAAV vectors containing the TrkB gene and the BDNF gene designed according to the teachings of the prior art documents show breakage or truncation of the rAAV genomic DNA during production. The occurrence of truncation of the genomic DNA interferes with the efficient production of the rAAV vector containing the TrkB gene and the BDNF gene, thereby resulting in a decrease in the production efficiency of the rAAV vector. Accordingly, the present inventors set out to obtain rAAV vectors containing both the TrkB gene and the BDNF gene with reduced truncation of the genomic DNA.

[0220] Example 1—Production of rAAV Constructs

[0221] A plasmid containing a truncated CAG (short CAG: sCAG) promoter (0.8 kb) was designed according to the description of International Patent Publication No. WO 2017 / 072498 and Hum. Gene Ther., 2018.29(7): p.828-841, and pAAV-sCAG-hTrkB-P2A-SP-hmBDNF-WPRE(S)-SV40pA (SEQ ID No: 24) (this plasmid construct is also referred to as #007) was obtained. A plasmid construct pAAV-CMV-hTrkB-P2A-SP-hmBDNF-WPRE(S)-SV40pA (SEQ ID No: 25) (this plasmid construct is also referred to as #008) containing a CMV promoter (SEQ ID No: 1) was obtained. The plasmid construct pAAV-CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA (SEQ ID No: 26, wherein the signal peptide was modified from #008) was obtained (this plasmid construct is also referred to as #036).

[0222] Plasmid construct #036 contains the polynucleotide "ITR-CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA-ITR" (SEQ ID No: 16), which contains the polynucleotide "CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA" (SEQ ID No: 15). The polynucleotide "CMV-hTrkB-P2A-mSP-hmBDNF" (SEQ ID No: 14) is the region of SEQ ID No: 15 that spans the CMV promoter to the nucleotide sequence encoding hmBDNF. In addition, Figure 1A map of the polynucleotide "ITR-CMV-hTrkB-P2A-mSP-hmBDNF-WPRE(S)-SV40pA-ITR" (SEQ ID No: 16) contained in plasmid construct #036 is shown.

[0223] Plasmid construct #007 (including the sCAG promoter), plasmid construct #008 (including the CMV promoter), and plasmid construct #036 were used to generate rAAV2 vectors. The rAAV2s produced were designated rAAV#007, rAAV#008, and rAAV#036, respectively. Plasmid construct #036 was used to generate rAAV2.7m8 and designated rAAV2.7m8#036. Plasmid construct #036 was used to generate rAAV2 Max and designated rAAV2 Max#036. rAAV2.7m8 had a capsid comprising the amino acid sequence set forth in SEQ ID No: 18. rAAV2 Max had a capsid comprising the amino acid sequence set forth in SEQ ID No: 19.

[0224] Example 2—Expression of transgene product and activation of TrkB in HEK293 cells transduced with rAAV#036

[0225] One day before the rAAV transduction experiment, HEK293 cells were plated at 1 × 10 5 Cells / well were seeded on collagen I-coated 24-well microplates (Iwaki, catalog number No. 4820-010) and cultured statically in Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich Co. LLC, catalog number No. D6429) containing 10% fetal bovine serum (FBS, Hyclone, catalog number No. SH30070.03) and 1% penicillin-streptomycin (Thermo Fisher Scientific, catalog number No. 15070-063) at 37°C and 5% CO2.

[0226] One day after cell seeding, the entire medium was replaced with 425 μL of DMEM containing 1% FBS and 1% penicillin-streptomycin, and 75 μL of rAAV#036 or Dulbecco's phosphate-buffered saline (DPBS, Wako Pure Chemical Industries, Ltd., catalog number No. 045-29795) was added dropwise to the cells and statically cultured at 37°C and 5% CO2. For the addition, rAAV#036 was prepared in DPBS in advance to a concentration of 2.5×10 9 The final concentration was vg / mL.

[0227] Two days after the addition of rAAV, the cells were washed with DPBS and then cell lysis buffer was added thereto, and the lysate was collected and stored at -80°C. The cell lysis buffer was prepared to the following final concentrations: 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES, Thermo Fisher Scientific, catalog number 15630-080), 135 mM sodium chloride (NaCl, Wako Pure Chemical Industries, Ltd., catalog number 191-01665), 1% Triton(R) X-100 (Nacalai Tesque, Inc., catalog number 35501-15), 0.1% Benzonase(R) nuclease (Merck Millipore, catalog number 70664), and 1% Halt(TM) protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, catalog number 78441).

[0228] The thawed lysate was allowed to stand on ice for 20 minutes, then centrifuged at 4°C and 15,000 rpm for 5 minutes using a centrifuge (Hitachi, Ltd.), and the supernatant was used for subsequent testing. The protein concentration of the sample was measured using a Pierce (TM) BCA protein assay kit (Thermo Fisher Scientific, catalog number No. 23227) and determined using a microplate reader (SpectraMax Plus 384, Molecular Devices, LLC.) based on absorbance at 562 nm.

[0229] Western blotting was performed using equal amounts of protein from the samples to confirm the expression of transgenic products (hmBDNF and TrkB) and activation of TrkB (phospho-TrkB: pTrkB) in HEK293 cells. The following antibodies were used for detection; the primary antibodies used were rabbit anti-BDNF [EPR1292] antibody (Abcam plc., catalog number ab108319), rabbit anti-TrkB [80E3] antibody (Cell Signaling Technology: CST, catalog number 4603S), rabbit anti-phospho-TrkB [Tyr515] polyclonal antibody (Thermo Fisher Scientific, catalog number PA5-36695), and rabbit anti-β-actin antibody (Cell Signaling Technology, catalog number 4967S); the secondary antibodies used were ECL™ anti-rabbit IgG and HRP-linked F(ab')2 fragment (from donkey) (GE Healthcare, catalog number NA934V). Amersham(TM) ECL(TM) Prime Western Blot Detection Reagent (GE Healthcare, Catalog No. RPN2232) was used for detection in Western blots, and images were acquired using a ChemiDoc Touch Imaging System (Bio-Rad Laboratories, Inc.). Expression of hmBDNF and TrkB as transgene products and activation of TrkB were confirmed in cells transduced with rAAV#036 ( Figure 2 ). In the figure, rAAV#036 is represented as "#036" and hmBDNF is represented as "BDNF".

[0230] Example 3: Expression of transgene product and TrkB in retinal tissue of mice intravitreally administered rAAV#036 Activation

[0231] Vehicle or rAAV#036 was intravitreally administered to 5-week-old male C57BL / 6J mice (Charles River Laboratories Japan, Inc.), and the expression level of BDNF in the retinal tissue was analyzed 3 weeks after administration. A solution obtained by adding 0.001% Pluronic(TM) F-68 (Thermo Fisher Scientific, catalog number No. 24040032) to DPBS was used as a vehicle. 3.0×10 7 (3.0e7)vg / 1μL、9.0×10 7 (9.0e7)vg / 1μL or 2.7×10 8rAAV#036 was administered intravitreally at a dose of (2.7e8) vg / 1 μL. Under anesthesia, a glass pipette (Sankyo Medic Co., Ltd.) connected to a microinjector FemtoJet(R) 4i (Eppendorf) was inserted into the vitreous of each 5-week-old C57BL / 6J mouse, and 1 μL was administered to each eye. Three weeks after administration, each mouse was euthanized by bleeding under isoflurane anesthesia, and retinal tissue was sampled. After freezing the sampled retinal tissue with dry ice, the same cell lysis buffer as used for analyzing the expression of transgenic products in cultured cells in Example 2 was added thereto, and the resultant was homogenized by using BioMasher (Nippi, Incorporated, product catalog number No. 320103) and stored at -80°C.

[0232] The thawed lysate was allowed to stand on ice for 20 to 30 minutes and then centrifuged at 4°C and 15,000 rpm for 10 minutes using a centrifuge (Hitachi, Ltd.), and the supernatant was used for subsequent testing. The protein concentration of the sample was measured using a Pierce (TM) BCA protein assay kit and determined using a microplate reader based on the absorbance at 562 nm. The protein expression level of hmBDNF was determined by using a human free BDNF Quantikine (R) ELISA kit (R&D Systems, Inc., catalog number No. DBD00) and calculating the amount of hmBDNF protein using a microplate reader based on the absorbance (using the absorbance at 450 nm minus the absorbance at 540 nm), and then corrected by the total protein concentration ( Figure 3 ).

[0233] like Figure 3 As demonstrated, the expression of hmBDNF was confirmed in the mouse retinal tissue after intravitreal administration of rAAV#036. In addition, the expression of transgenic products (hmBDNF and TrkB) and the activation of TrkB in the retina after administration of rAAV#036 were evaluated by Western blotting. For this evaluation, the high dose (2.7×10 8 vg / 1 μL) rAAV#036-administered group and vehicle-administered group were evaluated, and three samples in each group that showed values ​​closest to the median in hmBDNF expression analysis using ELISA were selected. The reagents and procedures used in this evaluation were the same as those in Example 2. Expression of hmBDNF and TrkB as transgene products and activation of TrkB (pTrkB) were confirmed in retinal tissues of mice transduced with rAAV#036 ( Figure 4 ). In the figure, rAAV#036 is represented as "#036" and hmBDNF is represented as "BDNF".

[0234] Example 4: rAAV genomic DNA analysis

[0235] After subsequent treatment with DNase I and then proteinase K, the AAV genomic DNA of rAAV#036 was purified by isopropanol precipitation. DNA concentration was measured using a fluorometer (Thermo Fisher Scientific, Qubit(R) Fluorometer and Qubit(R) dsDNA HS Assay Kit), and 160 ng of AAV genomic DNA was analyzed by electrophoresis on an alkaline agarose gel containing 50 mM sodium hydroxide (NaOH). The AAV genomic DNA and DNA size markers used for electrophoresis were denatured at 95°C for 5 to 10 minutes in the presence of 50 mM NaOH / 0.3% SDS.

[0236] The gel after electrophoresis was stained with a single-stranded DNA staining reagent (Biotium, product catalog No. 41003, GelRed (TM)), and DNA was detected using a UV transilluminator (Bio-Rad Laboratories, Inc., ChemiDoc MP Imaging System). Figure 5 ). For rAAV#007 and rAAV#008, AAV genomic DNA analysis was also performed in the same manner, except that for rAAV#007, genomic DNA was purified by using a DNA purification column (QIAGEN, product catalog No. 28104, QIAquick(R) PCR purification kit). In the electrophoresis, 200 ng of genomic DNA was used for rAAV#007 and rAAV#008. Figure 5 As demonstrated, it was confirmed that truncation of genomic DNA was reduced in rAAV#036 and rAAV#008 (both of which included a CMV promoter) compared to that found for rAAV vectors including an sCAG promoter designed according to the description of International Patent Publication No. WO 2017 / 072498 and Hum. Gene Ther., 2018. 29(7): p. 828-841 (e.g., rAAV#007).

[0237] Example 5: Evaluation of rAAV production capacity

[0238] 0.2% Triton X-100 and 200 mM NaCl (both at their final concentrations) were added to the culture solution of the production cells of rAAV#007 and rAAV#008 to obtain cell lysates. After subsequent treatment with DNase I and Exo I, protease treatment and purification of AAV genomic DNA were performed using the QIAamp MinElute Virus Centrifugation Kit (QIAGEN, catalog number No. 57704). Real-time PCR was then performed using the AAVpro(R) Titration Kit for Real-Time PCR (TakaraBio Inc., catalog number No. 6233) and the ITR primers included with the kit. A calibration curve was prepared using the standard DNA included with the kit, and the relative titer of the vector genome concentration in the cell lysate was calculated ( Figure 6 ).

[0239] For rAAV#008 and rAAV#036, cell lysates were obtained 5 days after transfection, and the vg contained in each cell lysate was quantified in the same manner, except that after DNase I / Exo I treatment, AAV genomic DNA was extracted by proteinase K treatment, the solution was diluted with water, and then real-time PCR was performed.

[0240] like Figure 6 As demonstrated, it was confirmed that rAAV#008 containing a CMV promoter achieved improved productivity compared to an rAAV vector (e.g., rAAV#007) containing an sCAG promoter designed according to the description of International Patent Publication No. WO 2017 / 072498 and Hum. Gene Ther., 2018.29(7): p.828-841. Furthermore, it was confirmed that rAAV#036 exhibited high productivity similar to rAAV#008.

[0241] Example 6: rAAV2.7m8 vector and rAAV2 Max vector

[0242] AAV genomic DNA analysis and rAAV production capacity evaluation were performed for rAAV2.Max#036 and rAAV2.7m8#036. The genome integrity of rAAV2.Max#036 and rAAV2.7m8#036 was confirmed ( Figure 7 The relative titers contained in each cell lysate were quantified. It was confirmed that rAAV2.7m8#036 achieved improved production capacity compared to rAAV#036 and rAAV2.Max#036 ( Figure 8 ).

[0243] Example 7: Intravitreal administration of rAAV2.7m8 vector and rAAV2 Max vector in monkey retinal tissue Expression of product

[0244] 6.3×10 per eye 10 rAAV#036, rAAV2.Max#036, and rAAV2.7m8#036 were intravitreally administered to female cynomolgus monkeys (Shin Nippon Biomedical Laboratories, Ltd) at a dose of vg / 70 μL. Under anesthesia, a 30G MYSHOT(TM) insulin syringe (NIPRO Pharma Vietnam Co., Ltd.) was inserted into the vitreous of each monkey, and 70 μL was administered to each eye. Eight weeks after administration, each monkey was euthanized by bleeding under anesthesia, and retinal tissue was sampled. After freezing the retinal tissue samples, after homogenization using a BioMasher, DNA and RNA were isolated using NucleoSpin(R) RNA / Protein (Takara Bio Inc., Catalog No. 740933) and NucleoSpin(R) RNA / DNA Buffer Set (TakaraBio Inc., Catalog No. 740944).

[0245] DNA and RNA concentrations of the samples were measured using a NanoDrop™ 8000 spectrophotometer (Thermo Fisher Scientific). Vector copy number and RNA expression levels were analyzed by real-time PCR using Power SYBR™ Green PCR Master Mix (Thermo Fisher Scientific, Catalog No. 4368708). Vector copy number was calculated using primers designed based on the CMV promoter sequence in SEQ ID No: 26. RNA primers were designed based on the BDNF and TrkB sequences in SEQ ID No: 26, respectively. BDNF and TrkB RNA expression levels were normalized using GAPDH.

[0246] Compared with rAAV#036 and rAAV2.Max#036, an increase in vector copy number in monkey retina was observed by rAAV2.7m8#036 ( Figure 9 Similarly, enhanced RNA expression levels of BDNF and TrkB in monkey retina were observed by rAAV2.7m8#036 compared with rAAV#036 and rAAV2.Max#036 ( Figure 10 ). Thus, these data indicate that the rAAV vectors according to the present invention exhibit improved transduction efficiency and can increase the RNA expression levels of BDNF and TrkB in retinal tissue when administered in vivo.

[0247] Example 8: rAAV2.7m8 #036 on retinal ganglion cells (RGC) in a monkey model of intraocular hypertension

[0248] Efficacy of related structures and functions

[0249] Male cynomolgus monkeys aged 4 to 9 years (Shin Nippon Biomedical Laboratories, Ltd.) were used as an experimental glaucoma model. As previously described (Ophthalmic Res., 2017.58(2):99-106), laser light was applied around the trabecular meshwork for uniform 360-degree irradiation at a wavelength of 532 nm. As previously reported, an increase in intraocular pressure (IOP) was confirmed in laser-treated eyes compared with non-laser-treated eyes. Nineteen days after laser application, the intraocular pressure (IOP) of the laser-treated eyes was increased at a dose of 6.0 × 10 10 (6.0e10)vg / 70μL or 3.0×10 11 Vehicle or rAAV2.7m8#036 was administered intravitreally at a dose of (3.0e11) vg / 70 μL. A solution obtained by adding 0.01% Poloxamer 188 (Merck Millipore, catalog number No. 137097) to PBS was used as a vehicle. Under anesthesia, a 30G MYSHOT (TM) insulin syringe or a BD insulin syringe (Becton Dickinson & Co.) with a BD Ultra-Fine (TM) 8mm×30G needle was inserted into the vitreous of each monkey, and 70 μL was administered to each eye. 16 weeks after laser application, the retinal nerve fiber layer (RNFL) thickness around the optic nerve head and the photopic negative wave response (PhNR) were measured in both eyes of each monkey under anesthesia. As previously described (Ophthalmic Res., 2017. 58(2):99-106), annular scans of the bilateral optic nerve heads were performed and overall RNFL thickness was measured using a Spectralis(R) optical coherence tomography (OCT) device (Heidelberg Engineering Ltd.). After contact lens-type electrodes were placed on the cornea, the RNFL thickness was measured by light stimulation (duration: 100 ms, stimulus light: 5, background light: 5, stimulus light size: 15°, intensity: 3.082 cds / m) using a Kowa ER-80 (Kowa Co., Ltd.) and PuREC (PC100-A, Mayo Ltd.). 2, background light: white) measured the local electroretinogram over the fovea. PhNR is a slow negative wave reflecting the activity of RGCs and their axons, and it has been reported that the PhNR amplitude is reduced in patients with glaucoma (Doc Ophthalmol., 2018.136(3):207-211; Invest Ophthalmol Vis Sci., 2008.49:2201-2207). As described (Doc Ophthalmol., 2018.136(3):207-211), the PhNR amplitude was measured from the peak of the b wave to the maximum amplitude in the trough immediately following the i wave.

[0250] A protective effect of rAAV2.7m8#036 on overall RNFL thickness was observed in laser-treated eyes, where overall RNFL thickness remained similar to that of non-laser-treated eyes. In contrast, overall RNFL thickness was reduced in vehicle-treated eyes compared to non-laser-treated eyes ( Figure 11 A protective effect of rAAV2.7m8#036 on the percentage change in PhNR amplitude relative to pre-administration in laser-treated eyes was also observed. In contrast, the percentage change in PhNR in laser-treated eyes was reduced by vehicle compared to non-laser-treated eyes ( Figure 12 ). Therefore, these data indicate that the rAAV vector according to the present invention exhibits a protective effect on RGC-related structure and function in the experimental monkey glaucoma model.

[0251] in conclusion

[0252] As demonstrated throughout the Examples, the present inventors discovered that rAAV vectors carrying a cytomegalovirus (CMV) promoter operably linked to a naturally occurring TrkB gene and a naturally occurring mature BDNF gene exhibited reduced fragmentation / truncation of genomic DNA. This means that the rAAV vectors of the present invention comprising a CMV promoter operably linked to naturally occurring TrkB and mBDNF can be produced with improved production efficiency and yield, and the rAAV vectors have increased transduction efficiency to the retina and have demonstrated protective effects on RGC-related structures and functions in an experimental monkey glaucoma model.

[0253] References

[0254] 1. International Patent Publication No. WO 2017 / 072498

[0255] 2. International Patent Publication No. WO 2018 / 185468

[0256] 3.Hum.Gene Ther.,2018.29(7):p.828-841

[0257] 4.Cell Death Dis.,2018.9:1007。

Claims

1. A recombinant adeno-associated virus (rAAV) vector comprising a gene construct comprising, in the 5' to 3' direction: - Cytomegalovirus (CMV) promoter; - a first coding sequence encoding tyrosine kinase receptor B (TrkB); - a nucleotide sequence encoding a linker for producing TrkB and mature brain-derived neurotrophic factor (mBDNF) as separate proteins; and - a second coding sequence encoding mBDNF, wherein the CMV promoter is operably linked to the first coding sequence and the second coding sequence. 2 . The rAAV vector according to claim 1 , wherein the CMV promoter comprises the nucleotide sequence shown in SEQ ID No: 1, or a fragment or variant thereof.

3. The rAAV vector according to claim 1, wherein the first coding sequence encodes a naturally occurring TrkB or a variant thereof having the function thereof.

4. The rAAV vector according to claim 1, wherein the first coding sequence encodes the amino acid sequence shown in SEQ ID No: 2, or a fragment or variant thereof, and / or wherein the first coding sequence comprises the nucleotide sequence shown in SEQ ID No: 3, or a fragment or variant thereof.

5. The rAAV vector of claim 1, wherein the second coding sequence encodes naturally occurring mBDNF.

6. The rAAV vector according to claim 1, wherein the second coding sequence encodes the amino acid sequence shown in SEQ ID No: 4, or a fragment or variant thereof, and / or wherein the second coding sequence comprises the nucleotide sequence shown in SEQ ID No: 5, or a fragment or variant thereof.

7. The rAAV vector according to claim 1, wherein the gene construct further comprises a nucleotide sequence encoding a signal peptide, optionally wherein the signal peptide is located at the 5' side of the nucleotide sequence encoding mBDNF, and / or wherein the nucleotide sequence encoding the signal peptide is located at the 3' side of the nucleotide sequence encoding the linker.

8. The rAAV vector according to claim 7, wherein the nucleotide sequence encoding the signal peptide encodes the amino acid sequence shown in SEQ ID No: 6 or SEQ ID No: 20, or a fragment or variant thereof, and / or wherein the signal peptide comprises the nucleotide sequence shown in SEQ ID No: 7 or SEQ ID No: 21, or a fragment or variant thereof.

9. The rAAV vector of claim 1, wherein the linker is a P2A peptide.

10. The rAAV vector according to claim 1, wherein the nucleotide sequence encoding the linker encodes the amino acid sequence shown in SEQ ID No: 8, or a fragment or variant thereof, and / or wherein the linker comprises the nucleotide sequence shown in SEQ ID No: 9, or a fragment or variant thereof.

11. The rAAV vector according to claim 1, wherein the gene construct further comprises a nucleotide sequence encoding a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), optionally wherein the WPRE comprises the nucleotide sequence shown in SEQ ID No: 10, or a fragment or variant thereof.

12. The rAAV vector according to claim 1, wherein the gene construct further comprises a nucleotide sequence encoding a poly A signal sequence, optionally wherein the poly A signal sequence comprises the nucleotide sequence shown in SEQ ID No: 11, or a fragment or variant thereof.

13. The rAAV vector of claim 1, wherein the rAAV vector comprises a gene construct comprising, in 5' to 3' direction, a CMV promoter sequence, a first coding sequence encoding TrkB, a nucleotide sequence encoding a P2A linker peptide, a nucleotide sequence encoding a signal peptide, a second coding sequence encoding mBDNF, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and a simian virus 40 (SV40) poly A signal sequence. 14 . The rAAV vector according to claim 1 , wherein the gene construct comprises the nucleotide sequence shown in any one of SEQ ID Nos: 14 to 17, or a variant or fragment thereof.

15. The rAAV vector of claim 1, wherein the rAAV vector is a rAAV2 vector.

16. The rAAV vector of claim 1, wherein the rAAV vector is a rAAV2.7m8 vector.

17. The rAAV vector of claim 1, for use as a medicament or in therapy.

18. The rAAV vector according to claim 1, for use in treating, preventing or ameliorating optic nerve disorders and / or retinal degenerative diseases involving retinal ganglion cell degeneration.

19. The rAAV vector of claim 18, wherein the optic nerve disorder and / or retinal degenerative disease involving retinal ganglion cell degeneration is glaucoma or glaucomatous optic neuropathy.

20. A method for treating, preventing or ameliorating an optic nerve disorder and / or a retinal degenerative disease involving retinal ganglion cell degeneration in a subject, the method comprising administering to the subject in need of such treatment a therapeutically effective amount of the rAAV vector of claim 1.

21. A pharmaceutical composition comprising the recombinant rAAV vector of claim 1 and a pharmaceutically acceptable vehicle.

22. A method for preparing the pharmaceutical composition of claim 21, comprising contacting the recombinant rAAV vector of claim 1 with a pharmaceutically acceptable vehicle.

23. A method for producing the rAAV vector of claim 1, comprising: (i) introducing a gene construct into an rAAV vector production cell, the gene construct comprising in the 5' to 3' direction: - Cytomegalovirus (CMV) promoter; - a first coding sequence encoding tyrosine kinase receptor B (TrkB); - a nucleotide sequence encoding a linker for producing TrkB and mature brain-derived neurotrophic factor (mBDNF) as separate proteins; and - a second coding sequence encoding mBDNF, wherein the CMV promoter is operably linked to the first coding sequence and the second coding sequence; and (ii) culturing the rAAV vector-producing cell to produce the rAAV vector of claim 1.

24. An rAAV vector production cell comprising the gene construct of the rAAV vector according to claim 1.

Images