Antisense oligomers for treating conditions and diseases based on non-sense mediated RNA decay

By using therapeutic agents or vectors to promote the incorporation of ASCE in cells and combining them with antisense oligomers to regulate mRNA splicing, the problem of non-productive mRNA caused by alternative splicing events is solved, and the expression of target proteins and the effect of disease treatment are improved.

CN120641565APending Publication Date: 2025-09-12STOKE PHARM
View PDF 20 Cites 0 Cited by

Patent Information

Application Number
CN202380085439.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-10-31
Filing Date
2023-10-30
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively regulate non-productive mRNA transcripts caused by alternative splicing events, which in turn leads to abnormal protein expression and affects the effectiveness of disease treatment.

Method used

By contacting cells with therapeutic agents or vectors encoding therapeutic agents, the inclusion of alternatively spliced ​​coding exons (ASCEs) during the processing of pre-mRNA is promoted, the level of processed mRNA is increased, and antisense oligomers (ASOs) are used to bind to the mRNA targeting portion to regulate the splicing process of ASCE and reduce nonsense-mediated RNA decay.

Benefits of technology

It improves the expression level of the target protein and enhances the therapeutic effect of the disease, especially by increasing the mRNA processing level and expression of the target protein, regulating abnormal protein expression, and improving the therapeutic potential of related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120641565A_ABST
    Figure CN120641565A_ABST
Patent Text Reader

Abstract

A variable splicing event in a gene may result in a non-productive mRNA transcript, which in turn may result in abnormal or reduced protein expression, and therapeutic agents that can target the variable splicing event in the gene can modulate the expression level of a functional protein and / or inhibit aberrant protein expression in a patient. Such therapeutic agents can be used to treat conditions or diseases caused by protein deficiency.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 381,640, filed on October 31, 2022, which is incorporated herein by reference in its entirety. Background Art

[0003] Alternative splicing events in genes may produce non-productive mRNA transcripts, which in turn may lead to abnormal protein expression, and therapeutic agents that can target these alternative splicing events in genes can modulate the expression level of functional proteins in patients and / or inhibit abnormal protein expression. Such therapeutic agents can be used to treat conditions or diseases caused by protein deficiency. Summary of the Invention

[0004] In some aspects, provided herein is a method of modulating expression of a target protein in a cell, the cell comprising a pre-mRNA transcribed from a target gene and encoding the target protein, the pre-mRNA comprising an alternatively spliced ​​coding exon (ASCE), wherein the alternatively processed mRNA produced by splicing out the ASCE during processing of the pre-mRNA undergoes nonsense-mediated RNA decay, the method comprising contacting a therapeutic agent or a vector encoding the therapeutic agent with the cell, wherein the therapeutic agent promotes incorporation of the ASCE during the processing of the pre-mRNA, thereby increasing the level of processed mRNA processed from the pre-mRNA and comprising the ASCE.

[0005] In some aspects, provided herein is a method of treating a subject in need thereof or reducing the likelihood of developing a disease or condition by modulating expression of a target protein in a cell of the subject, the method comprising contacting the cell of the subject with a therapeutic agent or a vector encoding the therapeutic agent, wherein the cell comprises a pre-mRNA transcribed from a target gene and encoding the target protein, the pre-mRNA comprising an alternatively spliced ​​coding exon (ASCE), wherein the alternatively processed mRNA produced by splicing out the ASCE during processing of the pre-mRNA undergoes nonsense-mediated RNA decay, wherein the therapeutic agent promotes incorporation of the ASCE during the processing of the pre-mRNA, thereby increasing the level of processed mRNA processed from the pre-mRNA and comprising the ASCE.

[0006] In some embodiments, said expression of said target protein is increased in said cell.

[0007] In some embodiments, the target gene is selected from the group consisting of PKD1, ABCA4, FUS, CEL, and NSD1.

[0008] In some embodiments, the target protein is selected from the group consisting of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, and nuclear receptor binding SET domain protein 1.

[0009] In some embodiments, the therapeutic agent

[0010] (a) binding to a targeting moiety of the mRNA encoding the target protein;

[0011] (b) regulating the binding of a factor involved in the splicing of said ASCE; or

[0012] (c) A combination of (a) and (b).

[0013] In some embodiments, said therapeutic agent interferes with the binding of said factor involved in splicing of said ASCE to a region of said targeting moiety.

[0014] In some embodiments, the targeting moiety is proximal to the ASCE.

[0015] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of the 5' end of the ASCE.

[0016] In some embodiments, the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, or about 1 nucleotide upstream of the 5' end of the ASCE.

[0017] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of the 3' end of the ASCE.

[0018] In some embodiments, the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, or about 1 nucleotide downstream of the 3' end of the ASCE.

[0019] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9133066530; and GRCh38 / hg38: chr5 177238237.

[0020] In some embodiments, the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9133066530; and GRCh38 / hg38: chr5 177238237.

[0021] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9133066660; and GRCh38 / hg38: chr5 177238507.

[0022] In some embodiments, the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9133066660; and GRCh38 / hg38: chr5 177238507.

[0023] In some embodiments, the targeting moiety is located in an intronic region between the ASCE and a typical exonic region upstream of the ASCE of the mRNA encoding the target protein.

[0024] In some embodiments, the targeting moiety is located in an intronic region between the ASCE and a typical exonic region downstream of the ASCE of the mRNA encoding the target protein.

[0025] In some embodiments, the targeting moiety at least partially overlaps with the ASCE.

[0026] In some embodiments, the targeting moiety at least partially overlaps with an intron located upstream or downstream of the ASCE.

[0027] In some embodiments, the targeting moiety does not comprise a 5' exon-intron junction or a 3' exon-intron junction.

[0028] In some embodiments, the targeting moiety is located within the ASCE.

[0029] In some embodiments, the targeting moiety comprises about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the ASCE.

[0030] In some embodiments, the mRNA encoding the target protein comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 6-10.

[0031] In some embodiments, the mRNA encoding the target protein is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1-5.

[0032] In some embodiments, the targeting portion of the mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a region of at least 8 contiguous nucleic acids comprising a sequence selected from the group consisting of SEQ ID NOs: 6-10.

[0033] In some embodiments, the targeting moiety of the mRNA is within the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 2092954 2093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr16 3118680231186836; GRCh38 / hg38: chr9 133066530133066660; and GRCh38 / hg38: chr5 177238237 177238507.

[0034] In some embodiments, the targeting moiety of the mRNA is located upstream or downstream of the ASCE, the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 20929542093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr1631186802 31186836; GRCh38 / hg38: chr9 133066530133066660; and GRCh38 / hg38: chr5 177238237 177238507.

[0035] In some embodiments, the targeting portion of the mRNA does not comprise an exon-intron junction of an ASCE selected from the group consisting of: GRCh38 / hg38: chrl6 2092954 2093093; GRCh38 / hg38: chrl 9411143894111579; GRCh38 / hg38: chrl6 3118680231186836; GRCh38 / hg38: chr9 133066530133066660; and GRCh38 / hg38: chr5 177238237 177238507.

[0036] In some embodiments, the target protein produced is a full-length protein or a wild-type protein.

[0037] In some embodiments, the incorporation of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.2-fold to about 10-fold, about 1.3-fold to about 10-fold, about 1.6-fold to about 10-fold, about 1.7-fold to about 10-fold, about 1.9-fold to about 10-fold, about 2.0-fold to about 2.5-fold, about 2.1-fold to about 2.5-fold, about 2.6-fold to about 10-fold, about 3.0-fold to about 10-fold, about 4.0-fold to about 10-fold, about 5.0-fold to about 5.5-fold, about 6.0-fold to about 10-fold, about 7.0-fold to about 10-fold, about 8.0-fold to about 10-fold, about 9.0-fold to about 10-fold, about 10. 1.1 times to about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0038] In some embodiments, the level of the processed mRNA in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 11-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 1.1-fold to about 20-fold, about 1.1-fold to about 21-fold, about 1.1-fold to about 22-fold, about 1.1-fold to about 23-fold, about 1.1-fold to about 24-fold, about 1.1-fold to about 25-fold, about 1.1-fold to about 26-fold, about 1.1-fold to about 27-fold, about 1.1-fold to about 28-fold, about 1.1-fold to about 29-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0039] In some embodiments, the level of the target protein produced in the cells contacted with the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 11-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 1.1-fold to about 20-fold, about 1.1-fold to about 21-fold, about 1.1-fold to about 22-fold, about 1.1-fold to about 23-fold, about 1.1-fold to about 24-fold, about 1.1-fold to about 25-fold, about 1.1-fold to about 26-fold, about 1.1-fold to about 27-fold, about 1.1-fold to about 28-fold, about 1.1-fold to about 29-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 31-fold, about 1.1-fold to about 31-fold, about 1.1-fold to about 32-fold, about 1. about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0040] In some embodiments, the exclusion of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent is reduced by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, compared to the exclusion of the ASCE during the processing of the pre-mRNA in a corresponding cell not contacted with the therapeutic agent or the vector encoding the therapeutic agent. times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0041] In some embodiments, the target protein is NSD1, and wherein the method results in modification of a histone in the cell.

[0042] In some embodiments, the histone is histone H3.

[0043] In some embodiments, the modification comprises acetylation, methylation, phosphorylation, or ubiquitination.

[0044] In some embodiments, the modification is methylation.

[0045] In some embodiments, said methylation of said histone is increased in said cell.

[0046] In some embodiments, the methylation of the histone in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 11-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 1.1-fold to about 20-fold, about 1.1-fold to about 21-fold, about 1.1-fold to about 22-fold, about 1.1-fold to about 23-fold, about 1.1-fold to about 24-fold, about 1.1-fold to about 25-fold, about 1.1-fold to about 26-fold, about 1.1-fold to about 27-fold, about 1.1-fold to about 28-fold, about 1.1-fold to about 29-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 3 .1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0047] In some embodiments, the method further comprises assessing the mRNA level or expression level of the target protein.

[0048] In some embodiments, the disease or condition is induced by a loss-of-function mutation in the target gene.

[0049] In some embodiments, the disease or condition is associated with haploinsufficiency of a gene encoding the target protein, and the subject has a first allele that encodes a functional target protein and a second allele that does not produce the target protein or produces the target protein at reduced levels, or encodes a non-functional target protein or a partially functional target protein.

[0050] In some embodiments, the disease or condition is selected from the group consisting of: polycystic kidney disease 1 with or without polycystic liver disease; autosomal dominant polycystic kidney disease; age-related macular degeneration-2; Stargardt disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young type 8 with exocrine dysfunction; maturity-onset diabetes of the young; Sotos syndrome 1; and Beckwith-Wiedemann syndrome.

[0051] In some embodiments, the disease or condition is associated with an autosomal recessive mutation in a gene encoding the target protein, wherein the subject has a first allele encoding for: (i) not producing the target protein or producing the target protein at a reduced level compared to the wild-type allele; or (ii) producing the target protein that is non-functional or partially functional compared to the wild-type allele; and a second allele: (iii) producing the target protein at a reduced level compared to the wild-type allele and producing the target protein that is at least partially functional compared to the wild-type allele; or (iv) producing the target protein that is partially functional compared to the wild-type allele.

[0052] In some embodiments, the disease or condition is induced by a gain-of-function mutation in the target protein.

[0053] In some embodiments, the subject has an allele that produces the target protein at increased levels, or an allele that encodes a mutant target protein that exhibits increased activity in the cell.

[0054] In some embodiments, the subject is a human.

[0055] In some embodiments, the subject is a non-human animal.

[0056] In some embodiments, the subject is a fetus, embryo, or child.

[0057] In some embodiments, the cell or cells are ex vivo, or in an ex vivo tissue or organ.

[0058] In some embodiments, the therapeutic agent is administered to the subject by intrathecal, intracerebroventricular, intraperitoneal, intramuscular, subcutaneous, intravitreal, or intravenous injection.

[0059] In some embodiments, the method further comprises administering to the subject a second therapeutic agent.

[0060] In some embodiments, the second therapeutic agent is a small molecule.

[0061] In some embodiments, the second therapeutic agent is an antisense oligomer.

[0062] In some embodiments, the second therapeutic agent corrects intron retention.

[0063] In some embodiments, the disease or condition is a disease or condition associated with a deficiency in the amount or activity of the target protein.

[0064] In some embodiments, the disease or condition is a disease or condition associated with a deficiency in the amount or activity of a protein that the target protein functionally enhances, compensates for, replaces, or functionally interacts with.

[0065] In some embodiments, the disease or condition is caused by a deficiency in the amount or activity of the target protein.

[0066] In some embodiments, the method further comprises assessing the subject's genome for at least one genetic mutation associated with the disease.

[0067] In some embodiments, at least one genetic mutation is located within a locus of a gene associated with the disease.

[0068] In some embodiments, at least one genetic mutation is located within a locus associated with expression of a gene associated with the disease.

[0069] In some embodiments, at least one genetic mutation is located within the locus of the gene encoding the target protein.

[0070] In some embodiments, at least one genetic mutation is located within a locus associated with expression of the gene encoding the target protein.

[0071] In some embodiments, the method treats the disease or condition.

[0072] In some embodiments, the target protein is a typical isoform of the protein.

[0073] In some embodiments, the alternatively processed mRNA produced by splicing out the ASCE comprises a premature termination codon (PTC).

[0074] In some embodiments, the agent is an antisense oligomer (ASO).

[0075] In some embodiments, the ASO is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the targeting portion of the mRNA.

[0076] In some embodiments, the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to at least 8 contiguous nucleic acids of a sequence selected from the group consisting of SEQ ID NOs: 6-10.

[0077] In some embodiments, the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphodiamidate linkage.

[0078] In some embodiments, the ASO comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

[0079] In some embodiments, the ASO comprises at least one modified sugar moiety.

[0080] In some embodiments, each sugar moiety is a modified sugar moiety.

[0081] In some embodiments, the ASO consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases or 12 to 15 nucleobases.

[0082] In some embodiments, the target gene is NSD1 and the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of SEQ ID NOs: 16-1748.

[0083] In some embodiments, the target gene is NSD1, and the vector encoding the agent encodes a polynucleotide comprising a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5D, Table 5E, Table 5G, and Table 5G-1.

[0084] In some embodiments, the vector encoding the agent is a viral vector.

[0085] In some embodiments, the viral vector is an adeno-associated viral vector.

[0086] In some embodiments, the vector encoding the agent encodes a polynucleotide comprising an ASO sequence and a snRNA.

[0087] In some embodiments, the snRNA comprises a modified snRNA.

[0088] In some embodiments, the modified snRNA is a modified U1 snRNA or a modified U7 snRNA.

[0089] In some embodiments, the snRNA comprises U1 snRNA.

[0090] In some embodiments, the target gene is NSD1 and the ASO sequence comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5B, Table 5D, Table 5E, and Table 5G.

[0091] In some embodiments, the snRNA comprises U7 snRNA.

[0092] In some embodiments, the target gene is NSD1 and the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5G, and Table 5G-1.

[0093] In some aspects, provided herein is a composition comprising an agent or a vector encoding the agent, wherein the agent modulates splicing of a pre-mRNA in a cell, the pre-mRNA being transcribed from a target gene and encoding the target protein, wherein the pre-mRNA comprises an alternatively spliced ​​coding exon (ASCE), wherein the alternatively processed mRNA produced by splicing out the ASCE during processing of the pre-mRNA undergoes nonsense-mediated RNA decay, wherein the agent promotes incorporation of the ASCE during the processing of the pre-mRNA, thereby increasing the level of processed mRNA processed from the pre-mRNA and comprising the ASCE.

[0094] In some embodiments, said agent increases expression of said target protein in said cell.

[0095] In some embodiments, the target gene is selected from the group consisting of PKD1, ABCA4, FUS, CEL, and NSD1.

[0096] In some embodiments, the target protein is selected from the group consisting of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, and nuclear receptor binding SET domain protein 1.

[0097] In some embodiments, the agent

[0098] (a) binding to a targeting moiety of the mRNA encoding the target protein;

[0099] (b) regulating the binding of factors involved in the splicing of said ASCE; or

[0100] (c) A combination of (a) and (b).

[0101] In some embodiments, said agent interferes with the binding of said factor involved in splicing of said ASCE to a region of said targeting moiety.

[0102] In some embodiments, the targeting moiety is proximal to the ASCE.

[0103] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of the 5' end of the ASCE.

[0104] In some embodiments, the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, or about 1 nucleotide upstream of the 5' end of the ASCE.

[0105] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of the 3' end of the ASCE.

[0106] In some embodiments, the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, or about 1 nucleotide downstream of the 3' end of the ASCE.

[0107] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9133066530; and GRCh38 / hg38: chr5 177238237.

[0108] In some embodiments, the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9133066530; and GRCh38 / hg38: chr5 177238237.

[0109] In some embodiments, the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9133066660; and GRCh38 / hg38: chr5 177238507.

[0110] In some embodiments, the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9133066660; and GRCh38 / hg38: chr5 177238507.

[0111] In some embodiments, the targeting moiety is located in an intronic region between the ASCE and a typical exonic region upstream of the ASCE of the mRNA encoding the target protein.

[0112] In some embodiments, the targeting moiety is located in an intronic region between the ASCE and a typical exonic region downstream of the ASCE of the mRNA encoding the target protein.

[0113] In some embodiments, the targeting moiety at least partially overlaps with the ASCE.

[0114] In some embodiments, the targeting moiety at least partially overlaps with an intron located upstream or downstream of the ASCE.

[0115] In some embodiments, the targeting moiety does not comprise a 5' exon-intron junction or a 3' exon-intron junction.

[0116] In some embodiments, the targeting moiety is located within the ASCE.

[0117] In some embodiments, the targeting moiety comprises about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the ASCE.

[0118] In some embodiments, the mRNA encoding the target protein comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 6-10.

[0119] In some embodiments, the mRNA encoding the target protein is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1-5.

[0120] In some embodiments, the targeting portion of the mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a region of at least 8 contiguous nucleic acids comprising a sequence selected from the group consisting of SEQ ID NOs: 6-10.

[0121] In some embodiments, the targeting moiety of the mRNA is within the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 2092954 2093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr16 3118680231186836; GRCh38 / hg38: chr9 133066530133066660; and GRCh38 / hg38: chr5 177238237 177238507.

[0122] In some embodiments, the targeting moiety of the mRNA is located upstream or downstream of the ASCE, the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 20929542093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr1631186802 31186836; GRCh38 / hg38: chr9 133066530133066660; and GRCh38 / hg38: chr5 177238237 177238507.

[0123] In some embodiments, the targeting portion of the mRNA does not comprise an exon-intron junction of an ASCE selected from the group consisting of: GRCh38 / hg38: chrl6 2092954 2093093; GRCh38 / hg38: chrl 9411143894111579; GRCh38 / hg38: chrl6 3118680231186836; GRCh38 / hg38: chr9 133066530133066660; and GRCh38 / hg38: chr5 177238237 177238507.

[0124] In some embodiments, the target protein produced is a full-length protein or a wild-type protein.

[0125] In some embodiments, the incorporation of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.2-fold to about 10-fold, about 1.3-fold to about 10-fold, about 1.6-fold to about 10-fold, about 1.7-fold to about 10-fold, about 1.9-fold to about 10-fold, about 2.0-fold to about 2.5-fold, about 2.1-fold to about 2.5-fold, about 2.6-fold to about 10-fold, about 3.0-fold to about 10-fold, about 4.0-fold to about 10-fold, about 5.0-fold to about 5.5-fold, about 6.0-fold to about 10-fold, about 7.0-fold to about 10-fold, about 8.0-fold to about 10-fold, about 9.0-fold to about 10-fold, about 10. 1.1 times to about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0126] In some embodiments, the level of the processed mRNA in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 11-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 1.1-fold to about 20-fold, about 1.1-fold to about 21-fold, about 1.1-fold to about 22-fold, about 1.1-fold to about 23-fold, about 1.1-fold to about 24-fold, about 1.1-fold to about 25-fold, about 1.1-fold to about 26-fold, about 1.1-fold to about 27-fold, about 1.1-fold to about 28-fold, about 1.1-fold to about 29-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0127] In some embodiments, the level of the target protein produced in the cells contacted with the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 11-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 1.1-fold to about 20-fold, about 1.1-fold to about 21-fold, about 1.1-fold to about 22-fold, about 1.1-fold to about 23-fold, about 1.1-fold to about 24-fold, about 1.1-fold to about 25-fold, about 1.1-fold to about 26-fold, about 1.1-fold to about 27-fold, about 1.1-fold to about 28-fold, about 1.1-fold to about 29-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 31-fold, about 1.1-fold to about 31-fold, about 1.1-fold to about 32-fold, about 1. 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0128] In some embodiments, the exclusion of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent is reduced by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, compared to the exclusion of the ASCE during the processing of the pre-mRNA in a corresponding cell not contacted with the therapeutic agent or the vector encoding the therapeutic agent. times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0129] In some embodiments, the target protein is NSD1, and wherein the method results in modification of a histone in the cell.

[0130] In some embodiments, the histone is histone H3.

[0131] In some embodiments, the modification comprises acetylation, methylation, phosphorylation, or ubiquitination.

[0132] In some embodiments, the modification is methylation.

[0133] In some embodiments, said methylation of said histone is increased in said cell.

[0134] In some embodiments, the methylation of the histone in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 11-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 1.1-fold to about 20-fold, about 1.1-fold to about 21-fold, about 1.1-fold to about 22-fold, about 1.1-fold to about 23-fold, about 1.1-fold to about 24-fold, about 1.1-fold to about 25-fold, about 1.1-fold to about 26-fold, about 1.1-fold to about 27-fold, about 1.1-fold to about 28-fold, about 1.1-fold to about 29-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 3 .1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

[0135] In some embodiments, the target protein is a typical isoform of the protein.

[0136] In some embodiments, the alternatively processed mRNA produced by splicing out the ASCE comprises a premature termination codon (PTC).

[0137] In some embodiments, the agent is an antisense oligomer (ASO).

[0138] In some embodiments, the ASO is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the targeting portion of the mRNA.

[0139] In some embodiments, the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% complementary to at least 8 contiguous nucleic acids of a sequence selected from the group consisting of SEQ ID NOs: 6-10.

[0140] In some embodiments, the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphodiamidate linkage.

[0141] In some embodiments, the ASO comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

[0142] In some embodiments, the ASO comprises at least one modified sugar moiety.

[0143] In some embodiments, each sugar moiety is a modified sugar moiety.

[0144] In some embodiments, the ASO consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases or 12 to 15 nucleobases.

[0145] In some embodiments, the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of SEQ ID NOs: 16-1748.

[0146] In some embodiments, the target gene is NSD1, and the vector encoding the agent encodes a polynucleotide comprising a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5D, Table 5E, Table 5G, and Table 5G-1.

[0147] In some embodiments, the vector encoding the agent is a viral vector.

[0148] In some embodiments, the viral vector is an adeno-associated viral vector.

[0149] In some embodiments, the vector encoding the agent encodes a polynucleotide comprising an ASO sequence and a snRNA.

[0150] In some embodiments, the snRNA comprises a modified snRNA.

[0151] In some embodiments, the modified snRNA is a modified U1 snRNA or a modified U7 snRNA.

[0152] In some embodiments, the snRNA comprises U1 snRNA.

[0153] In some embodiments, the target gene is NSD1 and the ASO sequence comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5B, Table 5D, Table 5E, and Table 5G.

[0154] In some embodiments, the snRNA comprises U7 snRNA.

[0155] In some embodiments, the target gene is NSD1 and the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5G, and Table 5G-1.

[0156] In some aspects, provided herein is a composition comprising an ASO comprising a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of SEQ ID NOs: 16-1748.

[0157] In some embodiments, the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphodiamidate linkage.

[0158] In some embodiments, the ASO comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

[0159] In some embodiments, the ASO comprises at least one modified sugar moiety.

[0160] In some embodiments, each sugar moiety is a modified sugar moiety.

[0161] In some embodiments, the ASO consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases or 12 to 15 nucleobases.

[0162] In some aspects, provided herein is a composition comprising a vector encoding a polynucleotide comprising a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5D, Table 5E, Table 5G, and Table 5G-1.

[0163] In some embodiments, the vector encoding the agent is a viral vector.

[0164] In some embodiments, the viral vector is an adeno-associated viral vector.

[0165] In some embodiments, the vector encoding the agent encodes a polynucleotide comprising an ASO sequence and a snRNA.

[0166] In some embodiments, the snRNA comprises a modified snRNA.

[0167] In some embodiments, the modified snRNA is a modified U1 snRNA or a modified U7 snRNA.

[0168] In some embodiments, the snRNA comprises U1 snRNA.

[0169] In some embodiments, the ASO sequence comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5B, Table 5D, Table 5E, and Table 5G.

[0170] In some embodiments, the snRNA comprises U7 snRNA.

[0171] In some embodiments, the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5G, and Table 5G-1.

[0172] In some aspects, provided herein is a pharmaceutical composition comprising a composition described herein; and a pharmaceutically acceptable excipient and / or delivery vehicle.

[0173] In some aspects, provided herein is a method of treating or reducing the likelihood of developing a disease or condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition described herein.

[0174] Incorporated by Reference

[0175] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0176] The novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by referring to the following detailed description of illustrative embodiments and the accompanying drawings in which the principles of the present disclosure are utilized:

[0177] Figures 1A-1B Depicted is a schematic diagram of a target pre-mRNA containing an alternatively spliced ​​coding exon (ASCE) that can be alternatively spliced ​​to generate a non-productive mRNA that undergoes nonsense-mediated RNA decay (NMD) and therapeutic agent-mediated promotion of canonical splicing to increase expression of a functional mRNA or a full-length target protein target mRNA.

[0178] Figure 1A A cell is shown divided into a nuclear compartment and a cytoplasmic compartment. In the nucleus, the pre-mRNA transcript of the target gene undergoes splicing to generate mRNA, which is exported to the cytoplasm and translated into the target protein. For this target gene, some fractions of the pre-mRNA are alternatively spliced, resulting in the formation of processed mRNA lacking ASCE (non-productive mRNA), which undergoes NMD and degrades in the cytoplasm, thus not resulting in non-productive mRNA producing the target protein.

[0179] Figure 1B An example of the same cell compartmented into nuclear and cytoplasmic compartments is shown. Treatment with therapeutic agents such as antisense oligomers (ASOs) promotes the incorporation of ASCE into mRNA processed from pre-mRNA, leading to an increase in functional (productive) mRNA containing ASCE, which in turn is translated into higher levels of target protein.

[0180] Figure 1C Shown is the difference between two alternative splicing events of a pre-mRNA transcript, where one of the alternative splicing events results in the formation of a non-productive mRNA lacking the ASCE (bottom) and where the other alternative splicing event results in the formation of a productive mRNA containing the ASCE (top).

[0181] Figure 1D Shown is the difference between two alternative splicing events of the NSD1 pre-mRNA transcript, one of which results in a non-productive mRNA lacking the ASCE (exon 8) (bottom) and the other of which results in a productive mRNA containing the ASCE (exon 8) (top).

[0182] Figures 2A-2C Depicted are the identification of exemplary alternative splicing events of ASCE in the NSD1 gene by cycloheximide treatment in astrocytes, Schwann cells, and macaque brain cells.

[0183] Figure 2A Depicted is a schematic diagram in which peaks corresponding to RNA sequencing reads were identified in exon 8 of NSD1 (GRCh38 / hg38: chr5177238237:177238507).

[0184] Figure 2B Depicted are gel images and graphs showing that cycloheximide treatment results in increased amounts of non-productive mature NSD1 mRNA transcripts (processed NSD1 mRNA containing a premature stop codon that makes the transcript a target for NMD) in various human cells, including astrocytes, Schwann cells, HEK293 cells, SH-SY-5Y (neuroblastoma cell line) cells, and SK-N-AS (neuroblastoma cell line) cells.

[0185] Figure 2C Depicted are gel images and graphs showing the presence of non-productive mature NSD1 mRNA transcripts in various macaque brain regions including the cortex, brainstem, hippocampus, and cerebellum.

[0186] Figure 2DDepicted are gel images and graphs showing the presence of non-productive mature NSD1 mRNA transcripts in human cortex.

[0187] Figures 3A-3D Depicted are confirmation of the inclusion or exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) in NSD1 mRNA products processed from NSD1 pre-mRNA in mouse brain by cycloheximide treatment in vivo or ex vivo.

[0188] Figure 3A Depicted are images of a gel showing that in ex vivo cycloheximide-treated mouse brain, exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) results in the formation of processed mRNA containing a premature stop codon that targets the transcript for NMD.

[0189] Figure 3B Depicts from Figure 3A Gel images of non-productive NSD1 mRNA products are plotted with NMD percentage (top) and fold change (bottom) in NMD events of NSD1 productive NSD1 mRNA products.

[0190] Figure 3C Depicted are images of a gel showing that in vivo in cycloheximide-treated mouse brain, exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) results in the formation of processed mRNA containing a premature stop codon that targets the transcript for NMD.

[0191] Figure 3D Depicts from Figure 3C Gel images of non-productive NSD1 mRNA products relative to NSD1 productive NSD1 mRNA products show NMD percentage (left) and fold change (right) in NMD events.

[0192] Figures 4A-4B Depicted is the confirmation of the inclusion or exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) in NSD1 mRNA products processed from NSD1 pre-mRNA in mouse brain by in vivo cycloheximide treatment.

[0193] Figure 4A Depicted are images of a gel showing that in vivo in cycloheximide-treated mouse brain, exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) results in the formation of processed mRNA containing a premature stop codon that targets the transcript for NMD.

[0194] Figure 4B Depicts from Figure 4AGel images of non-productive NSD1 mRNA products relative to NSD1 productive NSD1 mRNA products show NMD percentage (left) and fold change (right) in NMD events.

[0195] Figure 5 An exemplary ASO walk around the region of human NSD1 exon 8 (GRCh38 / hg38: chr5177238237:177238507) is depicted. Underlined nucleotides correspond to exon skipping events, and arrows point to typical 5' or 3' splice sites.

[0196] Figures 6A-6B The total NSD1 mRNA expression in HEK293 cells is shown. Figure 6A ) and non-productive NSD1 mRNA ( Figure 6B ) levels during an ASO walk around exon 8.

[0197] Figures 7A-7B The summed productive NSD1 mRNA ( Figure 7A ) and non-productive NSD1mRNA ( Figure 7B ) levels during an ASO walk around exon 8.

[0198] Figure 8 Depicted is an exemplary ASO walk around the human NSD1 exon 8 (GRCh38 / hg38: chr5 177238237:177238507) region for the ASO vectorization approach using U7 snRNA.

[0199] Figure 9 Depicted is an exemplary ASO walk around the human NSD1 exon 8 (GRCh38 / hg38: chr5 177238237:177238507) region for an ASO vectorization approach using U1 snRNA.

[0200] Figure 10Representative histograms of non-productive NSD1 mRNA levels when different cell lines were treated with alternative NMD inhibitors are shown. SH-SY5Y, U-87MG, HEK293, and SK-N-AS cell lines were each treated with one of three conditions: a mock control (vehicle only), the NMD inhibitor cycloheximide (CHX), or the NMD inhibitor SMG1i. Treatment with SMG1i resulted in approximately 28% NSD1 non-productive mRNA (the percentage of non-productive NSD1 mRNA transcript levels in the total level of all NSD1 mRNA transcripts) in U-87MG cells, approximately 19% NSD1 non-productive mRNA levels in SH-SY5Y cells, and < approximately 18% NSD1 non-productive mRNA levels in HEK293 and SK-N-AS cells. Treatment with CHX resulted in approximately 23% NSD1 non-productive mRNA in SH-SY5Y cells, approximately 15% NSD1 non-productive mRNA in U-87MG cells, and approximately 13% NSD1 non-productive mRNA in HEK293 and SK-N-AS cells. In cells treated with vehicle alone (mock), the percentage of non-productive RNA remained low.

[0201] Figures 11A-11C Data demonstrating that exemplary ASOs with variable backbone modifications have similar effects on NSD1 pre-mRNA splicing are presented. Figure 11A is a table showing the ASO names, their backbone chemistry, sequence and length. Figure 11B is a scatter plot showing the fold change in productive and non-productive NSD1 mRNA when various ASOs with PMO or 2'MOE-PS backbone modifications were nucleofected into U-87MG cells relative to cells treated with mock control. Figure 11C is a histogram of NSD1 protein levels present in U-87MG cells after treatment with various backbone ASOs relative to cells treated with a mock control (see Figure 11A ). From Figure 11B and Figure 11C Both data were normalized to mock controls.

[0202] Figures 12A-12B Depicted are representative data demonstrating the effects of exemplary ASOs on NSD1 protein expression and H3K36me2 levels in U-87MG cells. Figure 12A is a histogram showing the fold change in NSD1 protein in U-87MG cells treated with various ASOs relative to cells treated with water alone. Figure 12Bis a histogram showing the fold change in cellular H3K36me2 levels in U-87MG cells treated with various ASOs relative to cells treated with water alone. U-87 cells were nucleofected with 1 μM of each ASO and cells were harvested 72 hours after nucleofection. NSD1 protein levels were measured by immunocapillary electrophoresis (JESS) and Measurement of H3K36me2 levels. Figures 12A-12B Data presented are the sum of 2-3 independent experiments; mean ± SEM.

[0203] Figures 13A-13C Depicted are representative data demonstrating the dose-dependent effects of exemplary ASOs on NSD1 protein expression and H3K36me2 levels in U-87MG cells. Figure 13A is a histogram showing the fold change in NSD1 protein in U-87MG cells treated with ASO 211 at various dose concentrations (0.25 μM, 0.5 μM, 1.0 μM, or 2.0 μM) relative to cells treated with water only. Figure 13B is a histogram showing the fold change in cellular H3K36me2 levels in U-87MG cells treated with ASO 211 at various dose concentrations (0.25 μM, 0.5 μM, 1.0 μM, or 2.0 μM) relative to cells treated with water only. Figure 13C 2 is a histogram showing the total histone H3 levels present in U-87 cells treated with ASO 211 at various dose concentrations compared to cells treated with water alone. U-87 cells were nucleofected with ASO 211 at four test doses (0.25 μM, 0.5 μM, 1.0 μM, or 2.0 μM) and cells were harvested 72 hours after nucleofection. NSD1 protein was measured by immunocapillary electrophoresis (JESS) and H3K36me2 levels were measured. Total cellular histone H3 levels were measured. Figures 13A-13C The data presented are the sum of 2-3 independent experiments; mean ± SEM; one-way ANOVA; *pval < 0.05, ***pval < 0.01; ****pval < 0.001. DETAILED DESCRIPTION

[0204] Certain specific details of this specification are set forth in order to provide a thorough understanding of the various embodiments. However, those skilled in the art will understand that the present disclosure can be practiced without these details. In other instances, well-known structures are not shown or described in detail to avoid unnecessary confusion in the description of the embodiments. Unless the context otherwise requires, throughout the following specification and the appended claims, the word "comprise" and its variations, such as "comprises" and "comprising", will be interpreted in an open, inclusive sense, i.e., to mean "including but not limited to". In addition, the headings provided herein are for convenience only and do not interpret the scope or meaning of the disclosure claimed.

[0205] As used in this specification and the appended claims, the singular forms "an," "an," and "the" include plural referents unless the context clearly dictates otherwise. It should also be noted that the term "or" is generally employed in its sense including "and / or" unless the context clearly dictates otherwise.

[0206] Coordinates as used herein refer to the coordinates of the genome reference assembly GRCh38 (Genome Research Consortium human build 38), also known as Hg38 (Human Genome version 38).

[0207] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

[0208] Alternative splicing events in the PKD1, ABCA4, FUS, CEL, or NSD1 genes can produce non-productive mRNA transcripts, which in turn can lead to reduced protein expression, and therapeutic agents that can target alternative splicing events in the PKD1, ABCA4, FUS, CEL, or NSD1 genes can modulate (e.g., increase) the expression level of functional protein in patients. Such therapeutic agents can be used to treat conditions caused by a deficiency in the amount or activity of polycystin-1, retinal-specific phospholipid transporting ATPase ABCA4, RNA-binding protein FUS, bile salt-activated lipase, or H3 lysine-36-specific histone-lysine N-methyltransferase.

[0209] One alternative splicing event that can produce a non-productive mRNA transcript is an alternatively spliced ​​coding exon (ASCE) event. For example, excluding an alternatively spliced ​​coding exon can produce a processed mRNA that is shorter than the corresponding processed mRNA that includes an ASCE (the shorter processed mRNA is also referred to herein as "alternatively processed mRNA"). For example, skipping of an alternatively spliced ​​coding exon can produce a processed mRNA that is shorter than the corresponding processed mRNA that includes an ASCE. For example, excluding an alternatively spliced ​​coding exon caused by reduced or inhibited splicing of the 3' splice site (e.g., a canonical 3'ss) of the ASCE and / or reduced or inhibited splicing of the 5' splice site (e.g., a canonical 5'ss) of the ASCE can produce a processed mRNA that is shorter than the corresponding processed mRNA that includes an ASCE. The present disclosure provides compositions and methods for regulating alternative splicing of PKD1, ABCA4, FUS, CEL or NSD1 pre-mRNA to increase the production of protein-encoding mature mRNA, and thereby increase the production of translated functional polycystin-1, retina-specific phospholipid transporting ATPase ABCA4, RNA-binding protein FUS, bile salt-activated lipase or H3 lysine-36 specific histone-lysine N-methyltransferase. For example, the compositions and methods provided herein can regulate the processing of PKD1, ABCA4, FUS, CEL or NSD1 pre-mRNA by promoting or increasing splicing of the 3' splice site (e.g., a canonical 3'ss) of ASCE and / or promoting or increasing splicing of the 5' splice site (e.g., a canonical 5'ss) of ASCE. For example, the compositions and methods provided herein can modulate the processing of PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA by promoting or increasing splicing of the 3' splice site of an intron located upstream of an ASCE and / or by promoting or increasing splicing of the 5' splice site of an intron located downstream of an ASCE.

[0210] These compositions and methods include antisense oligomers (ASOs) or vectors encoding ASOs that can promote constitutive splicing of PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA. For example, these compositions and methods include ASOs or vectors encoding ASOs that can promote the incorporation of ASCE into processed mRNAs processed from PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA. In various embodiments, the methods of the present disclosure can be used to increase functional polycystin-1, retina-specific phospholipid transporting ATPase ABCA4, RNA-binding protein FUS, bile salt-activated lipase, or H3 lysine-36-specific histone-lysine N-methyltransferase to treat conditions caused by a deficiency in the amount or activity of polycystin-1, retina-specific phospholipid transporting ATPase ABCA4, RNA-binding protein FUS, bile salt-activated lipase, or H3 lysine-36-specific histone-lysine N-methyltransferase.

[0211] As referred to herein, "polycystin-1" or "PC1," also known as autosomal dominant polycystic kidney disease 1 protein, can be encoded by the PKD1 gene and can be a membrane protein involved in cell-to-cell or cell-matrix interactions, the membrane protein can be a component of a heterogeneous calcium-permeable ion channel formed by polycystin-2 (encoded by the PKD2 gene), which is activated by interaction with Wnt family members (such as WNT3A and WNT9B) and regulates multiple signaling pathways to maintain normal renal tubular structure and function, including any recombinant or naturally occurring form of polycystin-1 or its variants or homologs that has or maintains polycystin-1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity across the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 contiguous amino acid portion) compared to naturally occurring polycystin- 1. In some embodiments, polycystin- 1 is substantially identical to the protein identified by UniProt reference number P98161, or a variant or homolog thereof having substantial identity.

[0212] As referred to herein, "retina-specific phospholipid transporting ATPase ABCA4", also known as ATP-binding cassette subfamily A member 4, RIM ABC transporter (RIM protein or RmP), retina-specific ATP-binding cassette transporter or Stargardt's disease protein, can be encoded by the ABCA4 gene (also known as ABCR) and can be a membrane-associated protein that is a member of the superfamily of ATP-binding cassette (ABC) transporters, which can be a retina-specific ABC transporter with N-retinylidene-PE as a substrate and can be expressed only in retinal photoreceptor cells and can mediate the transport of the essential molecule all-trans-retinal (atRAL) across the photoreceptor cell membrane, including a recombinant or naturally occurring form of the retina-specific phospholipid transporting ATPase ABCA4 or any of its variants or homologs that has or maintains retina-specific phospholipid transporting ATPase ABCA4 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the naturally occurring retina-specific phospholipid transporting ATPase ABCA4. In some embodiments, the retina-specific phospholipid transporting ATPase ABCA4 is substantially identical to the protein identified by UniProt reference number P78363, or a variant or homolog having substantial identity thereto.

[0213] As referred to herein, "RNA-binding protein FUS", also known as FUS RNA-binding protein, 75 kDa DNA-pairing protein, oncogene FUS, oncogene TLS, POMp75 or translocated in liposarcoma protein, can be encoded by the FUS gene (also known as TLS) and can be a DNA / RNA-binding protein that plays a role in various cellular processes (such as transcriptional regulation, RNA splicing, RNA transport, DNA repair and damage response), including any recombinant or naturally occurring form of RNA-binding protein FUS or its variants or homologs that have or maintain RNA-binding protein FUS activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to the naturally occurring RNA binding protein FUS. In some embodiments, the RNA binding protein FUS is substantially identical to the protein identified by UniProt reference number P35637, or a variant or homolog having substantial identity thereto.

[0214] As referred to herein, "bile salt-activated lipase," also known as carboxyester lipase, bile salt-stimulated lipase (BSSL), Bucelipase, cholesterol esterase, pancreatic lysophospholipase or sterol esterase, can be encoded by a CEL gene (also known as BAL) and can catalyze the hydrolysis of a wide range of substrates including cholesterol esters, phospholipids, lysophospholipids, di- and triglycerides, and fatty acid esters of hydroxy fatty acids (FAHFAs), including any recombinant or naturally occurring form of a bile salt-activated lipase or variants or homologs thereof that have or maintain bile salt-activated lipase activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to a naturally occurring bile salt-activated lipase. In some embodiments, the bile salt-activated lipase is substantially identical to the protein identified by UniProt reference number P19835, or a variant or homolog having substantial identity thereto.

[0215] As referred to herein, “H3 lysine-36-specific histone-lysine N-methyltransferase,” also known as androgen receptor coactivator 267 kDa protein, androgen receptor-associated protein of 267 kDa, H3-K36-HMTase, lysine N-methyltransferase 3B, nuclear receptor-binding SET domain-containing protein 1 (NR-binding SET domain-containing protein), may be encoded by the NSD1 gene (also known as ARA267 and KMT3B) and may be a histone methyltransferase that methylates Lys-36 of histone H3 (H3K 36me2) dimethylation and can be a transcriptional intermediary factor that can negatively or positively affect transcription (depending on the cellular context), including a recombinant or naturally occurring form of an H3 lysine-36-specific histone-lysine N-methyltransferase or any variant or homolog thereof that has or maintains H3 lysine-36-specific histone-lysine N-methyltransferase activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity). In some aspects, the variant or homolog has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to a naturally occurring H3 lysine-36-specific histone-lysine N-methyltransferase. In some embodiments, the H3 lysine-36-specific histone-lysine N-methyltransferase is substantially identical to the protein identified by UniProt reference number Q96L73, or a variant or homolog having substantial identity thereto.

[0216] The terms "alternatively spliced ​​coding exon" or "ASCE" are used interchangeably and may refer to a coding exon (e.g., a canonical exon) that, if present in a mature RNA transcript, can prevent activation of the nonsense-mediated mRNA decay (NMD) pathway, or, if absent in a mature RNA transcript, promotes activation of the NMD pathway. In constitutive splicing events, ASCEs are typically not spliced ​​out, but ASCEs can be excluded during alternative or aberrant splicing events. Mature mRNA transcripts lacking an ASCE can be non-productive, for example, due to frame shifts that induce the NMD pathway. In some embodiments, an ASCE is an exon that is skipped. In some embodiments, an ASCE is an exon that results in a reading frame change when the ASCE is not included in a mature or processed mRNA. In some embodiments, an ASCE is an exon that contains a number of nucleotides that is not divisible by 3. In some embodiments, the mature or processed mRNA from which the ASCE has been excluded contains a premature stop codon (or premature termination codon (PTC)) or other sequence that promotes degradation of the mature RNA transcript from which the ASCE has been excluded. Exclusion of the ASCE from the mature or processed RNA transcript can downregulate gene expression. In some embodiments, the mature or processed mRNA from which the ASCE has been excluded is generated from an alternative splicing event. For example, the mature or processed mRNA from which the ASCE has been excluded can be generated from an alternative 3' splice site event. For example, the mature or processed mRNA from which the ASCE has been excluded can be generated from an alternative 5' splice site event. For example, the mature or processed mRNA from which the ASCE has been excluded can be generated from an alternative 5' splice site event and an alternative 3' splice site event. For example, the mature or processed mRNA from which the ASCE has been excluded can be generated from an exon skipping event. For example, the ASCE can be a canonical exon. For example, only exons that are divisible by 3 can be skipped or included in the mRNA without arbitrarily altering the reading frame.

[0217] Alternative splicing can result in the exclusion of at least one ASCE in the mature mRNA transcript. The terms "mature mRNA" and "fully spliced ​​mRNA" are used interchangeably herein to describe fully processed mRNA. Mature mRNA lacking an ASCE can be non-productive and lead to NMD of the mature mRNA. Mature mRNA lacking an ASCE can sometimes result in reduced protein expression compared to protein expression from the corresponding mature mRNA containing an ASCE.

[0218] Pseudo-splice sites have the same splice recognition sequence as the real splice sites, but are not used for the splicing reaction. The pseudo-splice sites are an order of magnitude more numerous than the real splice sites in the human genome and are generally blocked by molecular mechanisms that are not well understood so far. Cryptic 5' splice sites have a consensus NNN / GUNNNN or NNN / GCNNNN, where N is any nucleotide and / is an exon-intron boundary. Cryptic 3' splice sites have a consensus NAG / N. The activation of the splice site is actively influenced by the surrounding nucleotides, which makes the splice site more similar to the best consensus of the real splice site, namely MAG / GURAGU and YAG / G, respectively, where M is C or A, R is G or A, and Y is C or U.

[0219] Splice sites and their regulatory sequences can be readily identified by a skilled person using suitable publicly available algorithms, as exemplified in, for example, Kralovicova, J. and Vorechovsky, I. (2007) Global control of aberrant splice site activation by auxiliary splicing sequences: evidence for a gradient in exon and intron definition. Nucleic Acids Res., 35, 6399-6413,

[0220] (ncbi.nlm.nih.gov / pmc / articles / PMC2095810 / pdf / gkm680.pdf).

[0221] Splicing and nonsense-mediated mRNA decay

[0222] Intervening sequences, or introns, are removed by a large and highly dynamic RNA-protein complex called the spliceosome, which coordinates a complex interplay between the primary transcript, small nuclear RNAs (snRNAs), and a large number of proteins. The spliceosome is temporarily assembled at each intron in an orderly manner, beginning at either the 5' splice site (5'ss) recognized by the U1 snRNA or the 3' splice site (3'ss) recognized by the U2 pathway. This involves the binding of the U2 auxiliary factor (U2AF) to the 3'ss region to promote the binding of U2 to the branch point sequence (BPS). U2AF is a stable heterodimer composed of a 65-kD subunit (U2AF65) encoded by U2AF2 that binds to the polypyrimidine tract (PPT) and a 35-kD subunit (U2AF35) encoded by U2AF1 that interacts with the highly conserved AG dinucleotide at the 3'ss and stabilizes the binding of U2AF65. In addition to the BPS / PPT unit and 3'ss / 5'ss, accurate splicing requires auxiliary sequences or structures that activate or inhibit splice site recognition, known as intronic or exonic splicing enhancers or silencers. These elements allow recognition of authentic splice sites among a large excess of cryptic or pseudo-sites in the genomes of higher eukaryotes, which have identical sequences but are an order of magnitude more numerous than authentic sites. Although these cryptic or pseudo-sites often have regulatory functions, the precise mechanisms of their activation or repression are poorly understood.

[0223] The decision to splice can often be modeled as a stochastic rather than deterministic process, such that even the most limited splicing signals may sometimes result in incorrect splicing. However, under normal conditions, pre-mRNA splicing occurs with surprisingly high fidelity. This is due in part to the activity of adjacent cis-acting auxiliary exon and intron splicing regulatory elements (ESRs or ISRs). Typically, these functional elements are classified as exon or intron splicing enhancers (ESEs or ISEs) or silencers (ESSs or ISSs) based on their ability to stimulate or inhibit splicing, respectively. Although there is now evidence that some auxiliary cis-acting elements can act by influencing the dynamics of spliceosome assembly, such as the arrangement of the complex between the U1 snRNP and the 5'ss, it seems likely that many elements act in concert with trans-acting RNA-binding proteins (RBPs). For example, the serine- and arginine-rich RBP family (SR proteins) is a conserved protein family that plays a key role in defining exons. SR proteins promote exon recognition by recruiting components of the spliced ​​precursor to adjacent splice sites or by antagonizing the effects of nearby ESSs. The repressive effects of ESSs can be mediated by members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family and can alter the recruitment of core splicing factors to adjacent splice sites. In addition to their role in splicing regulation, silencer elements are also thought to play a role in the repression of pseudoexons, pseudointronic splice sites that have typical exon spacing but lack functional open reading frames. Together, ESEs and ESSs, along with their cognate trans-acting RBPs, represent important components of a set of splicing controls that dictate how, where, and when mRNAs are assembled from their precursors.

[0224] The sequence that marks exon-intron boundary is the degenerate signal of different intensity that can occur at high frequency in human gene.In multi-exon gene, different splice sites can be linked together to many different combinations, thereby produce different transcript arrays from single gene.This is commonly referred to as variable pre-mRNA splicing.Although most of mRNA isoforms produced by alternative splicing can be exported from nucleus and translated into functional polypeptide, the translation efficiency from the different mRNA isoforms of single gene may vary greatly.Those mRNA isoforms with premature termination codon (premature termination codon, PTC) or premature termination codon (premature stopcodon) at least 50bp place upstream of exon junction complex may be targeted for mRNA decay (NMD) pathway degradation by nonsense mediation. Mutations in conventional (BPS / PPT / 3'ss / 5'ss) and auxiliary splicing motifs can lead to aberrant splicing, such as exon skipping or cryptic (or pseudo) exon inclusion or splice site activation, and contribute significantly to human morbidity and mortality. Both aberrant and alternative splicing patterns can be influenced by natural DNA variants in exons and introns.

[0225] Given that exon-intron boundaries can occur at any of the three positions of a codon, it is clear that only a subset of alternative splicing events can maintain a typical open reading frame. For example, only exons that are divisible by 3 can be skipped or included in an mRNA without arbitrarily changing the reading frame. Splicing events that do not have compatible phases will cause frame shifts. Unless reversed by downstream events, frame shifts may undoubtedly produce one or more PTCs, which may subsequently be degraded by NMD. NMD is a translation-coupled mechanism that eliminates mRNAs containing PTCs. NMD can serve as a surveillance pathway present in all eukaryotes. NMD can reduce errors in gene expression by eliminating mRNA transcripts containing premature stop codons or PTCs. In some cases, the translation of these abnormal mRNAs may result in harmful gain-of-function or dominant-negative activity in the resulting protein. NMD not only targets transcripts with PTCs, but also targets a wide range of mRNA isoforms expressed from many endogenous genes, indicating that NMD is a master regulator that drives both fine and coarse regulation of steady-state RNA levels in cells.

[0226] In some cases, the therapeutic agent comprises a modified snRNA, such as a modified human or murine snRNA. In some cases, the therapeutic agent comprises a vector encoding the modified snRNA, such as a viral vector. In some embodiments, the modified snRNA is a modified U1 snRNA (see, e.g., Alanis et al., Human Molecular Genetics, 2012, Vol. 21, No. 11, 2389-2398). In some embodiments, the modified snRNA is a modified U7 snRNA (see, e.g., Gadgil et al., J Gene Med. 2021; 23: e3321). The modified U7 snRNA can be prepared by any method known in the art, including the methods described in Meyer, K.; Schümperli, Daniel (2012), Antisense Derivatives of U7 Small Nuclear RNA as Modulators of Pre-mRNA Splicing. In: Stamm, Stefan; Smith, Christopher WJ; Lührmann, Reinhard (eds.) Alternative pre-mRNA Splicing: Theory and Protocols (pp. 481-494), Chichester: John Wiley & Sons 10.1002 / 9783527636778.ch45, which is incorporated herein by reference in its entirety. In some embodiments, modified U7 (smOPT) does not compete with WT U7 (Stefanovic et al., 1995).

[0227] In some embodiments, the modified snRNA comprises a smOPT modification. For example, the modified snRNA may comprise the sequence AAUUUUUGGAG. For example, the sequence AAUUUUUGGAG may replace the sequence AAUUUGUCUAG in the wild-type U7 snRNA to generate a modified U7 snRNA (smOPT). In some embodiments, the smOPT modification of U7 snRNA functionally inactivates the particle in histone pre-mRNA processing (Stefanovic et al., 1995). In some embodiments, the modified U7 (smOPT) is stably expressed in the nucleus and at higher levels than WT U7 (Stefanovic et al., 1995). In some embodiments, the snRNA comprises a U1 snRNP targeting sequence. In some embodiments, the snRNA comprises a U7 snRNP targeting sequence. In some embodiments, the snRNA comprises a modified U7 snRNP targeting sequence, and wherein the modified U7 snRNP targeting sequence comprises smOPT. In some embodiments, the modified snRNA has been modified to comprise a single-stranded nucleotide sequence that hybridizes to a pre-mRNA, such as an ASCE-containing pre-mRNA. For example, the modified snRNA can be modified to comprise a single-stranded nucleotide sequence that hybridizes to a PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA. In some embodiments, the modified snRNA is designed according to the format described in Table 5C or Table 5F. In some cases, the modified snRNA comprising a U7 snRNP targeting sequence is designed according to the format described in Table 5C. In some cases, the modified snRNA comprising a U1 snRNP targeting sequence is designed according to the format described in Table 5F. In some embodiments, the U7 snRNP targeting sequence comprises a single-stranded nucleotide sequence that hybridizes to a PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA, wherein the single-stranded nucleotide sequence begins with the dinucleotide AA, such as the sequences in Tables 5A-1, 5B-1, and 5G-1. In some of these embodiments, when designing a single-stranded nucleotide sequence complementary to a target sequence in a target pre-mRNA (e.g., PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA), if the sequence complementary to the target sequence begins with a nucleotide other than the dinucleotide AA at the 5' end, the dinucleotide AA will be added to its 5' end; if the sequence complementary to the target sequence begins with an A nucleotide at the 5' end, followed by a non-A nucleotide, an A will be added to its 5' end. In some other cases, if the sequence complementary to the target sequence begins with the dinucleotide AA at the 5' end, no additional A nucleotide is added.

[0228] In some embodiments, the modified snRNA is modified to comprise a single-stranded nucleotide sequence that hybridizes to a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE. In some embodiments, the modified snRNA is modified to comprise a single-stranded nucleotide sequence that comprises one or more sequences of an ASO disclosed herein. In some embodiments, the modified snRNA is modified to comprise a single-stranded nucleotide sequence that hybridizes to a sequence of a pre-mRNA containing a mutation (e.g., a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE containing a mutation). In some embodiments, the modified snRNA is modified to comprise a single-stranded nucleotide sequence that comprises two or more sequences that hybridize to two or more target regions of a pre-mRNA containing an ASCE (e.g., a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE). For example, the modified snRNA can be modified to comprise a single-stranded nucleotide sequence that hybridizes to at least 8 consecutive nucleic acids of an ASCE-containing pre-mRNA (e.g., a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE). In some embodiments, the modified snRNA has been modified to comprise a single-stranded nucleotide sequence that hybridizes to any of the target regions of an ASCE-containing pre-mRNA (e.g., a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE) disclosed herein. In some embodiments, the modified snRNA has been modified to comprise a single-stranded nucleotide sequence comprising two or more sequences that hybridize to two or more target regions of an ASCE-containing pre-mRNA (e.g., a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE). For example, the modified snRNA may be modified to include a single-stranded nucleotide sequence that hybridizes with one or two or more sequences of an intron located upstream of an ASCE, an intron located downstream of an ASCE, an exon located upstream of an ASCE, an exon located downstream of an ASCE, or an exon located within an ASCE of a pre-mRNA containing an ASCE (e.g., a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE), or hybridizes with an ASCE skipping regulatory sequence in a pre-mRNA containing an ASCE. For example, the modified snRNA may be modified to include a single-stranded nucleotide sequence that hybridizes with one or two or more sequences of an intron located upstream of an ASCE. For example, the modified snRNA may be modified to include a single-stranded nucleotide sequence that hybridizes with one or two or more sequences of an intron located downstream of an ASCE. For example, the modified snRNA may be modified to include a single-stranded nucleotide sequence that hybridizes with one or two or more sequences of an exon located upstream of an ASCE.For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes to one or two or more sequences located in an exon downstream of the ASCE. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that hybridizes to one or two or more sequences located within the ASCE. For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is aligned with an intron located upstream of an ASCE, an intron located downstream of an ASCE, an exon located upstream of an ASCE, an exon located downstream of an ASCE, or an exon located within an ASCE of a pre-mRNA containing an ASCE of PKD1, ABCA4, FUS, CEL, or NSD1 (e.g., exon 38 of PKD1 (e.g., exon of PKD1 (GRCh38 / hg38: chr16 2092954 2093093)), e.g., exon 3 of ABCA4 (e.g., exon of ABCA4 (GRCh38 / hg38: chr1 94111438 94111579)), e.g., exon 7 of FUS (e.g., exon of FUS (GRCh38 / hg38: chr16 2092954 2093093)). 3118680231186836)), for example, exon 5 of CEL (for example, exon of CEL (GRCh38 / hg38: chr9 133066530 133066660)), for example, exon 8 of NSD1 (for example, exon of NSD1 (GRCh38 / hg38: chr5 177238237 177238507))). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is located within or at an ASCE (e.g., exon 38 of PKD1 (e.g., exon PKD1 (GRCh38 / hg38: chr16 20929542093093)), for example, exon 3 of ABCA4 (e.g., exon ABCA4 (GRCh38 / hg38: chr19411143894111579)), for example, exon 7 of FUS (e.g., exon FUS (GRCh38 / hg38: chr1631186802 31186836)), for example, exon 5 of CEL (e.g., exon CEL (GRCh38 / hg38: chr9133066530 133066660)), for example, a region upstream or downstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5177238237 177238507))).In some embodiments, the modified snRNA has a 5' region modified to comprise a single-stranded nucleotide sequence that hybridizes to a pre-mRNA containing an ASCE (e.g., a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE). In some embodiments, the modified snRNA has a 3' region modified to comprise a single-stranded nucleotide sequence that hybridizes to a pre-mRNA containing an ASCE (e.g., a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE).

[0229] For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is not aligned with an ASCE and is located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon PKD1 (GRCh38 / hg38: chr162092954 2093093)), for example, exon 3 of ABCA4 (e.g., exon ABCA4 (GRCh38 / hg38: chr19411143894111579)), for example, exon 7 of FUS (e.g., exon FUS (GRCh38 / hg38: chr1631186802 31186836)), for example, exon 5 of CEL (e.g., exon CEL (GRCh38 / hg38: chr9133066530 133066660)), for example, hybridizes to a region overlapping an intron upstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5177238237 177238507))). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that does not interact with and is located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon PKD1 (GRCh38 / hg38: chr16 2092954 2093093)), for example, exon 3 of ABCA4 (e.g., exon ABCA4 (GRCh38 / hg38: chr194111438 94111579)), for example, exon 7 of FUS (e.g., exon FUS (GRCh38 / hg38: chr16 31186802 31186836)), for example, exon 5 of CEL (e.g., exon CEL (GRCh38 / hg38: chr9 133066530 133066660)), for example, hybridizes to a region overlapping an intron downstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5 177238237177238507))).

[0230] For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon of PKD1 (GRCh38 / hg38: chr16 20929542093093)), for example, exon 3 of ABCA4 (e.g., exon of ABCA4 (GRCh38 / hg38: chr1 9411143894111579)), for example, exon 7 of FUS (e.g., exon of FUS (GRCh38 / hg38: chr163118680231186836)), for example, exon 5 of CEL (e.g., exon of CEL (GRCh38 / hg38: chr9133066530 133066660)), for example, an exon sequence or an intron sequence downstream of exon 8 of NSD1 (for example, exon 8 of NSD1 (GRCh38 / hg38: chr5177238237 177238507))). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that does not overlap with a sequence located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon of PKD1 (GRCh38 / hg38: chr16 2092954 2093093)), for example, exon 3 of ABCA4 (e.g., exon of ABCA4 (GRCh38 / hg38: chr1 94111438 94111579)), for example, exon 7 of FUS (e.g., exon of FUS (GRCh38 / hg38: chr16 3118680231186836)), for example, exon 5 of CEL (e.g., exon of CEL (GRCh38 / hg38: chr9 133066530 133066660)), for example, the 3' splice site of the intron sequence downstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5 177238237 177238507))).For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that does not interact with a region located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon of PKD1 (GRCh38 / hg38: chr16 20929542093093)), e.g., exon 3 of ABCA4 (e.g., exon of ABCA4 (GRCh38 / hg38: chr1 9411143894111579)), e.g., exon 7 of FUS (e.g., exon of FUS (GRCh38 / hg38: chr163118680231186836)), e.g., exon 5 of CEL (e.g., exon of CEL (GRCh38 / hg38: chr9133066530 133066660)), for example, the 5' splice site of the intron sequence downstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5177238237 177238507))).

[0231] For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that is located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon of PKD1 (GRCh38 / hg38: chr16 20929542093093)), for example, exon 3 of ABCA4 (e.g., exon of ABCA4 (GRCh38 / hg38: chr1 9411143894111579)), for example, exon 7 of FUS (e.g., exon of FUS (GRCh38 / hg38: chr163118680231186836)), for example, exon 5 of CEL (e.g., exon of CEL (GRCh38 / hg38: chr9133066530 133066660)), for example, an intronic sequence upstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5177238237 177238507))). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that does not overlap with a sequence located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon of PKD1 (GRCh38 / hg38: chr16 2092954 2093093)), for example, exon 3 of ABCA4 (e.g., exon of ABCA4 (GRCh38 / hg38: chr1 94111438 94111579)), for example, exon 7 of FUS (e.g., exon of FUS (GRCh38 / hg38: chr16 31186802 31186836)), for example, exon 5 of CEL (e.g., exon of CEL (GRCh38 / hg38: chr9 133066530133066660)), for example, the splice site of the intron sequence upstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5 177238237 177238507))).For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that does not overlap with a sequence located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon of PKD1 (GRCh38 / hg38: chr16 2092954 2093093)), for example, exon 3 of ABCA4 (e.g., exon of ABCA4 (GRCh38 / hg38: chr1 94111438 94111579)), for example, exon 7 of FUS (e.g., exon of FUS (GRCh38 / hg38: chr16 31186802 31186836)), for example, exon 5 of CEL (e.g., exon of CEL (GRCh38 / hg38: chr9 133066530133066660)), for example, the 3' splice site of the intron sequence upstream of exon 8 of NSD1 (for example, exon 1 of NSD1 (GRCh38 / hg38: chr5 177238237 177238507))). For example, the modified snRNA can be modified to include a single-stranded nucleotide sequence that does not interact with a sequence located at an ASCE (e.g., exon 38 of PKD1 (e.g., exon PKD1 (GRCh38 / hg38: chr16 2092954 2093093)), for example, exon 3 of ABCA4 (e.g., exon ABCA4 (GRCh38 / hg38: chr1 94111438 94111579)), for example, exon 7 of FUS (e.g., exon 8 of FUS (GRCh38 / hg38: chr1631186802 31186836)), for example, exon 5 of CEL (for example, exon of CEL (GRCh38 / hg38: chr9133066530133066660)), for example, exon 8 of NSD1 (for example, exon of NSD1 (GRCh38 / hg38: chr5177238237 177238507))).

[0232] Methods for identifying additional ASOs that promote splicing at a canonical 3' splice site and / or promote splicing at a canonical 5' splice site

[0233] Also within the scope of the present disclosure are methods for identifying or determining a therapeutic agent (e.g., an ASO) that promotes splicing at the canonical 3' splice site of an ASCE, promotes splicing at the canonical 3' splice site of an intron located upstream of an ASCE, promotes splicing at the canonical 5' splice site of an ASCE, and / or promotes splicing at the canonical 5' splice site of an intron located downstream of an ASCE of a pre-mRNA containing an ASCE (e.g., a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE). For example, a method can comprise identifying or determining an ASO that inhibits or reduces ASCE skipping of a pre-mRNA containing an ASCE (e.g., a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE). ASOs that specifically hybridize to different nucleotides within a target region of a pre-mRNA can be screened to identify or determine ASOs that improve the rate and / or extent of splicing at the canonical 3' splice site of the ASCE, the canonical 3' splice site of an intron upstream of the ASCE, the canonical 5' splice site of the ASCE, and / or the canonical 5' splice site of an intron downstream of the ASCE, and / or reduce the rate and / or extent of splicing at the alternative 3' splice site and / or alternative 5' splice site of the ASCE. In some embodiments, the ASO can block or interfere with the binding site of a splicing repressor / silencer. Any method known in the art can be used to identify (determine) ASOs that produce a desired effect (e.g., promoting splicing at the canonical 3' splice site of the ASCE, promoting splicing at the canonical 3' splice site of an intron upstream of the ASCE, promoting splicing at the canonical 5' splice site of the ASCE, promoting splicing at the canonical 5' splice site of an intron downstream of the ASCE, protein production, or functional RNA production) when hybridized to the target region. These methods can also be used to identify ASOs that promote or increase incorporation of the ASCE by binding to target regions flanking or within the ASCE. Examples of methods that can be used are provided below.

[0234] ASOs that have been designed to hybridize to a target region of a pre-mRNA can be used to perform a round of screening known as ASO "walking". For example, the ASOs used in the ASO walk can be tiled every 5 nucleotides from approximately 100 nucleotides upstream of the 3' or 5' splice site of the ASCE to approximately 100 nucleotides downstream of the 3' or 5' splice site of the ASCE. For example, the ASOs used in the ASO walk can be tiled every 5 nucleotides from approximately 100 nucleotides upstream of the 5' splice site of the intron following the ASCE to approximately 100 nucleotides downstream of the 3' splice site of the intron following the ASCE. For example, the ASOs used in the ASO walk can be tiled every 5 nucleotides from approximately 100 nucleotides upstream of the 3' splice site of the intron preceding the ASCE to approximately 100 nucleotides downstream of the 5' splice site of the intron preceding the ASCE. For example, the ASOs used in ASO walking can be tiled every 5 nucleotides from about 100 nucleotides upstream of the 5' splice site of the intron following the ASCE to about 100 nucleotides downstream of the 5' splice site of the intron following the ASCE. For example, the ASOs used in ASO walking can be tiled every 5 nucleotides from about 100 nucleotides upstream of the 3' splice site of the intron following the ASCE to about 100 nucleotides downstream of the 3' splice site of the intron following the ASCE. For example, the ASOs used in ASO walking can be tiled every 5 nucleotides from about 100 nucleotides upstream of the 3' splice site of the intron preceding the ASCE to about 100 nucleotides downstream of the 3' splice site of the intron preceding the ASCE. For example, the ASOs used in ASO walking can be tiled every 5 nucleotides from about 100 nucleotides upstream of the 5' splice site of the intron preceding the ASCE to about 100 nucleotides downstream of the 5' splice site of the intron preceding the ASCE. For example, the ASOs used in ASO walking can be tiled every 5 nucleotides from approximately 100 nucleotides upstream of the 3' or 5' splice site of the ASCE to approximately 100 nucleotides downstream of the 3' or 5' splice site of the ASCE. For example, a first ASO of 15 nucleotides in length can be designed to specifically hybridize to nucleotides +6 to +20 relative to the 3' splice site of the intron preceding the ASCE. A second ASO can be designed to specifically hybridize to nucleotides +11 to +25 relative to the 3' splice site of the intron preceding the ASCE. The ASOs are designed to span the target region of the pre-mRNA. In embodiments, the ASOs can be tiled more closely, for example, every 1, 7, 8, or 9 nucleotides. In addition, the ASOs can be tiled from 100 nucleotides downstream of the 5' splice site to 100 nucleotides upstream of the 3' splice site. In some embodiments, the ASOs can be tiled from approximately 500 nucleotides upstream of the 3' splice site to approximately 500 nucleotides downstream of the 5' splice site.In some embodiments, the ASO can be tiled from about 500 nucleotides upstream of the 3' splice site to about 500 nucleotides downstream of the 3' splice site.

[0235] One or more ASOs or control ASOs (ASOs having a scrambled sequence, i.e., an ASO with a sequence that is not expected to hybridize with the target region) can be delivered, for example, by transfection, to a disease-associated cell line expressing a target precursor mRNA (e.g., a precursor mRNA containing an ASCE as described herein). The exon skipping inhibition or ASCE inclusion promotion effect of each of the ASOs can be assessed by any method known in the art, such as by reverse transcriptase (RT)-PCR using primers that span the splice junction. An increase or presence of a longer RT-PCR product produced using primers that span the region containing the ASCE (e.g., including exons flanking the ASCE) in the ASO-treated cells compared to the control ASO-treated cells indicates that splicing of the target ASCE has been inhibited. In some embodiments, the ASOs described herein can be used to improve exon skipping inhibition efficiency, the ratio of unspliced ​​to spliced ​​precursor mRNA, a reduction in splicing rate, or a reduction in the extent of splicing. The amount of protein or functional RNA encoded by the target precursor mRNA can also be assessed to determine whether each ASO achieves the desired effect (e.g., enhanced functional protein production). Any method known in the art for assessing and / or quantifying protein production can be used, such as Western blotting, flow cytometry, immunofluorescence microscopy, and ELISA.

[0236] A second round of screening, called ASO "microwalking," can be performed using ASOs that have been designed to hybridize to a target region of the pre-mRNA. The ASOs used in ASO microwalking are tiled at 1 nucleotide intervals to further refine the nucleotide sequence of the pre-mRNA that, when hybridized to the ASO, results in enhanced incorporation of the ASCE into the mature RNA transcript and / or inhibition or reduction of ASCE skipping from pre-mRNA transcripts containing the ASCE.

[0237] The region defined by ASOs that promote incorporation of ASCEs into mature RNA transcripts was explored in more detail by means of ASO "microwalking" involving ASOs spaced in 1-nt steps, as well as longer ASOs of typically 18-25 nt.

[0238] As described above for ASO walking, ASO microwalking is performed by delivering one or more ASOs or control ASOs (ASOs with scrambled sequences, i.e., sequences that are not expected to hybridize with the target region), for example, by transfection, into a disease-associated cell line expressing the target precursor mRNA. As described herein, the splicing-inducing effect of each of the ASOs can be assessed by any method known in the art, such as by reverse transcriptase (RT)-PCR using primers that span the ASCE. An increase or presence of longer RT-PCR products generated using primers that span a region containing an ASCE (e.g., including exons flanking the ASCE) in ASO-treated cells compared to control ASO-treated cells indicates that splicing of the target ASCE has been inhibited. In some embodiments, the ASOs described herein can be used to improve exon skipping inhibition efficiency, the ratio of unspliced ​​to spliced ​​precursor mRNA, a reduction in splicing rate, or a reduction in the extent of splicing. The amount of protein or functional RNA encoded by the target precursor mRNA can also be assessed to determine whether each ASO achieves the desired effect (e.g., enhanced functional protein production). Any method known in the art for assessing and / or quantifying protein production can be used, such as Western blotting, flow cytometry, immunofluorescence microscopy, and ELISA.

[0239] ASOs that, when hybridized to a region of the pre-mRNA, cause the ASCE to be incorporated into the mature RNA transcript and / or inhibit or reduce the ASCE from the pre-mRNA transcript containing the ASCE and increase protein production can be tested in vivo using animal models (e.g., transgenic mouse models in which the full-length human gene has been knocked in, or in humanized mouse disease models). Suitable routes for administering the ASO can vary depending on the disease and / or cell type to which the ASO is to be delivered. The ASO can be administered, for example, by intrathecal, intracerebroventricular, intraperitoneal, intramuscular, subcutaneous, or intravenous injection. After administration, the cells, tissues, and / or organs of the model animal can be evaluated to determine the effect of the ASO treatment, for example, by evaluating splicing (e.g., efficiency, rate, extent) and protein production by methods known in the art and described herein. The animal model can also be any phenotypic or behavioral indicator of the disease or disease severity.

[0240] Also within the scope of the present disclosure is a method of identifying or validating ASCE in the presence of an NMD inhibitor, such as cycloheximide. An exemplary method is provided in Example 2.

[0241] Exemplary genes encoding ASCE-containing pre-mRNAs and ASCE sequences are summarized in Tables 1 and 2 (SEQ ID NO indicates the corresponding nucleotide sequence represented by the Gene ID number (NCBI Entrez Gene Number)). Sequences of exemplary target sequences in pre-mRNA transcripts are shown in Table 3. Exemplary ASO sequences are shown in Table 4.

[0242] Table 1: List of exemplary target genes encoding ASCE-containing pre-mRNAs

[0243]

[0244] Table 2: List of exemplary genes and ASCE sequences

[0245]

[0246]

[0247] Table 3: Sequences of exemplary target sequences in human pre-mRNA transcripts.

[0248]

[0249] Table 4: Exemplary ASO sequences

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258] Table 5A: Exemplary ASO sequences

[0259]

[0260]

[0261]

[0262]

[0263] Table 5A-1: Exemplary ASO sequences

[0264]

[0265]

[0266]

[0267] Table 5B: Exemplary ASO sequences

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286] Table 5B-1: Exemplary ASO sequences

[0287]

[0288]

[0289]

[0290]

[0291]

[0292]

[0293]

[0294]

[0295]

[0296]

[0297]

[0298]

[0299] Table 5C: Exemplary U7 vector sequences

[0300]

[0301]

[0302] Table 5D: Exemplary ASO sequences

[0303]

[0304]

[0305]

[0306]

[0307] Table 5E: Exemplary ASO sequences

[0308]

[0309]

[0310]

[0311]

[0312]

[0313]

[0314]

[0315]

[0316]

[0317]

[0318]

[0319]

[0320]

[0321]

[0322]

[0323] Table 5F: Exemplary U1 vector sequences

[0324]

[0325]

[0326] Table 5G: Exemplary ASO sequences

[0327]

[0328]

[0329]

[0330]

[0331] Table 5G-1: Exemplary ASO sequences

[0332]

[0333]

[0334]

[0335]

[0336] Alternative splicing events in the PKD1, ABCA4, FUS, CEL, or NSD1 genes can generate non-productive mRNA transcripts, which in turn can lead to abnormal protein expression, and therapeutic agents that can target alternative splicing events in the PKD1, ABCA4, FUS, CEL, or NSD1 genes can modulate the expression level of functional proteins and / or inhibit abnormal protein expression in DS patients. Such therapeutic agents can be used to treat conditions caused by deficiency of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 proteins.

[0337] One of the alternative splicing events that can produce non-productive mRNA transcripts is the inclusion of additional exons in the mRNA transcript that can induce nonsense-mediated mRNA decay. The present disclosure provides compositions and methods for regulating alternative splicing of PKD1, ABCA4, FUS, CEL, or NSD1 to increase the production of protein-encoding mature mRNA and, thereby, increase the production of translated functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain protein 1 protein. These compositions and methods include antisense oligomers (ASOs) that can cause exon skipping, e.g., pseudoexon skipping, and promote constitutive splicing of PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA. In various embodiments, the methods of the present disclosure can be used to increase functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein to treat conditions caused by a deficiency of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein.

[0338] target transcripts

[0339] In some embodiments, the methods of the present disclosure utilize the presence of ASCE in pre-mRNA transcribed from the PKD1, ABCA4, FUS, CEL, or NSD1 genes. Therapeutic agents (e.g., ASOs that stimulate exon skipping of ASCE) can be used to induce splicing of identified PKD1, ABCA4, FUS, CEL, or NSD1 ASCE pre-mRNA species to produce functional mature PKD1, ABCA4, FUS, CEL, or NSD1 mRNA. Induction of exon skipping can result in inhibition of the NMD pathway. The resulting mature PKD1, ABCA4, FUS, CEL or NSD1 mRNA can be translated normally without activating the NMD pathway, thereby increasing the amount of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase or nuclear receptor-binding SET domain protein 1 protein in the patient's cells and alleviating symptoms of conditions or diseases associated with polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase or nuclear receptor-binding SET domain protein 1 deficiency, such as polycystic kidney disease 1 with or without polycystic liver disease; autosomal dominant polycystic kidney disease; age-related macular degeneration-2; Stargardt disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young type 8 with exocrine dysfunction; maturity-onset diabetes of the young; Sotos syndrome 1; or Beckwith-Wiedemann syndrome.

[0340] In various embodiments, the present disclosure provides a therapeutic agent that can target PKD1, ABCA4, FUS, CEL, or NSD1 mRNA transcripts to modulate splicing or protein expression levels. The therapeutic agent can be a small molecule, a polynucleotide, or a polypeptide. In some embodiments, the therapeutic agent is an ASO. Various regions or sequences on the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA can be targeted by therapeutic agents such as ASOs. In some embodiments, the ASO targets a PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript containing an ASCE. In some embodiments, the ASO targets a sequence within the ASCE of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that is upstream (or 5') of the 5' end of the ASCE (3'ss) of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that is downstream (or 3') of the 3' end of the ASCE (5'ss) of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that is located within an intron that flanks the 5' end of the ASCE of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that is located within an intron that flanks the 3' end of the ASCE of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that comprises the ASCE-intron boundary of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. The ASCE-intron boundary can refer to the junction of an intron sequence and an ASCE region. The intron sequence can flank the 5' end of the ASCE or the 3' end of the ASCE. In some embodiments, the ASO targets a sequence within an exon of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. In some embodiments, the ASO targets a sequence within an intron of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript. In some embodiments, the ASO targets a sequence that comprises both a portion of an intron and a portion of an exon of the PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript.

[0341] In some embodiments, the ASO targets a sequence that is about 4 to about 300 nucleotides upstream (or 5') of the 5' end of the ASCE. In some embodiments, the ASO targets a sequence that is about 1 to about 20 nucleotides, about 20 to about 50 nucleotides, about 50 to about 100 nucleotides, about 100 to about 150 nucleotides, about 150 to about 200 nucleotides, about 200 to about 250 nucleotides, or about 250 to about 300 nucleotides upstream (or 5') of the 5' end of the ASCE region. In some embodiments, the ASO may target a sequence that is more than 300 nucleotides upstream of the 5' end of the ASCE. In some embodiments, the ASO targets a sequence that is about 4 to about 300 nucleotides downstream (or 3') of the 3' end of the ASCE. In some embodiments, the ASO targets a sequence that is about 1 to about 20 nucleotides, about 20 to about 50 nucleotides, about 50 to about 100 nucleotides, about 100 to about 150 nucleotides, about 150 to about 200 nucleotides, about 200 to about 250 nucleotides, or about 250 to about 300 nucleotides downstream of the 3' end of the ASCE. In some embodiments, the ASO targets a sequence that is more than 300 nucleotides downstream of the 3' end of the ASCE.

[0342] In some embodiments, the pre-mRNA transcript containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-5. In some embodiments, the pre-mRNA transcript containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE comprises a sequence having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 6-10.

[0343] In some embodiments, the pre-mRNA transcript containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of SEQ ID NOs: 6-10. In some embodiments, the pre-mRNA transcript containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE is encoded by a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of SEQ ID NOs: 1-5. In some embodiments, the targeting moiety of the pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE comprises a sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of any one of SEQ ID NOs: 6-10.

[0344] In some embodiments, the ASO targets an intron upstream of the ASCE, an intron downstream of the ASCE, an exon upstream of the ASCE, an exon downstream of the ASCE, or an exon within the ASCE of a pre-mRNA containing the ASCE. In some embodiments, the ASO targets an intron upstream of the ASCE, an intron downstream of the ASCE, an exon upstream of the ASCE, an exon downstream of the ASCE, or an exon within the ASCE of a pre-mRNA containing the PKD1, ABCA4, FUS, CEL, or NSD1 ASCE.

[0345] In some embodiments, the ASO targets a sequence that is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of the ASCE. In some embodiments, the ASO targets a sequence that is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of the ASCE. In some embodiments, the ASO targets a sequence that is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of the 5' end of the ASCE.

[0346] In some embodiments, the ASO targets a sequence that is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') of the 3' end of the ASCE. In some embodiments, the ASO targets a sequence that is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') of the ASCE. In some embodiments, the ASO targets a sequence that is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') from the 3' end of the ASCE.

[0347] In some embodiments, the ASO targets a pre-mRNA containing a PKD1 ASCE, wherein the ASCE is exon 38 of PKD1. In some embodiments, the ASO targets a pre-mRNA containing a PKD1 ASCE, wherein the ASCE is exon GRCh38 / hg38: chr162092954 2093093 of PKD1. In some embodiments, the ASO targets a pre-mRNA containing a PKD1 ASCE, wherein the ASCE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 11. In some embodiments, the ASO targets an intron upstream of the ASCE, an intron downstream of the ASCE, an exon upstream of the ASCE, an exon downstream of the ASCE, or an exon within the ASCE of the pre-mRNA containing the PKD1 ASCE. In some embodiments, the ASO targets a sequence that is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of GRCh38 / hg38:chr16 2092954 of PKD1. In some embodiments, the ASO targets a sequence that is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') of GRCh38 / hg38:chr16 2093093 of PKD1. In some embodiments, the ASO targets a sequence within GRCh38 / hg38:chr16 20929542093093 of PKD1.

[0348] In some embodiments, the ASO targets a pre-mRNA containing an ABCA4 ASCE, wherein the ASCE is exon 3 of ABCA4. In some embodiments, the ASO targets a pre-mRNA containing an ABCA4 ASCE, wherein the ASCE is exon GRCh38 / hg38 of ABCA4: chr194111438 94111579. In some embodiments, the ASO targets a pre-mRNA containing an ABCA4 ASCE, wherein the ASCE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 12. In some embodiments, the ASO targets an intron upstream of the ASCE, an intron downstream of the ASCE, an exon upstream of the ASCE, an exon downstream of the ASCE, or an exon within the ASCE of the pre-mRNA containing the ABCA4 ASCE. In some embodiments, the ASO targets a sequence that is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of GRCh38 / hg38:chrl 94111438 of ABCA4. In some embodiments, the ASO targets a sequence that is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') from GRCh38 / hg38 of ABCA4:chr1 94111438 94111579. In some embodiments, the ASO targets a sequence within GRCh38 / hg38 of ABCA4:chr1 94111438 94111579.

[0349] In some embodiments, the ASO targets a pre-mRNA containing a FUS ASCE, wherein the ASCE is exon 7 of FUS. In some embodiments, the ASO targets a pre-mRNA containing a FUS ASCE, wherein the ASCE is exon GRCh38 / hg38 of FUS: chrl6 3118680231186836. In some embodiments, the ASO targets a pre-mRNA containing a FUS ASCE, wherein the ASCE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 13. In some embodiments, the ASO targets an intron upstream of the ASCE, an intron downstream of the ASCE, an exon upstream of the ASCE, an exon downstream of the ASCE, or an exon within the ASCE of the pre-mRNA containing the FUS ASCE. In some embodiments, the ASO targets a sequence that is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of GRCh38 / hg38:chr16 31186802 of FUS. In some embodiments, the ASO targets a sequence that is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') of GRCh38 / hg38:chr16 31186836 of FUS. In some embodiments, the ASO targets a sequence within GRCh38 / hg38:chr16 3118680231186836 of FUS.

[0350] In some embodiments, the ASO targets a pre-mRNA containing a CEL ASCE, wherein the ASCE is exon 5 of CEL. In some embodiments, the ASO targets a pre-mRNA containing a CEL ASCE, wherein the ASCE is exon GRCh38 / hg38 of CEL: chr9 133066530133066660. In some embodiments, the ASO targets a pre-mRNA containing a CEL ASCE, wherein the ASCE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 14. In some embodiments, the ASO targets an intron upstream of the ASCE, an intron downstream of the ASCE, an exon upstream of the ASCE, an exon downstream of the ASCE, or an exon within the ASCE of the pre-mRNA containing a CEL ASCE. In some embodiments, the ASO targets a sequence that is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of GRCh38 / hg38:chr9 133066530 of CEL. In some embodiments, the ASO targets a sequence that is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') of GRCh38 / hg38 of CEL:chr9 133066660. In some embodiments, the ASO targets a sequence within GRCh38 / hg38 of CEL:chr9 133066530133066660.

[0351] In some embodiments, the ASO targets a pre-mRNA containing an NSD1 ASCE, wherein the ASCE is exon 8 of NSD1. In some embodiments, the ASO targets a pre-mRNA containing an NSD1 ASCE, wherein the ASCE is exon GRCh38 / hg38 of NSD1: chr5177238237 177238507. In some embodiments, the ASO targets a pre-mRNA containing an NSD1 ASCE, wherein the ASCE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to SEQ ID NO: 15. In some embodiments, the ASO targets an intron upstream of the ASCE, an intron downstream of the ASCE, an exon upstream of the ASCE, an exon downstream of the ASCE, or an exon within the ASCE of the pre-mRNA containing the NSD1 ASCE. In some embodiments, the ASO targets a sequence that is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides upstream (or 5') of GRCh38 / hg38:chr5 177238237 of NSD1. In some embodiments, the ASO targets a sequence that is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, or about 50 nucleotides downstream (or 3') of GRCh38 / hg38 of NSD1:chr5 177238507. In some embodiments, the ASO targets a sequence within GRCh38 / hg38:chr5 177238237 177238507 of NSD1.

[0352] In some embodiments, the ASO comprises a sequence that is complementary to a targeting portion of a pre-mRNA containing an ASCE, the pre-mRNA being encoded by a gene having a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the ASO comprises a sequence that is complementary to a targeting portion of a pre-mRNA containing an ASCE, the pre-mRNA having a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NOs: 6-10. In some embodiments, the ASO comprises a sequence that is complementary to a targeting portion of an ASCE, the ASCE having a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NOs: 11-15. In some embodiments, the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of SEQ ID NOs: 16-309. In some embodiments, the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to the reverse complement sequence of any one of SEQ ID NOs: 16-309. In some embodiments, the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to the complement sequence of any one of SEQ ID NOs: 16-309. In some embodiments, the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to the complement sequence of any one of SEQ ID NOs: 16-309.

[0353] In some embodiments, the ASO targets a sequence located 5' upstream of the ASCE.

[0354] In some embodiments, the ASO targets a sequence comprising an exon-intron boundary (or junction). In some embodiments, the ASO does not target a sequence comprising an exon-intron boundary (or junction). In some embodiments, the ASO targets a sequence located 3' downstream of the ASCE. In some embodiments, the ASO targets a sequence located within the ASCE.

[0355] Protein expression

[0356] In some embodiments, the methods described herein are used to increase the production of functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor binding SET domain protein 1 protein or RNA. As used herein, the term "functional" refers to the amount of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor binding SET domain protein 1 protein or RNA activity or function necessary to eliminate any one or more symptoms of the condition or disease being treated, e.g., polycystic kidney disease 1 with or without polycystic liver disease; autosomal dominant polycystic kidney disease; age-related macular degeneration-2; Stargardt disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young type 8 with exocrine dysfunction; maturity-onset diabetes of the young; Sotos syndrome 1; or Beckwith-Wiedemann syndrome. In some embodiments, the methods are used to increase the production of partially functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein or RNA. As used herein, the term "partially functional" refers to an amount of any activity or function of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein or RNA that is less than the amount of activity or function necessary to eliminate or prevent any one or more symptoms of a disease or condition. In some embodiments, the partially functional protein or RNA will have at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the activity of the fully functional protein or RNA.

[0357] In some embodiments, the method is a method of increasing expression of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein in cells of a subject having ASCE-containing pre-mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the subject has a disease caused by polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein. Polycystic kidney disease 1 with or without polycystic liver disease caused by deficiency in the activity of RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1; autosomal dominant polycystic kidney disease; age-related macular degeneration 2; Stargardt's disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young with exocrine dysfunction type 8; maturity-onset diabetes of the young; Sotos syndrome 1; or Beckwith-Wiedemann syndrome, and wherein the deficiency in the activity of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1 is caused by haploinsufficiency of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1. In such embodiments, the subject has a first allele and a second allele, wherein the first allele encodes a functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, and the second allele does not produce polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein. In another such embodiment, the subject has a first allele and a second allele, wherein the first allele encodes a functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, and the second allele encodes a non-functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein.In another such embodiment, the subject has a first allele that encodes a functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, and a second allele that encodes a partially functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein. In any of these embodiments, the antisense oligomer binds to the targeting moiety of the ASCE-containing pre-mRNA transcribed from the second allele, thereby inhibiting or reducing exon skipping of the ASCE from the pre-mRNA, or promoting incorporation of the ASCE into mature RNA processed from the ASCE-containing pre-mRNA, and resulting in an increase in the level of mature mRNA encoding functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxy ester lipase, or nuclear receptor-binding SET domain protein 1 protein, and an increase in expression of the polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxy ester lipase, or nuclear receptor-binding SET domain protein 1 protein in cells of the subject.

[0358] In some embodiments, the method is a method of increasing expression of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein in cells of a subject having ASCE-containing pre-mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the subject has a disease caused by polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein. Polycystic kidney disease 1 with or without polycystic liver disease caused by deficiency in the activity of RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1; autosomal dominant polycystic kidney disease; age-related macular degeneration 2; Stargardt disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young with exocrine dysfunction type 8; maturity-onset diabetes of the young; Sotos syndrome 1; or Beckwith-Wiedemann syndrome, wherein the deficiency in polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1 is caused by autosomal recessive inheritance.

[0359] In some embodiments, the method is a method of increasing expression of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein in cells of a subject having ASCE-containing pre-mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the subject has a disease caused by polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein. Polycystic kidney disease 1 with or without polycystic liver disease caused by deficiency in the activity of RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1; autosomal dominant polycystic kidney disease; age-related macular degeneration-2; Stargardt disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young with exocrine dysfunction type 8; maturity-onset diabetes of the young; Sotos syndrome 1; or Beckwith-Wiedemann syndrome, wherein the deficiency in the activity of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1 is caused by autosomal dominant inheritance.

[0360] In some embodiments, the method is a method of increasing expression of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein in cells of a subject having ASCE-containing pre-mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the subject has a disease caused by polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein. Polycystic kidney disease 1 with or without polycystic liver disease caused by deficiency in the activity of RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1; autosomal dominant polycystic kidney disease; age-related macular degeneration-2; Stargardt disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young with exocrine dysfunction type 8; maturity-onset diabetes of the young; Sotos syndrome 1; or Beckwith-Wiedemann syndrome, wherein the deficiency in polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain-containing protein 1 is caused by an X-linked dominant trait.

[0361] In related embodiments, the method is a method of using an ASO to increase expression of a protein or functional RNA. In some embodiments, the ASO can be used to increase expression of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein in a cell of a subject having ASCE-containing pre-mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the subject has polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein. Deficiency in the amount or function of RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain protein 1 protein, for example, polycystic kidney disease 1 with or without polycystic liver disease; autosomal dominant polycystic kidney disease; age-related macular degeneration 2; Stargardt disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes mellitus of the young type 8 with exocrine dysfunction; maturity-onset diabetes mellitus of the young; Sotos syndrome 1; or Beckwith-Wiedemann syndrome.

[0362] In some embodiments, ASCE-containing pre-mRNA transcripts encoding proteins that cause a disease or condition are targeted by the ASOs described herein. In some embodiments, ASCE-containing pre-mRNA transcripts encoding proteins that do not cause a disease are targeted by the ASOs. For example, a disease caused by a mutation or deficiency in a first protein in a particular pathway can be ameliorated by targeting an ASCE-containing pre-mRNA encoding a second protein, thereby increasing production of the second protein. In some embodiments, the function of the second protein is capable of compensating for the mutation or deficiency in the first protein that causes the disease or condition.

[0363] In some embodiments, the subject has:

[0364] (a) a first mutant allele, wherein the first mutant allele

[0365] (i) produces polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein at reduced levels compared to production by the wild-type allele,

[0366] (ii) producing the polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein in a form that is reduced in function compared to the equivalent wild-type protein, or

[0367] (iii) no production of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein or functional RNA; and

[0368] (b) a second mutant allele, said second mutant allele

[0369] (i) produces polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein at reduced levels compared to production by the wild-type allele,

[0370] (ii) producing the polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein in a form that is reduced in function compared to the equivalent wild-type protein, or

[0371] (iii) does not produce polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein, and

[0372] wherein the ASCE-containing pre-mRNA is transcribed from the first allele and / or the second allele. In these embodiments, the ASO binds to the targeting portion of the ASCE-containing pre-mRNA transcribed from the first allele or the second allele, thereby promoting exonic incorporation of the ASCE in the processed mRNA processed from the ASCE-containing pre-mRNA, and causing an increase in the level of mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein, and an increase in expression of the target protein or functional RNA in cells of the subject. In these embodiments, the increase in expression level of the target protein or functional RNA caused by reduction or inhibition of exon skipping of the ASCE from the ASCE-containing pre-mRNA can be in the form of reduced function compared to the equivalent wild-type protein (partial functionality) or fully functional compared to the equivalent wild-type protein (fully functional).

[0373] In some embodiments, the level of mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxy ester lipase, or nuclear receptor-binding SET domain protein 1 protein is increased by 1.1 to 10 fold when compared to the amount of mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxy ester lipase, or nuclear receptor-binding SET domain protein 1 protein produced in control cells (e.g., cells not treated with the antisense oligomer, or cells treated with an antisense oligomer that is not bound to a targeting moiety comprising a pre-mRNA of PKD1, ABCA4, FUS, CEL, or NSD1 ASCE).

[0374] In some embodiments, a subject treated using the methods of the present disclosure expresses a partially functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein from one allele, wherein the partially functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein can be caused by a frame shift mutation, a nonsense mutation, a missense mutation, or a partial gene deletion. In some embodiments, a subject treated using the methods of the present disclosure expresses a non-functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein from one allele, wherein the non-functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein can be caused by a frame shift mutation, a nonsense mutation, a missense mutation, or a partial gene deletion in one allele. In some embodiments, the subject treated using the methods of the present disclosure has a whole gene deletion of PKD1, ABCA4, FUS, CEL, or NSD1 in one allele.

[0375] Exon inclusion

[0376] As used herein, a "pre-mRNA containing an ASCE" is a pre-mRNA transcript containing at least one alternatively spliced ​​coding exon. Alternative or aberrant splicing may result in the exclusion of at least one ASC from the mature mRNA transcript. The terms "mature mRNA" and "fully spliced ​​mRNA" are used interchangeably herein to describe fully processed mRNA. The inclusion of at least one spurious exon can render the mRNA unproductive and promote NMD of the mature mRNA. Mature mRNA containing an ASCE may sometimes result in aberrant protein expression.

[0377] In some embodiments, the included pseudo-exon is the most abundant pseudo-exon in a population of ASCE-containing pre-mRNAs transcribed from a gene encoding a target protein in a cell. In some embodiments, the included pseudo-exon is the most abundant pseudo-exon in a population of ASCE-containing pre-mRNAs transcribed from a gene encoding a target protein in a cell, wherein the population of ASCE-containing pre-mRNAs comprises two or more of the included pseudo-exons. In some embodiments, an antisense oligomer targeting the most abundant pseudo-exon in a population of ASCE-containing pre-mRNAs encoding a target protein induces exon skipping of one or two or more pseudo-exons in the population, wherein the pseudo-exon comprises the pseudo-exon targeted or bound by the antisense oligomer. In some embodiments, the targeted region is within a pseudo-exon, wherein the pseudo-exon is the most abundant pseudo-exon in a pre-mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor binding SET domain protein 1 protein.

[0378] The extent of exon inclusion can be expressed as a percent exon inclusion, e.g., the percentage of transcripts that include a given pseudo exon. Briefly, the percent exon inclusion can be calculated as the percentage of the amount of RNA transcripts that incorporate the exon relative to the sum of the mean amount of RNA transcripts that incorporate the exon plus the mean amount of RNA transcripts that exclude the exon.

[0379] In some embodiments, the ASCE is based on determining the exclusion of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% of the exons identified as ASCEs. In embodiments, the ASCE is based on determining the exclusion of about 5% to about 100%, about 5% to about 95%, about 5% to about 90%, about 5% to about 85%, about 5% to about 80%, about 5% to about 75%, about 5% to about 70%, about 5% to about 65%, about 5% to about 60%, about 5% to about 55%, about 5% to about 50%, about 5% to about 45%, about 5% to about 40%, about 5% to about 35%, about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 10% to about 100%, about 10% to about 95%, about 10% to about 15%. % to about 90%, about 10% to about 85%, about 10% to about 80%, about 10% to about 75%, about 10% to about 70%, about 10% to about 65%, about 10% to about 60%, about 10% to about 55%, about 10% to about 50%, about 10% to about 45%, about 10% to about 40%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 10% to about 20%, about 15% to about 100%, about 15% to about 95%, about 15% to about 90%, about 15% to about 85%, about 15% to about 80%, about 15% to about 75%, about 15% to about 70%, about 15% to about 65%, about 15% to about 60%, about 15% to about 55%, about 15% to about 50%, about 15% to about 45%, about 15% to about 40%, about 15% to about 35%, about 15% to about 30%, about 15% to about 25%, about 20% to about 100%, about 20% to about 95%, about 20% to about 90%, about 20% to about 85%, about 20% to about 80%, about 20% to about 75%, about 20% to about 70%, about 20% to about 65%, about 20% to about 60%, about 20% to about 55% %, about 20% to about 50%, about 20% to about 45%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30%, about 25% to about 100%, about 25% to about 95%, about 25% to about 90%, about 25% to about 85%, about 25% to about 80%, about 25% to about 75%, about 25% to about 70%, about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, or about 25% to about 35% of the exons identified as ASCEs.ENCODE data (described by, e.g., Tilgner et al., 2012, “Deep sequencing of subcellular RNA fractions shows splicing to bepredominantly co-transcriptional in the human genome but inefficient for lncRNAs,” Genome Research 22(9):1616-25) can be used to help identify exon inclusion or exclusion.

[0380] In some embodiments, contacting a cell with an ASO that is complementary to a targeting portion of a PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript results in an increase in the amount of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein produced by at least 10%, 20%, 30%, 40%, 50%, 60%, 80%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, or 1000% compared to the amount of target protein produced by the cell in the absence of the ASO / treatment. In some embodiments, polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein produced by cells contacted with the antisense oligomer is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 80%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, or 1000% compared to the amount of target protein produced by the cell in the absence of the ASO / treatment. The total amount of RNA binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein is increased by about 20% to about 300%, about 50% to about 300%, about 100% to about 300%, about 150% to about 300%, about 20% to about 50%, about 20% to about 100%, about 20% to about 150%, about 20% to about 200%, about 20% to about 250%, about 50% to about 100%, about 50% to about 150%. %, about 50% to about 200%, about 50% to about 250%, about 100% to about 150%, about 100% to about 200%, about 100% to about 250%, about 150% to about 200%, about 150% to about 250%, about 200% to about 250%, at least about 10%, at least about 20%, at least about 50%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300%. In some embodiments, the amount of polycystin-1, ATP-binding cassette subfamily A member 4, FUS produced by cells contacted with the antisense oligomer is compared to the amount of target protein produced by a control compound. The total amount of RNA binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein is increased by about 1.1 to about 10 fold, about 1.5 to about 10 fold, about 2 to about 10 fold, about 3 to about 10 fold, about 4 to about 10 fold, about 1.1 to about 5 fold, about 1.1 to about 6 fold, about 1.1 to about 7 fold, about 1.1 to about 8 fold, about 1.1 to about 9 fold, about 2 to about 5 fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold. The control compound can be, for example, an oligonucleotide that is not complementary to a targeting portion of the pre-mRNA.

[0381] In some embodiments, contacting a cell with an ASO that is complementary to a targeting portion of a PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA transcript results in an increase in the amount of PKD1, ABCA4, FUS, CEL, or NSD1 mRNA, including mature mRNA encoding the target protein. In some embodiments, the amount of mRNA encoding polycystin-1, ATP-binding cassette subfamily A, member 4, FUS RNA-binding protein, carboxy ester lipase, or nuclear receptor-binding SET domain protein 1 protein, or mature mRNA encoding polycystin-1, ATP-binding cassette subfamily A, member 4, FUS RNA-binding protein, carboxy ester lipase, or nuclear receptor-binding SET domain protein 1 protein, is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 80%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, or 1000% compared to the amount of protein produced by the cell in the absence of the ASO / treatment. In some embodiments, the total amount of mRNA encoding polycystin-1, ATP-binding cassette subfamily A, member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, or mature mRNA encoding polycystin-1, ATP-binding cassette subfamily A, member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein produced in cells contacted with the antisense oligomer is increased by about 20% to about 300%, about 50% to about 300%, about 100% to about 300%, about 150% to about 300%, about 20% to about 50%, about 20% to about 100%, about 20% to about 150%, about 20% to about 200%, about 20% to about 250%, about 50% to about 10 ... 150%, about 50% to about 200%, about 50% to about 250%, about 100% to about 150%, about 100% to about 200%, about 100% to about 250%, about 150% to about 200%, about 150% to about 250%, about 200% to about 250%, at least about 10%, at least about 20%, at least about 50%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300%.In some embodiments, the amount of mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein or the amount of mRNA encoding polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein produced in cells contacted with the antisense oligomer is reduced compared to the amount of mature RNA produced in untreated cells (e.g., untreated cells or cells treated with a control compound). The total amount of mature mRNA for RNA binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein is increased by about 1.1 to about 10-fold, about 1.5 to about 10-fold, about 2 to about 10-fold, about 3 to about 10-fold, about 4 to about 10-fold, about 1.1 to about 5-fold, about 1.1 to about 6-fold, about 1.1 to about 7-fold, about 1.1 to about 8-fold, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold. A control compound can be, for example, an oligonucleotide that is not complementary to a targeting portion of a pre-mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE.

[0382] The ASCE may be of any length. The ASCE may comprise typical exons. The ASCE may comprise the full sequence of typical exons. In some embodiments, the ASCE may have a length of 5 to 10 nucleotides, a length of 10 to 15 nucleotides, a length of 15 to 20 nucleotides, a length of 20 to 25 nucleotides, a length of 25 to 30 nucleotides, a length of 30 to 35 nucleotides, a length of 35 to 40 nucleotides, a length of 40 to 45 nucleotides, a length of 45 to 50 nucleotides, a length of 50 to 55 nucleotides, a length of 55 to 60 nucleotides, a length of 60 to 65 nucleotides, a length of 65 to 70 nucleotides, a length of 70 to 75 nucleotides, a length of 75 to 80 nucleotides, a length of 80 to 85 nucleotides, a length of 85 to 90 nucleotides, a length of 90 to 95 nucleotides, or a length of 95 to 100 nucleotides. In some embodiments, the ASCE may have a length of at least 10 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, or at least 100 nucleotides. In some embodiments, the ASCE may have a length of 100 to 200 nucleotides, a length of 200 to 300 nucleotides, a length of 300 to 400 nucleotides, a length of 400 to 500 nucleotides, a length of 500 to 600 nucleotides, a length of 600 to 700 nucleotides, a length of 700 to 800 nucleotides, a length of 800 to 900 nucleotides, or a length of 900 to 1,000 nucleotides. In some embodiments, the length of the ASCE may be longer than 1,000 nucleotides.

[0383] Exclusion of the ASCE may result in frame shifts and the introduction of premature stop codons (PICs) in the mature mRNA transcript, making the transcript a target for NMD. A mature mRNA transcript lacking an ASCE may be a non-productive mRNA transcript that does not result in protein expression. The PIC may be present in any position downstream of an exon upstream of the ASCE in the pre-mRNA. In some embodiments, the PIC may be present in any exon downstream of an exon upstream of the ASCE in the pre-mRNA.

[0384] therapeutic agents

[0385] In various embodiments of the present disclosure, compositions and methods comprising therapeutic agents are provided for modulating protein expression levels of ABCA4, FUS, CEL, or NSD1. In some embodiments, compositions and methods are provided herein for modulating alternative splicing of PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA. In some embodiments, compositions and methods are provided herein for promoting the incorporation of ASCEs into the splicing of PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA, for example, to inhibit ASCE skipping during splicing of PKD1, ABCA4, FUS, CEL, or NSD1 pre-mRNA.

[0386] The therapeutic agents disclosed herein may be NMD inhibitors. The therapeutic agent may comprise a polynucleic acid polymer.

[0387] According to one aspect of the present disclosure, provided herein is a method for treating or preventing a condition or disease associated with a deficiency of functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, the method comprising administering to a subject an ASCE repressor to increase the level of functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the agent binds to a region of the pre-mRNA transcript to reduce the incorporation of ASCE in the mature transcript. For example, provided herein is a method for treating or preventing a condition associated with a deficiency of functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, the method comprising administering to a subject an ASCE repressor to increase the level of functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the agent binds to a region of a pre-mRNA containing ASCE. For example, provided herein is a method for treating or preventing a condition associated with a deficiency of functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain protein 1 protein, the method comprising administering to a subject an ASCE inhibitor to increase the level of functional polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, or nuclear receptor-binding SET domain protein 1 protein, wherein the agent is incompatible with a protein containing an ASCE (e.g., an ASCE of PKD1 (GRCh38 / hg38: chr16 2092954 2093093); an ASCE of ABC4 (GRCh38 / hg38: chr1 94111438 94111579); an ASCE of FUS (GRCh38 / hg38: chr16 31186802 31186836); ASCE of CEL (GRCh38 / hg38: chr9133066530133066660); ASCE of NSD1 (GRCh38 / hg38: chr5 177238237 177238507)).

[0388] In the context of promoting ASCE incorporation in mature mRNA, the promotion can be complete, e.g., 100%, or can be partial. The promotion can be clinically significant. The promotion / correction can be relative to the level of ASCE incorporation in an untreated subject, or relative to the amount of ASCE incorporation in a similar population of subjects. The promotion / correction can be at least 10% greater ASCE incorporation relative to the average subject or subject before treatment. The promotion can be at least 20% greater ASCE incorporation relative to the average subject or subject before treatment. The promotion can be at least 40% greater ASCE incorporation relative to the average subject or subject before treatment. The promotion can be at least 50% greater ASCE incorporation relative to the average subject or subject before treatment. The promotion can be at least 60% greater ASCE incorporation relative to the average subject or subject before treatment. The promotion can be at least 80% greater ASCE incorporation relative to the average subject or subject before treatment. The promotion can be at least 90% greater ASCE incorporation relative to the average subject or subject before treatment.

[0389] In the case of increasing the level of active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein, the increase can be clinically significant. The increase can be relative to the level of active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein in an untreated subject, or relative to the amount of active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein in a population of similar subjects. The increase can be at least 10% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor binding SET domain protein 1 protein relative to the average subject or the subject before treatment. The increase can be at least 20% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein relative to the average subject or subject before treatment. The increase can be at least 40% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein relative to the average subject or subject before treatment. The increase can be at least 50% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein relative to the average subject or subject before treatment. The increase can be at least 80% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein relative to the average subject or subject before treatment. The increase can be at least 100% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein relative to the average subject or subject before treatment. The increase can be at least 200% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein relative to the average subject or subject before treatment. The increase can be at least 500% more active polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyester lipase, or nuclear receptor-binding SET domain protein 1 protein relative to the average subject or subject before treatment.

[0390] In embodiments where the ASCE repressor comprises a polynucleic acid polymer, the polynucleic acid polymer may be about 50 nucleotides in length. The polynucleic acid polymer may be about 45 nucleotides in length. The polynucleic acid polymer may be about 40 nucleotides in length. The polynucleic acid polymer may be about 35 nucleotides in length. The polynucleic acid polymer may be about 30 nucleotides in length. The polynucleic acid polymer may be about 24 nucleotides in length. The polynucleic acid polymer may be about 25 nucleotides in length. The polynucleic acid polymer may be about 20 nucleotides in length. The polynucleic acid polymer may be about 19 nucleotides in length. The polynucleic acid polymer may be about 18 nucleotides in length. The polynucleic acid polymer may be about 17 nucleotides in length. The polynucleic acid polymer may be about 16 nucleotides in length. The polynucleic acid polymer may be about 15 nucleotides in length. The polynucleic acid polymer may be about 14 nucleotides in length. The polynucleic acid polymer may be about 13 nucleotides in length. The polynucleic acid polymer may be about 12 nucleotides in length. The polynucleic acid polymer may be about 11 nucleotides in length. The polynucleic acid polymer may be about 10 nucleotides in length. The polynucleic acid polymer may be about 10 to about 50 nucleotides in length. The polynucleic acid polymer may be about 10 to about 45 nucleotides in length. The polynucleic acid polymer may be about 10 to about 40 nucleotides in length. The polynucleic acid polymer may be about 10 to about 35 nucleotides in length. The polynucleic acid polymer may be about 10 to about 30 nucleotides in length. The polynucleic acid polymer may be about 10 to about 25 nucleotides in length. The polynucleic acid polymer may be about 10 to about 20 nucleotides in length. The polynucleic acid polymer may be about 15 to about 25 nucleotides in length. The polynucleic acid polymer may be about 15 to about 30 nucleotides in length. The polynucleic acid polymer may be about 12 to about 30 nucleotides in length.

[0391] The sequence of the polynucleic acid polymer can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% complementary to a target sequence of an mRNA transcript (e.g., a partially processed mRNA transcript). The sequence of the polynucleic acid polymer can be 100% complementary to a target sequence of a pre-mRNA transcript.

[0392] The sequence of the polynucleic acid polymer may have 4 or fewer mismatches with the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 3 or fewer mismatches with the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 2 or fewer mismatches with the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 1 or fewer mismatches with the target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have no mismatches with the target sequence of the pre-mRNA transcript.

[0393] The polynucleic acid polymer can specifically hybridize to a target sequence of a pre-mRNA transcript. For example, the polynucleic acid polymer can have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence complementarity to the target sequence of the pre-mRNA transcript. Hybridization can be under high stringency hybridization conditions.

[0394] The polynucleic acid polymer comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 16-309. The polynucleic acid polymer may comprise a sequence having 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 16-309.

[0395] In the case of reference to a polynucleic acid polymer sequence, the skilled artisan will understand that one or more substitutions can be accepted, and optionally two substitutions can be accepted in the sequence, so that it maintains the ability to hybridize to the target sequence; or, in the case where the substitution is located in the target sequence, the ability to be recognized as the target sequence. Reference to sequence identity can be determined by BLAST sequence alignment using standard / default parameters. For example, a sequence can have 99% identity and still function according to the present disclosure. In other embodiments, a sequence can have 98% identity and still function according to the present disclosure. In another embodiment, a sequence can have 95% identity and still function according to the present disclosure. In another embodiment, a sequence can have 90% identity and still function according to the present disclosure.

[0396] antisense oligomers

[0397] Provided herein is a composition comprising an antisense oligomer that induces exon skipping by binding to a targeting portion of a precursor mRNA containing PKD1, ABCA4, FUS, CEL or NSD1ASCE. As used herein, the terms "ASO" and "antisense oligomer" are used interchangeably and refer to an oligomer, such as a polynucleotide, comprising a nucleobase that hybridizes to a target nucleic acid (e.g., a precursor mRNA containing PKD1, ABCA4, FUS, CEL or NSD1 ASCE) sequence by Watson-Crick base pairing or wobble base pairing (GU). The ASO may have an exact sequence complementary to the target sequence or close complementarity (e.g., sufficient complementarity to bind to the target sequence and enhance splicing at the splicing site). The ASO is designed so that it binds (hybridizes) to the target nucleic acid (e.g., the targeting portion of the precursor mRNA transcript) and maintains hybridization under physiological conditions. Typically, if the ASO hybridizes to a site other than the expected (targeting) nucleic acid sequence, it hybridizes to a limited number of sequences that are not the target nucleic acid (hybridizes to several sites other than the target nucleic acid). The design of ASOs can take into account the appearance of sufficiently similar nucleic acid sequences in other positions in the nucleic acid sequence of the targeting portion of the pre-mRNA transcript or the genome or cell pre-mRNA or transcriptome, so that the ASO will be bound to other sites and cause the possibility of a "missing target" effect to be limited. Any antisense oligomer known in the art, such as any antisense oligomer in PCT application No. PCT / US2014 / 054151, entitled "Reducing Nonsense-Mediated mRNA Decay" disclosed in WO2015 / 035091, incorporated herein by reference, can be used to practice the methods described herein.

[0398] In some embodiments, the ASO "specifically hybridizes" to or is "specific for" a targeting portion of a target nucleic acid or ASCE-containing pre-mRNA. Typically, such hybridization occurs at a T of substantially greater than 37°C, preferably at least 50°C, and typically 60°C to about 90°C. m Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, T m It is the temperature at which 50% of the target sequence hybridizes to the complementary oligonucleotide.

[0399] Oligomers, such as oligonucleotides, are "complementary" to each other when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. A double-stranded polynucleotide can be "complementary" to another polynucleotide if hybridization can occur between one of the strands of the first polynucleotide and the second polynucleotide. According to generally accepted base pairing rules, complementarity (the degree to which one polynucleotide is complementary to another) can be quantified based on the ratio (e.g., percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other. The sequence of an antisense oligomer (ASO) does not need to be 100% complementary to the sequence of its target nucleic acid to hybridize. In certain embodiments, an ASO may comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence complementary to the target region within the target nucleic acid sequence to which it is targeted. For example, an ASO in which 18 of the 20 nucleobases of the oligomeric compound are complementary to the target region and therefore will specifically hybridize would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be clustered together or interspersed with complementary nucleobases and need not be contiguous or adjacent to each other. The percent complementarity of an ASO to a region of a target nucleic acid can be routinely determined using BLAST programs (Basic Local Alignment Search Tool) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

[0400] An ASO need not hybridize to all nucleobases in a target sequence, and the nucleobases to which it hybridizes may be continuous or non-continuous. An ASO may hybridize to one or more segments of a pre-mRNA transcript such that intermediate or adjacent segments are not involved in a hybridization event (e.g., a loop structure or hairpin structure may be formed). In certain embodiments, an ASO hybridizes to non-continuous nucleobases in a target pre-mRNA transcript. For example, an ASO may hybridize to nucleobases in a pre-mRNA transcript separated by one or more nucleobases to which the ASO does not hybridize.

[0401] The ASOs described herein comprise nucleobases that are complementary to nucleobases present in the target portion of the ASCE-containing pre-mRNA. The term ASO encompasses oligonucleotides and any other oligomeric molecule comprising a nucleobase capable of hybridizing to a complementary nucleobase on the target mRNA but not comprising a sugar moiety, such as a peptide nucleic acid (PNA). An ASO may comprise naturally occurring nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the foregoing. The term "naturally occurring nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides having modified or substituted sugar groups and / or having a modified backbone. In some embodiments, all nucleotides of an ASO are modified nucleotides. Chemical modifications of ASOs or components of ASOs that are compatible with the methods and compositions described herein will be apparent to those skilled in the art and can be found, for example, in U.S. Pat. No. 8,258,109 B2, U.S. Pat. No. 5,656,612, U.S. Pat. Pub. No. 2012 / 0190728, and Dias and Stein, Mol. Cancer Ther. 2002, 347-355, which are incorporated herein by reference in their entireties.

[0402] The one or more nucleobases of the ASO can be any naturally occurring, unmodified nucleobase (e.g., adenine, guanine, cytosine, thymine, and uracil) or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on the target pre-mRNA. Examples of modified nucleobases include, but are not limited to, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethylcytosine.

[0403] The ASOs described herein also comprise a backbone structure connecting the components of the oligomer. The terms "backbone structure" and "oligomer bond" are used interchangeably and refer to the connection between the monomers of the ASO. In naturally occurring oligonucleotides, the backbone comprises a 3'-5' phosphodiester bond connecting the sugar moieties of the oligomer. The backbone structure or oligomer bond of the ASOs described herein may include, but is not limited to, phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoamide, and the like. See, e.g., LaPlanche et al., Nucleic Acids Res. 14:9081 (1986); Stec et al., J. Am. Chem. Soc. 106:6077 (1984), Stein et al., Nucleic Acids Res. 16:3209 (1988), Zon et al., Anti-Cancer Drug Design 6:539 (1991); Zon et al., Oligonucleotides and Analogues: A Practical Approach, pp. 87-108 (F. Eckstein, ed., Oxford University Press, Oxford England (1991)); Stec et al., U.S. Pat. No. 5,151,510; Uhlmann and Peyman, Chemical Reviews 90:543 (1990). In some embodiments, the backbone structure of the ASO does not contain phosphorus, but rather contains peptide bonds, such as peptide nucleic acids (PNAs), or linking groups including carbamates, amides, and linear and cyclic hydrocarbon groups. In some embodiments, the backbone modification is a phosphorothioate bond. In some embodiments, the backbone modification is a phosphoamide bond.

[0404] In certain embodiments, the stereochemistry of each phosphorus internucleotide bond in the phosphorus internucleotide bond of the ASO main chain is random. In certain embodiments, the stereochemistry of each phosphorus internucleotide bond in the phosphorus internucleotide bond of the ASO main chain is controlled and is not random. For example, U.S. Patent Application Publication No. 2014 / 0194610, incorporated herein by reference, " Methods for the Synthesis of Functionalized Nucleic Acids " describes a method for independently selecting the chiral handedness of each phosphorus atom in a nucleic acid oligomer. In certain embodiments, the ASO used in the method of the present disclosure, including but not limited to any one of the ASO shown in Table 4, 5A, 5A-1, 5B, 5B-1, 5D, 5E, 5G and 5G-1, comprises an ASO with non-random phosphorus internucleotide bond. In certain embodiments, the composition used in the method of the present disclosure comprises pure diastereoisomerism ASO. In some embodiments, the compositions used in the methods of the present disclosure comprise an ASO having a diastereomeric purity of at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to about 100%.

[0405] In some embodiments, the ASO has a non-random mixture of Rp and Sp configurations at its phosphointernucleotide linkages. For example, it has been proposed that a mixture of Rp and Sp is required in antisense oligonucleotides to achieve a balance between good activity and nuclease stability (Wan et al., 2014, "Synthesis, biophysical properties and biological activity of second generation antisense oligonucleotides containing chiralphosphorothioate linkages", Nucleic Acids Res. 42(22): 13456-13468, incorporated herein by reference. In some embodiments, the ASOs used in the methods of the present disclosure, including but not limited to any of the ASOs described herein in SEQ ID NOs: 16-309, comprise about 5-100% Rp, at least about 5% Rp, at least about 10% Rp, at least about 15% Rp, at least about 20% Rp, at least about 25% Rp, at least about 30% Rp, at least about 35% Rp, at least about 40% Rp, at least about 45% Rp, at least about 50% Rp, or at least about 50% Rp. Rp, at least about 55% Rp, at least about 60% Rp, at least about 65% Rp, at least about 70% Rp, at least about 75% Rp, at least about 80% Rp, at least about 85% Rp, at least about 90% Rp or at least about 95% Rp, and the remainder Sp, or about 100% Rp.In some embodiments, the ASOs used in the methods of the present disclosure include, but are not limited to, any of the ASOs described herein comprising a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of any of SEQ ID NOs: 16-309, comprising about 10% to about 100% Rp, about 15% to about 100% Rp, about 20% to about 100% Rp, about 25% to about 100% Rp, about 30% to about 100% Rp, about 35% to about 100% Rp, about 40% to about 100% Rp, about 45% to about 100% Rp, about 50% to about 100% Rp, about 55% to about 100% Rp, about 60% to about 100% Rp, about 65% to about 100% Rp, about 70% to about 100% Rp, about 75% to about 100% Rp, or about 80% to about 100% Rp. Rp, about 80% to about 100% Rp, about 85% to about 100% Rp, about 90% to about 100% Rp or about 95% to about 100% Rp, about 20% to about 80% Rp, about 25% to about 75% Rp, about 30% to about 70% Rp, about 40% to about 60% Rp or about 45% to about 55% Rp, and the remainder Sp.

[0406] In some embodiments, the ASOs used in the methods of the present disclosure include, but are not limited to, any of the ASOs described herein comprising a sequence complementary to a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of any of SEQ ID NOs: 6-10, comprising about 5-100% Sp, at least about 5% Sp, at least about 10% Sp, at least about 15% Sp, at least about 20% Sp, at least about 25% Sp, at least about 30% Sp, at least about 35% Sp, at least about 40% Sp, at least about 45% Sp, at least about 50% Sp, at least about 55% Sp, at least about 60% Sp, at least about 65% Sp, at least about 70% Sp, at least about 75% Sp, at least about 80% Sp, at least about 85% Sp, at least about 90% Sp, or at least about 95% Sp, and the remainder Rp, or about 100% Sp. In embodiments, the ASOs used in the methods of the present disclosure include, but are not limited to, any of the ASOs described herein comprising a sequence complementary to a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of any of SEQ ID NOs: 6-10, comprising about 10% to about 100% Sp, about 15% to about 100% Sp, about 20% to about 100% Sp, about 25% to about 100% Sp, about 30% to about 100% Sp, about 35% to about 100% Sp, about 40% to about 100% Sp, about 45% to about 100% Sp, about 50% to about 100% Sp, about 55% to about 100% Sp, about 60% to about 100% Sp, about 65% to about 100% Sp, about 70% to about 100% Sp, about 75% to about 100% Sp, about 80% to about 100% Sp, or about 85% to about 100% Sp. Sp, about 85% to about 100% Sp, about 90% to about 100% Sp or about 95% to about 100% Sp, about 20% to about 80% Sp, about 25% to about 75% Sp, about 30% to about 70% Sp, about 40% to about 60% Sp or about 45% to about 55% Sp, and the remainder Rp.

[0407] Any of the ASOs described herein may contain a sugar moiety comprising ribose or deoxyribose as present in naturally occurring nucleotides, or a modified sugar moiety or sugar analogue, including a morpholine ring. Non-limiting examples of modified sugar moieties include 2' substitutions, such as 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F; N3'->P5' phosphoamide, 2' dimethylaminooxyethoxy, 2' dimethylaminoethoxyethoxy, 2'-guanidine, 2'-O-guanidineethyl, carbamate-modified sugars, and bicyclic-modified sugars. In some embodiments, the sugar moiety modification is selected from 2'-O-Me, 2'F, and 2'MOE. In some embodiments, the sugar moiety modification is an additional bridge bond, such as a locked nucleic acid (LNA). In some embodiments, sugar analogues contain a morpholine ring, such as phosphorodiamidate morpholino (PMO). In some embodiments, the sugar moiety comprises a ribofuranosyl or 2' deoxyribofuranosyl modification. In some embodiments, the sugar moiety comprises a 2'4'-restricted 2'-O-methyloxyethyl (cMOE) modification. In some embodiments, the sugar moiety comprises a cEt2',4'-restricted 2'-O ethyl BNA modification. In some embodiments, the sugar moiety comprises a tricyclic DNA (tcDNA) modification. In some embodiments, the sugar moiety comprises an ethylene nucleic acid (ENA) modification. In some embodiments, the sugar moiety comprises an MCE modification. Modifications are known in the art and are described in the literature, for example, Jarver et al., 2014, "A Chemical View of Oligonucleotides for Exon Skipping and Related Drug Applications", Nucleic Acid Therapeutics 24(1):37-47, which is incorporated herein by reference for this purpose.

[0408] In some embodiments, each monomer of the ASO is modified in the same manner, for example, each bond of the main chain of the ASO comprises a phosphorothioate bond, or each ribose sugar moiety comprises a 2'O-methyl modification. Such modifications present on each monomer component of the monomer components of the ASO are referred to as "unified modifications". In some instances, a combination of different modifications may be desired, for example, the ASO may comprise a combination of a phosphorodiamidate bond and a sugar moiety comprising a morpholine ring (morpholino). The combination of different modifications of the ASO is referred to as "mixed modification" or "mixed chemical substances".

[0409] In some embodiments, the ASO comprises one or more main chain modifications. In some embodiments, the ASO comprises one or more sugar moiety modifications. In some embodiments, the ASO comprises one or more main chain modifications and one or more sugar moiety modifications. In some embodiments, the ASO comprises 2'MOE modification and a phosphorothioate backbone. In some embodiments, the ASO comprises phosphorodiamidate morpholino (PMO). In some embodiments, the ASO comprises peptide nucleic acid (PNA). Any of the ASOs described herein or any component of the ASO (e.g., core base, sugar moiety, main chain) can be modified to achieve the desired properties or activity of the ASO or reduce the undesirable properties or activity of the ASO. For example, one or more components of the ASO or any ASO can be modified to enhance the binding affinity to the target sequence on the precursor mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (i.e., RNase H); improve the uptake of the ASO into the cell and / or the nucleus of the cell; change the pharmacokinetics or pharmacodynamics of the ASO; and / or regulate the half-life of the ASO.

[0410] In some embodiments, the ASO comprises a nucleotide modified with 2'-O-(2-methoxyethyl) (MOE) phosphorothioate. ASOs comprising such nucleotides are particularly well-suited for the methods disclosed herein; oligomers with such modifications have been shown to have significantly enhanced resistance to nuclease degradation and increased bioavailability, making them suitable for oral delivery, for example, in some embodiments described herein. See, for example, Geary et al., J Pharmacol Exp Ther. 2001; 296(3):890-7; Geary et al., J Pharmacol Exp Ther. 2001; 296(3):898-904.

[0411] Methods for synthesizing ASOs are known to those skilled in the art. Alternatively or additionally, ASOs can be obtained from commercial sources.

[0412] Unless otherwise indicated, the left-hand end of a single-stranded nucleic acid (e.g., pre-mRNA transcript, oligonucleotide, ASO, etc.) sequence is the 5' end, and the left-hand direction of a single-stranded or double-stranded nucleic acid sequence is referred to as the 5' direction. Similarly, the right-hand end or direction of a nucleic acid sequence (single-stranded or double-stranded) is the 3' end or direction. Typically, a region or sequence 5' from a reference point in a nucleic acid is referred to as "upstream," and a region or sequence 3' from a reference point in a nucleic acid is referred to as "downstream." Typically, the 5' direction or end of an mRNA is the position where the start or start codon is located, and the 3' end or direction is the position where the stop codon is located. In some aspects, the nucleotides upstream of the reference point in a nucleic acid can be specified by a negative number, while the nucleotides downstream of the reference point can be specified by a positive number. For example, a reference point (e.g., an exon-exon junction in an mRNA) can be designated as the "zero" position, and the nucleotide immediately adjacent to and upstream of the reference point is designated as "minus one," e.g., "-1," while the nucleotide immediately adjacent to and downstream of the reference point is designated as "plus one," e.g., "+1."

[0413] In some embodiments, the ASO is complementary to (and binds to) a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located downstream (in the 3' direction) of the 5' splice site (or 3' end of the ASCE) in the pre-mRNA containing the PKD1, ABCA4, FUS, CEL, or NSD1 ASCE (e.g., a direction indicated by a positive number relative to the 5' splice site). In some embodiments, the ASO is complementary to a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located within a region of about +1 to about +500 relative to the 5' splice site (or 3' end) of the ASCE. In some embodiments, the ASO may be complementary to a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located within a region of nucleotides +6 to +40,000 relative to the 5' splice site (or 3' end) of the ASCE.In some aspects, the ASO is located at about +1 to about +40,000, about +1 to about +30,000, about +1 to about +20,000, about +1 to about +15,000, about +1 to about +10,000, about +1 to about +5,000, about +1 to about +4,000, about +1 to about +3,000, about +1 to about +2,000, about +1 to about +1,000, about +1 to about +500, about +1 to about +490, about +1 to about +480, about +1 to about +470, about +1 to about +460, about +1 to about +450, about +1 to about +440, about +1 to about +430, about +1 to about +420, about +1 to about +410, about +1 to about +400, about +1 to about +390, about +1 to about +380, about +1 to about +370, about +1 to about +360, about +1 to about +350, about +1 to about +3 40, about +1 to about +330, about +1 to about +320, about +1 to about +310, about +1 to about +300, about +1 to about +290, about +1 to about +280, about +1 to about +270, about +1 to about +260, about +1 to about +250, about +1 to about +240, about +1 to about +230, about +1 to about +220, about +1 to about +210, about +1 to about +200, about +1 to about +190, about +1 to about +180 In some aspects, the ASO is complementary to a targeting moiety located within a region of about +1 to about +170, about +1 to about +160, about +1 to about +150, about +1 to about +140, about +1 to about +130, about +1 to about +120, about +1 to about +110, about +1 to about +100, about +1 to about +90, about +1 to about +80, about +1 to about +70, about +1 to about +60, about +1 to about +50, about +1 to about +40, about +1 to about +30, or about +1 to about +20 relative to the 5' splice site (or 3' end) of the ASCE.

[0414] In some embodiments, the ASO is complementary to (and binds to) a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located upstream (in the 5' direction) of the 5' splice site (or 3' end) of the ASCE in the pre-mRNA containing the PKD1, ABCA4, FUS, CEL, or NSD1 ASCE (e.g., a direction indicated by a negative number relative to the 5' splice site). In some embodiments, the ASO is complementary to a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located within a region of about -4 to about -270 relative to the 5' splice site (or 3' end) of the ASCE. In some embodiments, the ASO may be complementary to a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located within a region of nucleotides -1 to -40,000 relative to the 5' splice site (or 3' end) of the ASCE.In some aspects, the ASO is located at about -1 to about -40,000, about -1 to about -30,000, about -1 to about -20,000, about -1 to about -15,000, about -1 to about -10,000, about -1 to about -5,000, about -1 to about -4,000, about -1 to about -3,000, about -1 to about -2,000, about -1 to about -1,000, about -1 to about -500, about -1 to about -490, about -1 to about -480, about -1 to about -470, about -1 to about -460, about -1 to about -450, about -1 to about -440, about -1 to about -430, about -1 to about -420, about -1 to about -410, about -1 to about -400, about -1 to about -390, about -1 to about -380, about -1 to about -370, about -1 to about -360, about -1 to about -350, about -1 to about -3 40, about -1 to about -330, about -1 to about -320, about -1 to about -310, about -1 to about -300, about -1 to about -290, about -1 to about -280, about -1 to about -270, about -1 to about -260, about -1 to about -250, about -1 to about -240, about -1 to about -230, about -1 to about -220, about -1 to about -210, about -1 to about -200, about -1 to about -190, about -1 to about -180 , about -1 to about -170, about -1 to about -160, about -1 to about -150, about -1 to about -140, about -1 to about -130, about -1 to about -120, about -1 to about -110, about -1 to about -100, about -1 to about -90, about -1 to about -80, about -1 to about -70, about -1 to about -60, about -1 to about -50, about -1 to about -40, about -1 to about -30, or about -1 to about -20.

[0415] In some embodiments, the ASO is complementary to a targeting region of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located upstream (in the 5' direction) (e.g., in the direction specified by negative numbers) of the 3' splice site (or 5' end) of the ASCE in the pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE. In some embodiments, the ASO is complementary to a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located within a region of about -1 to about -500 relative to the 3' splice site (or 5' end) of the ASCE. In some embodiments, the ASO is complementary to a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located within a region of -1 to -40,000 relative to the 3' splice site of the ASCE. In some aspects, the ASO is located at about -1 to about -40,000, about -1 to about -30,000, about -1 to about -20,000, about -1 to about -15,000, about -1 to about -10,000, about -1 to about -5,000, about -1 to about -4,000, about -1 to about -3,000, about -1 to about -2,000, about -1 to about -1,000, about -1 to about -500, about -1 to about -500, about -1 to about -600, about -1 to about -700, about -1 to about -800, about -1 to about -900, about -1 to about -1000, about -1 to about -1500, about -10,000, about -1 to about -10,000, about -1 to about -500, about -1 to about -4,000, about -1 to about -3,000, about -1 to about -2,000, about -1 to about -1,000, about -1 to about -500, about -1 to about about -1 to about -490, about -1 to about -480, about -1 to about -470, about -1 to about -460, about -1 to about -450, about -1 to about -440, about -1 to about -430, about -1 to about -420, about -1 to about -410, about -1 to about -400, about -1 to about -390, about -1 to about -380, about -1 to about -370, about -1 to about -360, about -1 to about -350, about -1 to about -340, about -1 to about -330, about -1 to about -320, about -1 to about -310, about -1 to about -300, about -1 to about -290, about -1 to about -280, about -1 to about -270, about -1 to about -260, about -1 to about -250, about -1 to about -240, about -1 to about -230, about -1 to about -220, about -1 to about -210, about -1 to about -200, about -1 to about -190, about -1 to about -180, about The targeting portion is complementary to a region from about -1 to about -170, from about -1 to about -160, from about -1 to about -150, from about -1 to about -140, from about -1 to about -130, from about -1 to about -120, from about -1 to about -110, from about -1 to about -100, from about -1 to about -90, from about -1 to about -80, from about -1 to about -70, from about -1 to about -60, from about -1 to about -50, from about -1 to about -40, from about -1 to about -30, or from about -1 to about -20.In some aspects, the ASO is complementary to a targeting moiety located within a region from about -1 to about -100, about -100 to about -200, about -200 to about -300, about -300 to about -400, or about -400 to about -500 relative to the 3' splice site of the ASCE.

[0416] In some embodiments, the ASO is complementary to a targeting region of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located downstream (in the 3' direction) of the 3' splice site (5' end) of the ASCE in the pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE (e.g., in the direction specified by a positive number). In some embodiments, the ASO is complementary to a targeting portion of a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE that is located within a region of about +1 to about +40,000 relative to the 3' splice site of the ASCE. In some aspects, the ASO is located at about +1 to about +40,000, about +1 to about +30,000, about +1 to about +20,000, about +1 to about +15,000, about +1 to about +10,000, about +1 to about +5,000, about +1 to about +4,000, about +1 to about +3,000, about +1 to about +2,000, about +1 to about +1,000, about +1 to about +500, about +1 to about +600, about +1 to about +700, about +1 to about +800, about +1 to about +900, about +1 to about +1100, about +1 to about +1200, about +1 to about +1300, about +1 to about +1400, about +1 to about +1500, about +1 to about +1600, about +1 to about +1700, about +1 to about +1800, about +1 to about +1900, about +1 to about +2100 +1 to about +490, about +1 to about +480, about +1 to about +470, about +1 to about +460, about +1 to about +450, about +1 to about +440, about +1 to about +430, about +1 to about +420, about +1 to about +410, about +1 to about +400, about +1 to about +390, about +1 to about +380, about +1 to about +370, about +1 to about +360, about +1 to about +350, about +1 to about +340, about +1 to about +330, about +1 to about +320, about +1 to about +310, about +1 to about +300, about +1 to about +290, about +1 to about +280, about +1 to about +270, about +1 to about +260, about +1 to about +250, about +1 to about +240, about +1 to about +230, about +1 to about +220, about +1 to about +210, about +1 to about +200, about +1 to about +190, about +1 to about +180, about +1 to about +170 +1 to about +10, about +1 to about +110, about +1 to about +120, about +1 to about +130, about +1 to about +140, about +1 to about +150, about +1 to about +160, about +1 to about +170, about +1 to about +180, about +1 to about +190, about +1 to about +20, about +1 to about +210, about +1 to about +220, about +1 to about +230, about +1 to about +240, about +1 to about +250, about +1 to about +260, about +1 to about +270, about +1 to about +280, about +1 to about +30, about +1 to about +310, or about +1 to about +320, or about +1 to about +330.

[0417] In some embodiments, the targeting portion of the pre-mRNA containing the PKD1, ABCA4, FUS, CEL, or NSD1 ASCE is located within the region from +100 to the 5' splice site (3' end) relative to the ASCE to -100 to the 3' splice site (5' end) relative to the ASCE. In some embodiments, the targeting portion of the pre-mRNA containing the PKD1, ABCA4, FUS, CEL, or NSD1 ASCE is located within the ASCE. In some embodiments, the targeting portion of the pre-mRNA containing the PKD1, ABCA4, FUS, CEL, or NSD1 ASCE comprises the ASCE and intron boundaries. In some embodiments, the targeting portion of the pre-mRNA containing the PKD1, ABCA4, FUS, CEL, or NSD1 ASCE does not comprise the ASCE and intron boundaries.

[0418] ASOs can have any length suitable for specific binding and effective reduction of splicing. In some embodiments, the ASO consists of 8 to 50 nucleobases. For example, the length of the ASO can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45 or 50 nucleobases. In some embodiments, the ASO consists of greater than 50 nucleobases. In some embodiments, the ASO is 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases bases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 13 to 50 nucleobases, 13 to 40 nucleobases, 13 to 35 nucleobases, 13 to 30 nucleobases, 13 to 25 nucleobases, 13 to 20 nucleobases, 14 to 50 nucleobases, 14 to 40 nucleobases, 14 to 35 nucleobases, 14 to 30 nucleobases, 14 to 25 nucleobases, 14 to In some embodiments, the ASO is 18 nucleotides in length. In some embodiments, the ASO is 15 nucleotides in length. In some embodiments, the ASO is 25 nucleotides in length.

[0419] In some embodiments, two or more ASOs are used that have different chemistries but are complementary to the same targeting portion of a pre-mRNA containing an ASCE. In some embodiments, two or more ASOs are used that are complementary to different targeting portions of a pre-mRNA containing an ASCE.

[0420] In certain embodiments, the antisense oligonucleotide of the present disclosure is chemically connected to one or more active or cellular uptake enhancing oligonucleotides or conjugates, for example, targeting moieties or other conjugates. Such moieties include but are not limited to lipid moieties, for example, as cholesterol moieties, cholesteryl moieties, aliphatic chains, for example, dodecanediol or undecyl residues, polyamines or polyethylene glycol chains or adamantane acetic acid. Oligonucleotides and preparation methods comprising lipophilic moieties have been described in published documents. In an embodiment, antisense oligonucleotides are conjugated to moieties, and the moieties include but are not limited to abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, for example, N-acetylgalactosamine (GalNAc), N-Ac-glucosamine (GluNAc) or mannose (for example, mannose-6-phosphate), lipids or polyhydrocarbon compounds. Conjugates can be connected to one or more nucleotides in any nucleotide comprising antisense oligonucleotides, as understood in the art and described in the literature, for example, using joints at any position in several positions on sugar, base or phosphate groups. Joints can include divalent or trivalent branched joints. In an embodiment, the conjugate is attached to the 3' end of an antisense oligonucleotide.Methods of preparing oligonucleotide conjugates are described, for example, in U.S. Patent No. 8,450,467, "Carbohydrate conjugates as delivery agents for oligonucleotides," which is incorporated herein by reference.

[0421] In some embodiments, the nucleic acid to be targeted by the ASO is a precursor mRNA containing PKD1, ABCA4, FUS, CEL, or NSD1 ASCE expressed in a cell, such as a eukaryotic cell. In some embodiments, the term "cell" may refer to a cell population. In some embodiments, the cell is in a subject. In some embodiments, the cell is isolated from a subject. In some embodiments, the cell is ex vivo. In some embodiments, the cell is a cell or cell line associated with a condition or disease. In some embodiments, the cell is in vitro (e.g., in cell culture).

[0422] Pharmaceutical composition

[0423] The medicament (for example, antisense oligonucleotide) comprising described compositions and the pharmaceutical composition or preparation in any method for described method can be prepared according to the conventional techniques described in the well-known and disclosed literature of pharmaceutical industry.In an embodiment, the pharmaceutical composition or preparation for treating experimenter comprise any antisense oligomer as described herein or its pharmaceutically acceptable salt, solvate, hydrate or ester thereof of effective dose.The pharmaceutical preparation comprising antisense oligomer can further comprise pharmaceutically acceptable excipient, diluent or carrier.

[0424] Pharmaceutically acceptable salts are suitable for contact with the tissues of humans and lower animals without excessive toxicity, irritation, allergic response, etc., and are commensurate with a reasonable benefit / risk ratio. (See, for example, SM Berge et al., J. Pharmaceutical Sciences, 66: 1-19 (1977), which is incorporated herein by reference for this purpose). Salts can be prepared in situ during the final separation and purification of the compound, or prepared separately by reacting the free base form with a suitable organic acid. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts formed by amino groups with the following acids or by using other methods described in the literature (such as ion exchange): inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid; or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, gluconoheptate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Where appropriate, additional pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates.

[0425] In certain embodiments, the composition is formulated into any of many possible dosage forms, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories and enemas. In an embodiment, the composition is formulated into a suspension in an aqueous, non-aqueous or mixed culture medium. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension may also contain a stabilizer. In an embodiment, pharmaceutical preparations or compositions of the present disclosure include, but are not limited to, solutions, emulsions, microemulsions, foams or preparations containing liposomes (e.g., cationic or non-cationic liposomes).

[0426] Pharmaceutical compositions or formulations as described herein may include one or more suitable and well-known or described in the published literature penetration enhancers, carriers, excipients or other active ingredients or inactive ingredients by those skilled in the art. In an embodiment, liposomes also include sterically stabilized liposomes, for example, liposomes comprising one or more specialized lipids. These specialized lipids produce liposomes with enhanced circulation life. In an embodiment, sterically stabilized liposomes comprise one or more glycolipids or are derived with one or more hydrophilic polymers (such as polyethylene glycol (PEG) moieties). In certain embodiments, surfactants are included in pharmaceutical formulations or compositions. The use of surfactants in medicines, formulations and emulsions is well known in the art. In an embodiment, the present disclosure uses penetration enhancers to achieve the effective delivery of antisense oligonucleotides, for example, to help diffuse through cell membranes and / or enhance the permeability of lipophilic drugs. In certain embodiments, the penetration enhancer is a surfactant, fatty acid, bile salt, chelating agent or non-chelating non-surfactant.

[0427] In some embodiments, the pharmaceutical formulation comprises a plurality of antisense oligonucleotides.In some embodiments, the antisense oligonucleotides are administered in combination with another drug or therapeutic agent.

[0428] Combination therapy

[0429] In some embodiments, the ASO disclosed in this disclosure can be used in combination with one or more additional therapeutic agents. In some embodiments, one or more additional therapeutic agents may include small molecules. For example, one or more additional therapeutic agents may include the small molecules described in WO2016128343A1, WO2017053982A1, WO2016196386A1, WO201428459A1, WO201524876A2, WO2013119916A2, and WO2014209841A2, which are incorporated herein by reference in their entirety.

[0430] Treatment of subjects

[0431] Any of the compositions provided herein can be administered to an individual. "Individual" can be used interchangeably with "subject" or "patient." An individual can be a mammal, such as a human, or an animal, such as a non-human primate, rodent, rabbit, rat, mouse, horse, donkey, goat, cat, dog, cow, pig, or sheep. In embodiments, the individual is a human. In embodiments, the individual is a fetus, embryo, or child. In other embodiments, the individual can be another eukaryotic organism, such as a plant. In some embodiments, the compositions provided herein are administered ex vivo to cells.

[0432] In some embodiments, the compositions provided herein are applied to an individual as a method for treating a disease or condition. In some embodiments, the individual suffers from a genetic disease, such as any disease in the diseases described herein. In some embodiments, the individual has the risk of developing a disease, such as any disease in the diseases described herein. In some embodiments, the individual has the risk of developing an increase in the disease or condition caused by insufficient amounts of protein or insufficient protein activity. If the individual suffers from an increase in the risk of a disease or condition caused by insufficient amounts of protein or insufficient protein activity, the method relates to preventive or prophylactic treatment. For example, an individual may be at an increased risk of suffering from such a disease or condition due to a family history of the disease. Typically, individuals at an increased risk of suffering from such a disease or condition benefit from prophylactic treatment (e.g., by preventing or delaying the onset or progression of a disease or condition). In an embodiment, the fetus is treated in the uterus, for example, by directly or indirectly (e.g., via the mother) applying the ASO compositions to the fetus.

[0433] The appropriate route for administering the ASOs of the present disclosure may vary depending on the cell type to which the ASO is desired to be delivered. Multiple tissues and organs are affected by Dravet syndrome, with the brain being the most severely affected tissue. The ASOs of the present disclosure may be administered to a patient parenterally, for example, by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, or intravenous injection.

[0434] In an embodiment, antisense oligonucleotides are administered together with one or more medicaments that can promote theme antisense oligonucleotides to penetrate through the blood-brain barrier by any method known in the art. For example, medicaments are delivered by applying adenovirus vectors to the motor neurons in muscle tissue and are described in U.S. Patent No. 6,632,427, "Adenovirus-vector-mediated gene transfer into medullary motor neurons" which is incorporated herein by reference. Carriers are delivered directly to the brain, such as striatum, thalamus, hippocampus or substantia nigra, which are described in, for example, U.S. Patent No. 6,756,523, "Adenovirus vectors for the transfer of foreign genes into cells of the central nervous systemparticularly in brain" which is incorporated herein by reference.

[0435] In some embodiments, antisense oligonucleotides are connected or conjugated to a pharmaceutical agent that provides a desired drug or pharmacodynamic property. In an embodiment, antisense oligonucleotides are coupled to a substance known in the art that promotes, for example, antibody penetration or transport through the blood-brain barrier for transferrin receptors. In an embodiment, antisense oligonucleotides are connected to a viral vector that, for example, makes antisense compounds more effective or increases transport through the blood-brain barrier. In an embodiment, permeability of the blood-brain barrier is disrupted by the infusion of the following substances: sugar, for example, erythritol, xylitol, D (+) galactose, D (+) lactose, D (+) xylose, sweet alcohol, inositol, L (-) fructose, D (-) mannitol, D (+) glucose, D (+) arabinose, D (-) arabinose, cellobiose, D (+) maltose, D (+) raffinose, L (+) rhamnose, D (+) melibiose, D (-) riboflavin, d-(-) ... sugars, aconitol, D(+)arabinitol, L(-)arabinitol, D(+)fucose, L(-)fucose, D(-)lyxose, L(+)lyxose, and L(-)lyxose; or amino acids, for example, glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine. Methods and materials for enhancing blood-brain barrier penetration are described, for example, in U.S. Pat. No. 9,193,969, “Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types,” U.S. Pat. No. 4,866,042, “Method for the delivery of genetic material across the blood-brain barrier,” U.S. Pat. No. 6,294,520, “Material for passage through the blood-brain barrier,” and U.S. Pat. No. 6,936,589, “Parenteral delivery systems,” each of which is incorporated herein by reference.

[0436] In some embodiments, the ASOs of the present disclosure are conjugated to dopamine reuptake inhibitors (DRIs), selective serotonin reuptake inhibitors (SSRIs), norepinephrine reuptake inhibitors (NRIs), norepinephrine-dopamine reuptake inhibitors (NDRIs), and serotonin-norepinephrine-dopamine reuptake inhibitors (SNDRIs) using the methods described in, for example, U.S. Pat. No. 9,193,969, which is incorporated herein by reference.

[0437] In some embodiments, subjects treated using the methods and compositions are evaluated for improvement of a condition using any method known and described in the art.

[0438] Methods for Identifying Additional ASOs to Facilitate Inclusion of ASCE

[0439] Also within the scope of the present disclosure are methods for identifying or determining an ASO that promotes the incorporation of an ASCE into a processed mRNA processed from a pre-mRNA comprising an ASCE. Also within the scope of the present disclosure are methods for identifying or determining an ASO that promotes the incorporation of an ASCE into a pre-mRNA comprising a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE. Also within the scope of the present disclosure are methods for identifying or determining an ASO that promotes the incorporation of an ASCE into a processed mRNA processed from a pre-mRNA comprising an ASCE.

[0440] For example, a method can include identifying or determining an ASO that promotes incorporation of an ASCE into a pre-mRNA containing a PKD1, ABCA4, FUS, CEL, or NSD1 ASCE. ASOs that specifically hybridize to different nucleotides within a target region of the pre-mRNA can be screened to identify or determine ASOs that improve the rate and / or extent of splicing of the target intron. In some embodiments, the ASO can block or interfere with the binding site of a splicing repressor / silencer. Any method known in the art can be used to identify (determine) an ASO that produces a desired effect (e.g., exon incorporation, protein or functional RNA production) when hybridized to a target region of an exon. These methods can also be used to identify ASOs that promote exon incorporation of an excluded exon by binding to a targeted region in an intron flanking the excluded exon or in an exon that is not excluded. Examples of methods that can be used are provided below.

[0441] A round of screening, known as ASO "walking," can be performed using ASOs that have been designed to hybridize to a target region of a pre-mRNA. For example, the ASOs used in the ASO walk can be tiled every 5 nucleotides from approximately 100 nucleotides upstream of the 3' splice site flanking the ASCE (e.g., a portion of the sequence of an intron located upstream of the target / ASCE) to approximately 100 nucleotides downstream of the 3' splice site flanking the target / ASCE and / or from approximately 100 nucleotides upstream of the 5' splice site flanking the ASCE to approximately 100 nucleotides downstream of the 5' splice site flanking the target / ASCE (e.g., a portion of the sequence of an intron located downstream of the target / ASCE). For example, a first ASO of 15 nucleotides in length can be designed to specifically hybridize to nucleotides -6 to -20 relative to the 3' splice site flanking the target / ASCE. A second ASO can be designed to specifically hybridize to nucleotides -1 to -15 relative to the 3' splice site flanking the target / ASCE. ASO is designed to span the target region of pre-mRNA. In an embodiment, ASO can be tiled more tightly, for example, every 1, 2, 3 or 4 nucleotides. In addition, ASO can be tiled from 100 nucleotides downstream of the 5' splice site to 100 nucleotides upstream of the 3' splice site. In certain embodiments, ASO can be tiled from about 1000 or 500 nucleotides upstream of the 3' splice site to about 1000 or 500 nucleotides downstream of the 5' splice site. In certain embodiments, ASO can be tiled from about 1000 or 500 nucleotides upstream of the 3' splice site to about 1000 or 500 nucleotides downstream of the 3' splice site.

[0442] One or more ASOs or control ASOs (ASOs with scrambled sequences, i.e., sequences not expected to hybridize with the target region) are delivered, for example, by transfection, to a disease-related cell line expressing a target pre-mRNA (e.g., a pre-mRNA containing an ASCE as described herein). The exon incorporation effect of each of the ASOs can be assessed by any method known in the art, such as by reverse transcriptase (RT)-PCR using primers spanning the splice junction, as described in Example 3. An increase or presence of a longer RT-PCR product generated using primers spanning the region containing the ASCE (e.g., including the flanking introns of the ASCE) in the ASO-treated cells compared to the control ASO-treated cells indicates that splicing of the target ASCE has been reduced. In some embodiments, the ASOs described herein can be used to modulate exon incorporation efficiency, the ratio of unspliced ​​to spliced ​​pre-mRNA, the rate of splicing, or the extent of splicing. The amount of protein or functional RNA encoded by the target pre-mRNA can also be assessed to determine whether each ASO achieves the desired effect (e.g., enhanced production of a functional protein). Any method known in the art for assessing and / or quantifying protein production can be used, such as Western blot, Jess blot, flow cytometry, immunofluorescence microscopy, and ELISA.

[0443] A second round of screening, called ASO "microwalking," can be performed using ASOs that have been designed to hybridize to a target region of the pre-mRNA. The ASOs used in ASO microwalking are tiled every 1 nucleotide to further refine the nucleotide sequence of the pre-mRNA that, when hybridized to the ASO, results in exon inclusion (or reduced splicing of the ASCE).

[0444] The region defined by ASOs that reduced splicing of the target exon was explored in more detail by means of ASO "micro-walking" involving ASOs spaced in 1-nt steps, as well as longer ASOs of typically 18-25 nt.

[0445] As described above for ASO walking, ASO microwalking is performed by delivering one or more ASOs or control ASOs (ASOs with scrambled sequences, i.e., sequences that are not expected to hybridize with the target region), for example, by transfection, into a disease-associated cell line expressing the target precursor mRNA. As described herein, the splicing-inducing effect of each of the ASOs can be assessed by any method known in the art, such as by reverse transcriptase (RT)-PCR using primers that span the ASCE (see, e.g., Example 5). An increase or presence of longer RT-PCR products generated using primers that span the ASCE in ASO-treated cells compared to control ASO-treated cells indicates that exon incorporation has been enhanced. In some embodiments, the ASOs described herein can be used to modulate exon incorporation efficiency, the ratio of unspliced ​​to spliced ​​precursor mRNA, the splicing rate, or the degree of splicing. The amount of protein or functional RNA encoded by the target precursor mRNA can also be assessed to determine whether each ASO achieves the desired effect (e.g., enhanced functional protein production). Any method known in the art for assessing and / or quantifying protein production can be used, such as Western blot, Jess blot, flow cytometry, immunofluorescence microscopy, and ELISA.

[0446] The ASO that produces exon inclusion and increased protein production when hybridized with the district of pre-mRNA can be tested in vivo using animal models, such as transgenic mouse models or humanized mouse disease models in which the full-length human gene has been knocked into. Suitable pathways for administering ASOs can vary according to the disease and / or cell type to which the ASO is delivered. ASOs can be administered, for example, by intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection or intravenous injection. After administration, the cells, tissues and / or organs of model animals can be assessed to determine the effect of ASO processing by, for example, evaluating montage (e.g., efficiency, rate, degree) and protein production by methods known in the art and described herein. Animal models can also be any phenotype or behavioral indication of disease or disease severity.

[0447] Also within the scope of the present disclosure is a method of identifying or validating ASCE in the presence of an NMD inhibitor, such as cycloheximide. An exemplary method is provided in Example 2.

[0448] Examples

[0449] The present disclosure will be described in more detail with reference to the following examples. However, it should be understood that the present disclosure is not limited to these examples in any way.

[0450] Example 1. Identification of NMD-induced exon incorporation events in transcripts by RNAseq using next-generation sequencing

[0451] Next-generation sequencing was used to perform whole-transcriptome shotgun sequencing to reveal a snapshot of transcripts produced by genes to identify ASCE incorporation events. To this end, polyA+ RNA from the nuclear and cytoplasmic fractions of human cells was isolated, and cDNA libraries were constructed using the Illumina TruSeq Stranded mRNA Library Preparation Kit. The libraries were paired-pair sequenced to generate 100-nucleotide reads that mapped to the human genome (GRCh38 / hg38 assembly).

[0452] Example 2. Confirmation of ASCE by cycloheximide treatment

[0453] RT-PCR analysis using RNA extracts from DMSO- or cycloheximide-treated human and mouse cells and primers in exons (e.g., a forward primer complementary to exon 7 and a reverse primer complementary to exon 9) confirmed the presence of bands corresponding to NMD-induced exon exclusion events. Cycloheximide treatment of cells to inhibit NMD may result in an increase in products corresponding to NMD-induced exon exclusion events in the cytoplasmic fraction. RT-PCR and quantification of the cassette exon of NSD1 RNA (exon 8: GRCh38 / hg38: chr5177238237:177238507) were performed. Densitometric analysis of the bands on the images of the RT-PCR products was performed to calculate the percentage of ASCE incorporation in the total transcript. Figure 2A -D depicts the confirmation of exemplary alternative splicing events of ASCE in the NSD1 gene by cycloheximide treatment in various human cells, and the confirmation of the presence of non-productive NSD1 mRNA transcripts in macaque brain regions and human cortex. Figure 2A Depicted is a schematic diagram in which peaks corresponding to RNA sequencing reads were identified in exon 8 of NSD1 (GRCh38 / hg38: chr5177238237:177238507). Figure 2B Depicted are gel images and graphs showing that cycloheximide treatment results in increased amounts of non-productive mature NSD1 mRNA transcripts (processed NSD1 mRNA containing a premature stop codon that makes the transcript a target for NMD) in various human cells, including astrocytes, Schwann cells, HEK293 cells, SH-SY-5Y (neuroblastoma cell line) cells, and SK-N-AS (neuroblastoma cell line) cells. Figure 2C Depicted are gel images and graphs showing the presence of non-productive mature NSD1 mRNA transcripts in various macaque brain regions including the cortex, brainstem, hippocampus, and cerebellum. Figure 2DDepicted are gel images and graphs showing the presence of non-productive mature NSD1 mRNA transcripts in human cortex.

[0454] Example 3. Confirmation of ASCE in mice by cycloheximide treatment

[0455] RT-PCR analysis using total RNA from mouse brain regions (cortex, deep structures, cerebellum, and brainstem) treated with DMSO or cycloheximide in vivo or ex vivo and primers in exons (e.g., a forward primer complementary to mouse exon 6 and a reverse primer complementary to mouse exon 8) confirmed the presence of bands corresponding to ASCE exclusion events ( Figures 3A-3D ). Figure 3A Depicted are images of gels showing that exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) in isolated cycloheximide-treated or DMSO-treated mouse brains results in the formation of processed mRNA containing a premature stop codon that targets the transcript for NMD. Figure 3B Describes the Figure 3A Densitometric analysis of bands from gel images, plot of NMD percentage (top) and fold change (bottom) of NMD events of non-productive NSD1 mRNA products relative to productive NSD1 mRNA products to calculate ASCE percentage. Figure 3B The fold change in the bottom panel was calculated as the fold change in the percentage of NMD between DMSO-treated and cycloheximide-treated samples, i.e., the percentage of NMD in the cycloheximide-treated samples divided by the corresponding percentage of NMD in the DMSO-treated samples for each indicated brain region. Figure 3C Depicted are gel images showing that in vivo in cycloheximide-treated mouse brain (treatment duration 3, 6, or 12 hours), exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) results in the formation of processed mRNA containing a premature stop codon that targets the transcript for NMD. Figure 3D Describes the Figure 3C Densitometric analysis of bands from gel images, plot of NMD percentage (left) and fold change (right) of NMD events for non-productive NSD1 mRNA products relative to productive NSD1 mRNA products to calculate ASCE percentage. Figure 3D The fold change in the right panel was calculated as the fold change in the percentage of NMD between saline-treated and cycloheximide-treated samples, i.e., the percentage of NMD in the cycloheximide-treated samples divided by the corresponding percentage of NMD in the saline-treated samples for each indicated brain region.

[0456] Figures 4A-4B Depicted is the confirmation of the inclusion or exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) in NSD1 mRNA products processed from NSD1 pre-mRNA in mouse brain by in vivo cycloheximide treatment. Figure 4A Depicted are images of a gel showing that in vivo in cycloheximide-treated mouse brain, exclusion of the ASCE of mouse NSD1 (mouse exon 7, corresponding to human exon 8) results in the formation of processed mRNA containing a premature stop codon that targets the transcript for NMD. Figure 4B Describes the Figure 4A Densitometric analysis of bands from gel images, plot of NMD percentage (left) and fold change (right) of NMD events of non-productive NSD1 mRNA products relative to productive NSD1 mRNA products to calculate ASCE percentage. Figure 4B The fold change in the right panel of was calculated as the fold change in the percentage of NMD between saline-treated and cycloheximide-treated samples, i.e., the percentage of NMD in the samples treated with 60 mg / kg or 120 mg / kg cycloheximide divided by the corresponding percentage of NMD in the saline-treated samples.

[0457] Example 4. ASCE zone ASO step

[0458] Using 2'-MOE ASOs and a PS backbone, ASO walking can be performed on ASCE region targeting sequences located upstream of the canonical 3' splice site, across the 3' splice site, in skipped exons (e.g., exon 8), across the 5' splice site, and downstream of the 5' splice site. ASOs can be designed to cover these regions by shifting 5 nucleotides at a time or by shifting any predetermined number of nucleotides at a time. In some embodiments, ASO walking can be performed on ASCE region targeting sequences that do not span the 3' splice site and / or do not span the 5' splice site. Figure 5 An exemplary ASO walk of an exemplary ASCE region is depicted. Figure 5 The shaded nucleotides in the figure correspond to exon skipping events, and arrows point to canonical splice sites.

[0459] Example 5. Evaluation of ASO migration in the ASCE region by RT-PCR

[0460] ASO walking sequence can be assessed by, for example, RT-PCR. PAGE can be used to visualize SYBR-safe stained RT-PCR products of mock-treated or ASO-treated cells targeting the ASCE region as described herein at a 20-μM concentration by gymnotic uptake in human / mouse cells. Products corresponding to exon exclusion and full-length can be quantified, and the percentage of NMD can be plotted. The full-length product can be normalized to an internal control.

[0461] In one experiment, HEK293 cells were transfected with an exemplary ASO according to some embodiments of the present disclosure at an 80-nM concentration for 24 hours. Figure 6A Shown is a graph summarizing changes in the levels of productive NSD1 mRNA during one ASO walk around a cassette exon (exon 8).

[0462] Figure 6B Shown is a graph summarizing changes in the levels of non-productive NSD1 mRNA during one ASO walk around a cassette exon (exon 8).

[0463] In another experiment, ASO microwalking was performed by nucleofecting SH-SY-5Y cells with an exemplary ASO according to some embodiments of the present disclosure at a concentration of 5 mM for 24 hours. Figure 7A Shown is a graph summarizing changes in the levels of productive NSD1 mRNA during one ASO walk around a cassette exon (exon 8). Figure 7B Shown is a graph summarizing changes in the levels of non-productive NSD1 mRNA during one ASO walk around a cassette exon (exon 8).

[0464] Example 6. ASO walking of the NSD1 ASCE region vector

[0465] ASO walking can be performed on ASCE region targeting sequences upstream of the canonical 3' splice site, across the 3' splice site, in skipped exons (e.g., exon 8), across the 5' splice site, and downstream of the 5' splice site to identify vectored ASOs that can prevent non-productive AS events (e.g., promote the incorporation of ASCE into processed mRNA). Systematic vectored ASO walking can be performed in 5-nt or 2-nt steps along the AS event of interest. These vectored ASOs can be expressed from a vector as modified U1 snRNA or U7 snRNA containing the ASO sequence as its targeting sequence. Figure 8 Systematic walking of vectored ASOs along AS events of NSD1 pre-mRNA is shown for vectored ASOs expressed as modified U7 snRNA. Figure 9A systematic vectored ASO walk along AS events in the NSD1 pre-mRNA is shown for vectored ASOs expressed as U1 snRNA. RT-PCR analysis from transfected cell lines can identify several vectored ASOs that result in a decrease in AS in NSD1 mRNA (e.g., promoting the incorporation of ASCE into processed mRNA) and an increase in productive mRNA. The observed increase in NSD1 productive mRNA can be confirmed by TaqMan qPCR. The fold change in AS can be plotted against the increase in productive mRNA (as measured by qPCR) to demonstrate that the vectored ASO is mechanistically effective.

[0466] Example 7. NSD1 non-productive mRNA levels in various cell lines

[0467] Alternative NMD inhibitors (i.e., non-ASOs) were tested in different cell lines to assess baseline differences in non-productive RNA levels across various cell types.

[0468] The cell lines used were SH-SY5Y, U-87MG, HEK293, and SK-N-AS. SH-SY5Y is a subclonal cell line derived from a neuroblastoma cell line that is a metastatic bone tumor. U-87MG is a cell line isolated from a malignant glioma that exhibits epithelial morphology. Human embryonic kidney (HEK) 293 is a cell line routinely used in basic biotechnology research. SK-N-AS cells are human neuroblastoma cells derived from neuroblastoma cells.

[0469] The NMD inhibitors tested included SMG1 nonsense-mediated mRNA decay-related PI3K-related kinase inhibitor (SMG1i) and cycloheximide (CHX). SMG1i is an inhibitor of the nonsense-mediated mRNA decay (NMD) regulator SMG1 and was originally designed to target multiple myeloma. SMG1i is used as an NMD inhibitor and is tested together with CHX, a standard mRNA translation inhibitor also known to inhibit NMD. The effects of NMD inhibitors were measured in different cell lines to determine whether the cell lines have different baseline levels of non-productive RNA, interpreted as equivalent to NMD events. Each of the four cell lines (SH-SY5Y, U-87MG, HEK293 and SK-N-AS) was incubated for three hours with a negative control (mock) and an NMD inhibitor (CHX at a final concentration of 50 μg / ml and SMG1i at a final concentration of 1 μM) to assess the baseline level of non-productive NSD1 mRNA ( Figure 10). After treatment with a water-only mimic control, CHX, or SMG1i, cells from each cell line were harvested and RNA was extracted and quantified. Treatment with SMG1i resulted in approximately 28% NSD1 non-productive mRNA (the percentage of non-productive NSD1 mRNA transcript levels in the total levels of all NSD1 mRNA transcripts) in U-87MG cells, approximately 19% NSD1 non-productive mRNA levels in SH-SY5Y cells, and < approximately 18% NSD1 non-productive mRNA levels in HEK293 and SK-N-AS cells. Treatment with CHX resulted in approximately 23% NSD1 non-productive mRNA in SH-SY5Y cells, approximately 15% NSD1 non-productive mRNA in U-87MG cells, and approximately 13% NSD1 non-productive mRNA in HEK293 and SK-N-AS cells. In cells treated with water alone (mimetic), the percentage of non-productive RNA remained low.

[0470] Example 8. Effects of Exemplary Chemically Modified ASOs

[0471] The effects of ASOs with modified backbone chemistries were determined in U-87MG cells. U-87MG cells were treated with (1) ASOs with phosphorodiamidate morpholino (PMO) modifications or (2) ASOs with 2'-O-methoxyethyl modifications and phosphorothioate backbones (2'MOE-PS). Figure 11A , Table 6).

[0472] NSD1 mRNA levels were assessed 24 h after nucleofection of U-87MG cells with 2 μM ASO with PMO modification or 1 μM ASO with 2′MOE-PS modification, and the fold changes of productive and non-productive mRNA transcripts compared to mock control were quantified ( Figure 11BAll results were normalized to the mock control. ASO 1749, containing a PMO, corresponds in sequence to ASO 1752, containing 2'MOE-PS. Both chemically modified ASO 1749 and ASO 1752 caused an increase in productive NSD1 mRNA by at least about 1.1-fold compared to the mock control. Compared to the water-only mimic control, ASO 1749 caused a decrease in non-productive NSD1 mRNA by about 0.4-fold, and ASO 1752 caused a decrease in non-productive NSD1 mRNA by about 0.3-fold. ASO 1750, containing a PMO, corresponds in sequence to ASO 1754, containing 2'MOE-PS. Compared to the mock control, ASO 1750, containing a PMO, caused an increase in productive NSD1 mRNA by at least about 1.2-fold, and a decrease in non-productive NSD1 mRNA by about 0.3-fold. Compared to the mock control, ASO 1754, containing a 2'MOE-PS, caused an increase in productive NSD1 mRNA by at least about 1.1-fold and a decrease in non-productive NSD1 mRNA by about 0.2-fold. ASO 1751, containing a PMO, corresponds in sequence to ASO 1755, containing a 2'MOE-PS. Compared to the mock control, ASO 1751, containing a PMO, caused an increase in productive NSD1 mRNA by at least 1.2-fold and a decrease in non-productive NSD1 mRNA by about 0.3-fold. ASO 1755, containing a 2'MOE-PS, did not cause a change in productive NSD1 mRNA, but decreased non-productive NSD1 mRNA by about 0.3-fold compared to the mock control. ASO 1753, containing a 2'MOE-PS, caused an increase in productive NSD1 mRNA by at least about 1.2-fold and a decrease in non-productive NSD1 mRNA by about 0.3-fold compared to the mock control. Typically, when cells were treated with 2 μM ASO with a PMO modification or 1 μM ASO with a 2'MOE-PS modification, productive NSD1 mRNA levels were increased and non-productive NSD1 mRNA was decreased relative to the mock control.

[0473] NSD1 protein levels were assessed 72 hours after nucleofection of U-87MG cells with 2 μM ASO with PMO modification or 1 μM ASO with 2'MOE-PS modification and compared to mock control ( Figure 11CAll results were normalized to the mock control. ASO 1752, containing 2'MOE-PS, increased NSD1 protein by at least about 1.3-fold compared to the mock control. ASO 1750, containing PMO, increased NSD1 protein by at least about 1.1-fold compared to the water-only mock control. ASO 1754, containing 2'MOE-PS, increased NSD1 protein by at least about 1.2-fold compared to the mock control. ASO 1751, containing PMO, increased NSD1 protein by at least about 1.2-fold compared to the mock control. ASO 1755, containing 2'MOE-PS, increased NSD1 protein by at least about 1.1-fold compared to the mock control. ASO 1753, containing 2'MOE-PS, increased NSD1 protein by at least about 1.2-fold compared to the mock control. Typically, when cells were treated with 2 μM ASOs with PMO modifications or 1 μM ASOs with 2'MOE-PS modifications, NSD1 protein levels increased relative to mock controls. Thus, the effects of MOE-PS ASO hits translate to (i.e., behave similarly to) ASOs with alternative backbones, such as those modified with PMOs.

[0474] Table 6. Exemplary ASOs with modified backbone chemistries

[0475] ASO name Chemical substances sequence ASO 1749 PMO TTCCTCTAATCATATCTG ASO 1750 PMO TTCCTCTAATCATATCTGCT ASO 1751 PMO GCTTCCTCTAATCATATCTG ASO 1752 2'MOE PS TTCCTCTAATCATATCTG ASO 1753 2'MOE PS TTCCTCTAATCATATCTGC ASO 1754 2'MOE PS TTCCTCTAATCATATCTGCT ASO 1755 2'MOE PS GCTTCCTCTAATCATATCTG

[0476] Example 9. Upregulation of NSD1 protein by exemplary ASOs results in a global increase in H3K36me2 levels

[0477] H3K36me2 is an epigenetic modification on histone H3, and NSD1 is a histone methyltransferase that can mediate the dimethylation of histone H3 at residue K36 (H3K36me2). NSD1-mediated H3K36me2 can contribute to the recruitment of DNA methyltransferases and the maintenance of DNA methylation at intergenic regions. Therefore, the level of H3K36me2 was examined to determine whether the upregulation of NSD1 protein caused by ASO would promote the increase of H3K36me2 levels in U-87MG cells. All results in this example contain data extracted from 2-3 independent experiments, and all results for each assay are normalized to the water-only control, mean ± SEM.

[0478] ASOs were evaluated in U-87MG cells to assess their efficacy in increasing NSD1 protein expression and H3K36me2 levels. U-87MG cells were nucleofected with 1 μM of one of four exemplary ASOs (ASO 214, ASO 210, ASO 211, or ASO 215) and harvested 72 hours after nucleofection. NSD1 protein levels were measured by immunocapillary electrophoresis (JESS) for each of the four exemplary ASOs and compared to a water-only control ( Figure 12A When U-87MG cells were treated with ASO 210, ASO 211, or ASO 215, NSD1 protein levels were higher than those in the water-only control, whereas when U-87MG cells were treated with ASO 214, NSD1 protein levels were slightly lower than those in the water-only control. Treatment with ASO 210 increased NSD1 protein levels by approximately 1.25-fold. Treatment with ASO 211 increased NSD1 protein levels by approximately 1.3-fold. Treatment with ASO 215 increased NSD1 protein levels by approximately 1.15-fold. Treatment with ASO 214 decreased NSD1 protein levels to approximately 0.96-fold compared to the water-only control.

[0479] If through As measured by the assay, H3K36me2 levels were elevated in cells after treatment with all four ASOs ( Figure 12B ). In cells treated with ASO 214, H3K36me2 levels were approximately 1.41-fold higher. H3K36me2 levels in cells treated with ASO 210 were approximately 1.39-fold higher than in cells treated with water alone, H3K36me2 levels in cells treated with ASO 211 were approximately 1.38-fold higher than in cells treated with water alone, and H3K36me2 levels in cells treated with ASO 215 were approximately 1.35-fold higher than in cells treated with water alone. Taken together, all four ASOs tested were found to increase NSD1 protein levels in U-87MG cells and elevate cellular H3K36me2 levels.

[0480] Example 10. ASO 211 causes a dose-dependent increase in global H3K36me2

[0481] ASO 211 was further evaluated to determine whether dose variation would affect NSD1 protein expression and H3K36me2 levels in U-87MG cells.

[0482] U-87MG cells were nucleofected with one of four doses (0.25 μM, 0.5 μM, 1.0 μM, or 2.0 μM) of the hit ASO (ASO 211) or a water-only control. Cells were harvested 72 hours after nucleofection and their NSD1 protein, H3K36me2, and total histone 3 (H3) levels were quantified. All results in this example contain data extracted from 2-3 independent experiments, and all results for each assay are normalized to the water-only control, mean ± SEM; one-way ANOVA; *pval < 0.05, ***pval < 0.01; ****pval < 0.001.

[0483] NSD1 protein levels were measured by immunocapillary electrophoresis (JESS). At all tested concentrations of ASO 211, NSD1 protein levels were higher than those of the water-only control ( Figure 13A ). Specifically, relative to the water-only control, a 0.25-μM concentration of ASO 211 caused an approximately 1.1-fold increase in NSD1 protein levels, 0.5 μM caused an approximately 1.2-fold increase, 1.0 μM caused an approximately 1.4-fold increase, and 2.0 μM caused an approximately 1.1-fold increase. Relative to the remaining three concentrations of ASO, treatment of U-87 cells with 1.0 μM of ASO 211 produced the highest fold increase in NSD1 protein (approximately 1.4-fold). Relative to the three other concentrations of ASO, treatment of U-87 cells with 0.5 μM of ASO 211 produced the second highest fold increase in NSD1 protein (approximately 1.2-fold). Relative to the other intermediate concentrations of ASO tested, treatment of U-87 cells with the highest or lowest concentrations (0.25 μM and 2.0 μM) of ASO 211 produced the smallest fold increase in NSD1 protein (approximately 1.1-fold).

[0484] After treatment with all tested concentrations of ASO 211, the The assay showed that the level of H3K36me2 in cells increased ( Figure 13B Compared to cells treated with water alone, H3K36me2 levels increased approximately 1.3-fold in cells treated with 1.0 μM ASO 211. When cells were treated with either 0.25 μM or 0.5 μM ASO 211, H3K36me2 levels were approximately 1.1-fold higher than in cells treated with water alone. When cells were treated with 2.0 μM ASO 211, H3K36me2 levels were approximately 1.2-fold higher than in cells treated with water alone. Lower ASO concentrations generally caused smaller fold changes in cellular H3K36me2 levels.

[0485] To exclude the possibility that the observed effects on NSD1 protein expression and H3K36me2 levels were due to changes in cellular levels of histone H3, we also measured The assay measured total H3 levels ( Figure 13C ). It was found that histone H3 levels remained roughly the same across all experimental conditions, regardless of whether water or any concentration of ASO 211 was used. Therefore, the regulation of NSD1 protein expression and H3K36me2 levels by ASO 211 is likely not due to changes in total histone H3 levels, but rather to the presence of the ASO itself and the experimental concentrations tested. In summary, ASO 211 was found to increase global H3K36me2 levels in a dose-dependent manner.

[0486] Although preferred embodiments of the present disclosure have been shown and described herein, it should be apparent to those skilled in the art that such embodiments are provided by way of example only. Many variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure may be adopted in practicing the present disclosure. The appended claims are intended to define the scope of the present disclosure and thus cover methods and structures within the scope of these claims and their equivalents.

Claims

1. A method for modulating expression of a target protein in a cell, the cell comprising a pre-mRNA transcribed from a target gene and encoding the target protein, the pre-mRNA comprising an alternatively spliced ​​coding exon (ASCE), wherein the alternatively processed mRNA produced by splicing out the ASCE during processing of the pre-mRNA undergoes nonsense-mediated RNA decay, the method comprising contacting the cell with a therapeutic agent or a vector encoding the therapeutic agent, wherein the therapeutic agent promotes incorporation of the ASCE during the processing of the pre-mRNA, thereby increasing the level of processed mRNA processed from the pre-mRNA and comprising the ASCE.

2. A method of treating a subject in need thereof or reducing the likelihood of developing a disease or condition by modulating expression of a target protein in a cell of the subject, the method comprising: contacting the cell of the subject with a therapeutic agent or a vector encoding the therapeutic agent, wherein the cell comprises a pre-mRNA transcribed from a target gene and encoding the target protein, the pre-mRNA comprising an alternatively spliced ​​coding exon (ASCE), wherein the alternatively processed mRNA produced by splicing out the ASCE during processing of the pre-mRNA undergoes nonsense-mediated RNA decay, wherein the therapeutic agent promotes incorporation of the ASCE during the processing of the pre-mRNA, thereby increasing the level of processed mRNA processed from the pre-mRNA and comprising the ASCE.

3. The method of claim 1 or 2, wherein the expression of the target protein is increased in the cell. 4 . The method according to claim 1 , wherein the target gene is selected from the group consisting of PKD1, ABCA4, FUS, CEL and NSD1.

5. The method according to any one of claims 1 to 4, wherein the target protein is selected from the group consisting of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA-binding protein, carboxyl ester lipase, and nuclear receptor binding SET domain protein 1.

6. The method according to any one of claims 1 to 5, wherein the therapeutic agent (a) binding to a targeting moiety of the mRNA encoding the target protein; (b) regulating the binding of a factor involved in the splicing of said ASCE; or (c) A combination of (a) and (b).

7. The method of claim 6, wherein the therapeutic agent interferes with the binding of the factor involved in splicing of the ASCE to a region of the targeting moiety.

8. The method of claim 6, wherein the targeting moiety is proximal to the ASCE.

9. The method of claim 6, wherein the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of the 5' end of the ASCE.

10. The method of claim 6, wherein the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, about 1 nucleotide upstream of the 5' end of the ASCE.

11. The method of claim 6, wherein the targeting moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of the 3' end of the ASCE.

12. The method of claim 6, wherein the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, or about 1 nucleotide downstream of the 3' end of the ASCE.

13. The method of claim 6, wherein the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr162092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9133066530; and GRCh38 / hg38: chr5 177238237.

14. The method of claim 6, wherein the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr162092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9133066530; and GRCh38 / hg38: chr5 177238237.

15. The method of claim 6, wherein the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr162093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9133066660; and GRCh38 / hg38: chr5 177238507.

16. The method of claim 6, wherein the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr162093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9133066660; and GRCh38 / hg38: chr5 177238507.

17. The method of claim 6, wherein the targeting moiety is located in an intronic region between the ASCE and a typical exonic region upstream of the ASCE of the mRNA encoding the target protein.

18. The method of claim 6, wherein the targeting moiety is located in an intronic region between the ASCE and a typical exonic region downstream of the ASCE of the mRNA encoding the target protein.

19. The method of claim 6, wherein the targeting moiety at least partially overlaps with the ASCE.

20. The method of claim 6, wherein the targeting moiety at least partially overlaps with an intron located upstream or downstream of the ASCE.

21. The method of claim 6, wherein the targeting moiety does not comprise a 5' exon-intron junction or a 3' exon-intron junction.

22. The method of claim 6, wherein the targeting moiety is located within the ASCE.

23. The method of claim 6, wherein the targeting moiety comprises about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the ASCE.

24. The method of any one of claims 1 to 23, wherein the mRNA encoding the target protein comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 6-10.

25. The method of any one of claims 1 to 23, wherein the mRNA encoding the target protein is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1-5.

26. The method of any one of claims 1 to 23, wherein the targeting portion of the mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a region comprising at least 8 contiguous nucleic acids of a sequence selected from the group consisting of SEQ ID NOs: 6-10.

27. The method of any one of claims 1 to 26, wherein the targeting portion of the mRNA is located within the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 2092954 2093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr16 31186802 31186836; GRCh38 / hg38: chr9133066530 133066660; and GRCh38 / hg38: chr5 177238237 177238507.

28. The method of any one of claims 1 to 26, wherein the targeting moiety of the mRNA is located upstream or downstream of the ASCE, the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 2092954 2093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr16 31186802 31186836; GRCh38 / hg38: chr9133066530 133066660; and GRCh38 / hg38: chr5 177238237 177238507.

29. The method of any one of claims 1 to 26, wherein the targeting portion of the mRNA does not comprise an exon-intron junction of an ASCE selected from the group consisting of: GRCh38 / hg38: chr16 2092954 2093093; GRCh38 / hg38: chrl 9411143894111579; GRCh38 / hg38: chr16 31186802 31186836; GRCh38 / hg38: chr9133066530 133066660; and GRCh38 / hg38: chr5 177238237 177238507.

30. The method of any one of claims 1 to 29, wherein the target protein produced is a full-length protein or a wild-type protein.

31. The method of any one of claims 1 to 30, wherein incorporation of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.2-fold to about 10-fold, about 1.3-fold to about 10-fold, about 1.6-fold to about 10-fold, about 1.7-fold to about 10-fold, about 1.9-fold to about 10-fold, about 2.1-fold to about 10-fold, about 2.2-fold to about 10-fold, about 3.4-fold to about 10-fold, about 4.5-fold to about 10-fold, about 5.6-fold to about 10-fold, about 6.7-fold to about 10-fold, about 7.8-fold to about 10-fold, about 8.9-fold to about 10-fold, about 9. 1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 2-fold to about 5-fold, about 2-fold to about 6-fold, about 2-fold to about 7-fold, about 2-fold to about 8-fold, about 2-fold to about 9-fold, about 3-fold to about 6-fold, about 3-fold to about 7-fold, about 3-fold to about 8-fold, about 3-fold to about 9-fold, about 4-fold to about 7-fold, about 4-fold to about 8-fold, about 4-fold to about 9-fold, at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold.

32. The method of any one of claims 1 to 31, wherein the level of the processed mRNA in the cells contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.2-fold to about 10-fold, or about 1.3-fold to about 10-fold compared to the level of the processed mRNA in a corresponding cell that has not been contacted with the therapeutic agent or the vector encoding the therapeutic agent. .1 times to about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

33. The method of any one of claims 1 to 32, wherein the level of the target protein produced in the cells contacted with the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 2.1-fold to about 20-fold, about 2.1-fold to about 21-fold, about 2.1-fold to about 22-fold, about 2.1-fold to about 23-fold, about 2.1-fold to about 24-fold, about 2.1-fold to about 25-fold, about 2.1-fold to about 26-fold, about 2.1-fold to about 27-fold, about 2.1-fold to about 28-fold, about 2.1-fold to about 29-fold, about 3. 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

34. The method of any one of claims 1 to 33, wherein the exclusion of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent is reduced by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold compared to the exclusion of the ASCE during the processing of the pre-mRNA in a corresponding cell not contacted with the therapeutic agent or the vector encoding the therapeutic agent. , about 1.1 times to about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

35. The method of any one of claims 1 to 34, wherein the target protein is NSD1, and wherein the method results in modification of histones in the cell.

36. The method of claim 35, wherein the histone is histone H3.

37. The method of claim 35 or 36, wherein the modification comprises acetylation, methylation, phosphorylation or ubiquitination.

38. The method of claim 35 or 36, wherein the modification is methylation.

39. The method of claim 38, wherein the methylation of the histone is increased in the cell.

40. The method of claim 38, wherein the methylation of the histone in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, or about 1.2-fold to about 10-fold compared to the methylation of the histone in a corresponding cell not contacted with the therapeutic agent or the vector encoding the therapeutic agent. times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

41. The method of any one of claims 1 to 40, wherein the method further comprises assessing the mRNA level or expression level of the target protein.

42. The method of any one of claims 2 to 41, wherein the disease or condition is induced by a loss-of-function mutation in the target gene.

43. The method of any one of claims 2 to 41, wherein the disease or condition is associated with haploinsufficiency of a gene encoding the target protein, and wherein the subject has a first allele that encodes a functional target protein and a second allele that does not produce the target protein or produces the target protein at reduced levels, or the second allele encodes a non-functional target protein or a partially functional target protein.

44. The method of any one of claims 2 to 43, wherein the disease or condition is selected from the group consisting of: polycystic kidney disease 1 with or without polycystic liver disease; autosomal dominant polycystic kidney disease; age-related macular degeneration-2; Stargardt Disease 1; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis 6 with or without frontotemporal dementia; hereditary essential tremor 4; frontotemporal dementia; maturity-onset diabetes of the young type 8 with exocrine dysfunction; maturity-onset diabetes of the young; Sotos syndrome 1; and Beckwith-Wiedemann syndrome.

45. The method of any one of claims 2 to 40, wherein the disease or condition is associated with an autosomal recessive mutation in a gene encoding the target protein, wherein the subject has a first allele encoding for: (i) not producing the target protein or producing the target protein at a reduced level compared to a wild-type allele; or (ii) producing a non-functional or partially functional target protein compared to a wild-type allele; and a second allele: (iii) producing the target protein at a reduced level compared to a wild-type allele and producing the target protein that is at least partially functional compared to a wild-type allele; or (iv) producing the target protein that is partially functional compared to a wild-type allele.

46. ​​The method of any one of claims 2 to 40, wherein the disease or condition is induced by a gain-of-function mutation in the target protein.

47. The method of claim 46, wherein the subject has an allele that produces the target protein at increased levels, or an allele that encodes a mutant target protein that exhibits increased activity in the cell.

48. The method of any one of claims 2 to 47, wherein the subject is a human.

49. The method of any one of claims 2 to 47, wherein the subject is a non-human animal.

50. The method of any one of claims 2 to 47, wherein the subject is a fetus, embryo, or child.

51. The method of any one of claims 2 to 47, wherein the cell or cells are ex vivo, or in an ex vivo tissue or organ.

52. The method of any one of claims 2 to 47, wherein the therapeutic agent is administered by intrathecal, intracerebroventricular, intraperitoneal, intramuscular, subcutaneous, intravitreal, or intravenous injection to the subject.

53. The method of any one of claims 2 to 47, wherein the method further comprises administering to the subject a second therapeutic agent.

54. The method of claim 53, wherein the second therapeutic agent is a small molecule.

55. The method of claim 53, wherein the second therapeutic agent is an antisense oligomer.

56. The method of claim 53, wherein the second therapeutic agent corrects intron retention.

57. The method of any one of claims 2 to 56, wherein the disease or condition is a disease or condition associated with a deficiency in the amount or activity of the target protein.

58. The method of any one of claims 2 to 57, wherein the disease or condition is a disease or condition associated with a deficiency in the amount or activity of a protein that functionally enhances, compensates for, replaces, or functionally interacts with the target protein.

59. The method of any one of claims 2 to 57, wherein the disease or the condition is caused by a deficiency in the amount or activity of the target protein.

60. The method of any one of claims 2 to 59, wherein the method further comprises assessing the subject's genome for at least one genetic mutation associated with the disease.

61. The method of claim 60, wherein at least one genetic mutation is located within a locus of a gene associated with the disease.

62. The method of claim 60, wherein at least one genetic mutation is located within a locus associated with expression of a gene associated with the disease.

63. The method of claim 60, wherein at least one genetic mutation is located within the locus of the gene encoding the target protein.

64. The method of claim 60, wherein at least one genetic mutation is located within a locus associated with expression of the gene encoding the target protein.

65. The method of any one of claims 2 to 64, wherein the method treats the disease or condition.

66. The method of any one of claims 1 to 65, wherein the target protein is a typical isoform of the protein.

67. The method of any one of claims 1 to 66, wherein the alternatively processed mRNA produced by splicing out the ASCE comprises a premature termination codon (PTC).

68. The method of any one of claims 1 to 67, wherein the agent is an antisense oligomer (ASO).

69. The method of claim 68, wherein the ASO is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% complementary to the targeting portion of the mRNA.

70. The method of claim 68 or 69, wherein the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97% or 100% complementary to at least 8 contiguous nucleic acids of a sequence selected from the group consisting of SEQ ID NOs: 6-10.

71. The method of any one of claims 68 to 70, wherein the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphodiamidate linkage.

72. The method of any one of claims 68 to 70, wherein the ASO comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

73. The method of any one of claims 68 to 70, wherein the ASO comprises at least one modified sugar moiety.

74. The method of claim 73, wherein each sugar moiety is a modified sugar moiety.

75. The method of any one of claims 68 to 74, wherein the ASO consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases. nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, or 12 to 15 nucleobases.

76. The method of any one of claims 68 to 74, wherein the target gene is NSD1 and the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of SEQ ID NOs: 16-1748.

77. The method of any one of claims 1 to 67, wherein the target gene is NSD1, and wherein the vector encoding the agent encodes a polynucleotide comprising a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5D, Table 5E, Table 5G, and Table 5G-1.

78. The method of claim 77, wherein the vector encoding the agent is a viral vector.

79. The method of claim 78, wherein the viral vector is an adeno-associated viral vector.

80. The method of any one of claims 1 to 67, wherein the vector encoding the agent encodes a polynucleotide comprising an ASO sequence and a snRNA.

81. The method of claim 80, wherein the snRNA comprises a modified snRNA.

82. The method of claim 81, wherein the modified snRNA is a modified U1 snRNA or a modified U7 snRNA.

83. The method of any one of claims 80 to 82, wherein the snRNA comprises U1 snRNA.

84. The method of claim 83, wherein the target gene is NSD1, and wherein the ASO sequence comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5B, Table 5D, Table 5E, and Table 5G.

85. The method of any one of claims 80 to 82, wherein the snRNA comprises U7 snRNA.

86. The method of claim 85, wherein the target gene is NSD1, and wherein the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5G, and Table 5G-1.

87. A composition comprising an agent or a vector encoding the agent, wherein the agent modulates splicing of a pre-mRNA in a cell, the pre-mRNA being transcribed from a target gene and encoding the target protein, wherein the pre-mRNA comprises an alternatively spliced ​​coding exon (ASCE), wherein the alternatively processed mRNA produced by splicing out the ASCE during processing of the pre-mRNA undergoes nonsense-mediated RNA decay, wherein the agent promotes incorporation of the ASCE during the processing of the pre-mRNA, thereby increasing the level of processed mRNA processed from the pre-mRNA and comprising the ASCE.

88. The composition of claim 87, wherein the agent increases expression of the target protein in the cell.

89. The composition of claim 87 or 88, wherein the target gene is selected from the group consisting of PKD1, ABCA4, FUS, CEL, and NSD1.

90. The composition of any one of claims 87 to 89, wherein the target protein is selected from the group consisting of polycystin-1, ATP-binding cassette subfamily A member 4, FUS RNA binding protein, carboxyl ester lipase, and nuclear receptor binding SET domain protein 1.

91. according to the composition described in any one of claims 87 to 90, wherein said agent (a) binding to a targeting moiety of the mRNA encoding the target protein; (b) regulating the binding of a factor involved in the splicing of said ASCE; or (c) A combination of (a) and (b).

92. The composition of claim 91, wherein the agent interferes with the binding of the factor involved in splicing of the ASCE to a region of the targeting moiety.

93. The composition of claim 91, wherein the targeting moiety is proximal to the ASCE.

94. The composition of claim 91, wherein the targeting moiety is up to about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of the 5' end of the ASCE.

95. The composition of claim 91, wherein the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, about 1 nucleotide upstream of the 5' end of the ASCE.

96. The composition of claim 91, wherein the targeting moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of the 3' end of the ASCE.

97. The composition of claim 91, wherein the targeting moiety is at least about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides, about 40 nucleotides, about 30 nucleotides, about 20 nucleotides, about 10 nucleotides, about 5 nucleotides, about 4 nucleotides, about 2 nucleotides, about 1 nucleotide downstream of the 3' end of the ASCE.

98. The composition of claim 91, wherein the targeting moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9 133066530; and GRCh38 / hg38: chr5 177238237.

99. The composition of claim 91, wherein the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides upstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr162092954; GRCh38 / hg38: chr1 94111438; GRCh38 / hg38: chr16 31186802; GRCh38 / hg38: chr9 133066530; and GRCh38 / hg38: chr5 177238237.

100. The composition of claim 91, wherein the targeting moiety is at most about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr16 2093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9 133066660; and GRCh38 / hg38: chr5 177238507.

101. The composition of claim 91, wherein the targeting moiety is about 1500 nucleotides, about 1000 nucleotides, about 800 nucleotides, about 700 nucleotides, about 600 nucleotides, about 500 nucleotides, about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, about 100 nucleotides, about 80 nucleotides, about 70 nucleotides, about 60 nucleotides, about 50 nucleotides downstream of a genomic site selected from the group consisting of: GRCh38 / hg38: chr162093093; GRCh38 / hg38: chr1 94111579; GRCh38 / hg38: chr16 31186836; GRCh38 / hg38: chr9133066660; and GRCh38 / hg38: chr5 177238507.

102. The composition of claim 91, wherein the targeting moiety is located in an intronic region between the ASCE and a typical exonic region upstream of the ASCE of the mRNA encoding the target protein.

103. The composition of claim 91, wherein the targeting moiety is located in an intronic region between the ASCE and a typical exonic region downstream of the ASCE of the mRNA encoding the target protein.

104. The composition of claim 91, wherein the targeting moiety at least partially overlaps with the ASCE.

105. The composition of claim 91, wherein the targeting moiety at least partially overlaps with an intron located upstream or downstream of the ASCE.

106. The composition of claim 91, wherein the targeting moiety does not comprise a 5' exon-intron junction or a 3' exon-intron junction.

107. The composition of claim 91, wherein the targeting moiety is located within the ASCE.

108. The composition of claim 91, wherein the targeting moiety comprises about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the ASCE.

109. The composition of any one of claims 87 to 108, wherein the mRNA encoding the target protein comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 6-10.

110. The composition of any one of claims 87 to 108, wherein the mRNA encoding the target protein is encoded by a gene sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1-5.

111. The composition of any one of claims 87 to 110, wherein the targeting portion of the mRNA comprises a sequence having at least 80%, 85%, 90%, 95%, 97% or 100% sequence identity to a region comprising at least 8 consecutive nucleic acids of a sequence selected from the group consisting of SEQ ID NOs: 6-10.

112. The composition of any one of claims 87 to 111, wherein the targeting portion of the mRNA is located within the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 2092954 2093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr16 31186802 31186836; GRCh38 / hg38: chr9133066530 133066660; and GRCh38 / hg38: chr5 177238237 177238507.

113. The composition of any one of claims 87 to 111, wherein the targeting moiety of the mRNA is located upstream or downstream of the ASCE, the ASCE selected from the group consisting of: GRCh38 / hg38: chr16 20929542093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr16 3118680231186836; GRCh38 / hg38: chr9133066530 133066660; and GRCh38 / hg38: chr5 177238237177238507.

114. The composition of any one of claims 87 to 111, wherein the targeting portion of the mRNA does not comprise an exon-intron junction of an ASCE selected from the group consisting of: GRCh38 / hg38: chr16 20929542093093; GRCh38 / hg38: chr1 9411143894111579; GRCh38 / hg38: chr16 3118680231186836; GRCh38 / hg38: chr9133066530 133066660; and GRCh38 / hg38: chr5 177238237177238507.

115. The composition of any one of claims 87 to 114, wherein the target protein produced is a full-length protein or a wild-type protein.

116. The composition of any one of claims 87 to 115, wherein incorporation of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.2-fold to about 10-fold, or about 1.3-fold to about 10-fold compared to incorporation of the ASCE during the processing of the pre-mRNA in a corresponding cell not contacted with the therapeutic agent or the vector encoding the therapeutic agent. .1 times to about 6 times, about 1.1 times to about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

117. The composition of any one of claims 87 to 116, wherein the level of the processed mRNA in the cells contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, or about 1.2-fold to about 10-fold compared to the level of the processed mRNA in a corresponding cell that has not been contacted with the therapeutic agent or the vector encoding the therapeutic agent. about 1.1 times to about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

118. The composition of any one of claims 87 to 117, wherein the level of the target protein produced in the cells contacted with the agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 7-fold, about 1.1-fold to about 8-fold, about 1.1-fold to about 9-fold, about 1.1-fold to about 10-fold, about 1.1-fold to about 11-fold, about 1.1-fold to about 12-fold, about 1.1-fold to about 13-fold, about 1.1-fold to about 15-fold, about 1.1-fold to about 16-fold, about 1.1-fold to about 17-fold, about 1.1-fold to about 18-fold, about 1.1-fold to about 19-fold, about 1.1-fold to about 20-fold, about 1.1-fold to about 21-fold, about 1.1-fold to about 22-fold, about 1.1-fold to about 23-fold, about 1.1-fold to about 24-fold, about 1.1-fold to about 25-fold, about 1.1-fold to about 26-fold, about 1.1-fold to about 27-fold, about 1.1-fold to about 28-fold, about 1.1-fold to about 29-fold, about 1.1-fold to about 30-fold, about 1.1-fold to about 31-fold, about 1.1-fold to about 31-fold, about about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

119. The composition of any one of claims 87 to 118, wherein the elimination of the ASCE during the processing of the pre-mRNA in the cell contacted with the therapeutic agent is reduced by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 10-fold, compared to the elimination of the ASCE during the processing of the pre-mRNA in a corresponding cell not contacted with the therapeutic agent or the vector encoding the therapeutic agent. 6 times, about 1.1 times to about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

120. The composition of any one of claims 87 to 119, wherein the target protein is NSD1, and wherein the method results in modification of a histone in the cell.

121. The composition of claim 120, wherein the histone is histone H3.

122. The composition of claim 120 or 121, wherein the modification comprises acetylation, methylation, phosphorylation, or ubiquitination.

123. The composition of claim 120 or 121, wherein the modification is methylation.

124. The composition of claim 123, wherein the methylation of the histone is increased in the cell.

125. The composition of claim 123, wherein the methylation of the histone in the cell contacted with the therapeutic agent or the vector encoding the therapeutic agent is increased by about 1.1-fold to about 10-fold, about 1.5-fold to about 10-fold, about 2-fold to about 10-fold, about 3-fold to about 10-fold, about 4-fold to about 10-fold, about 1.1-fold to about 5-fold, about 1.1-fold to about 6-fold, about 1.1-fold to about 10-fold, compared to the methylation of the histone in a corresponding cell not contacted with the therapeutic agent or the vector encoding the therapeutic agent. or about 7 times, about 1.1 times to about 8 times, about 1.1 times to about 9 times, about 2 times to about 5 times, about 2 times to about 6 times, about 2 times to about 7 times, about 2 times to about 8 times, about 2 times to about 9 times, about 3 times to about 6 times, about 3 times to about 7 times, about 3 times to about 8 times, about 3 times to about 9 times, about 4 times to about 7 times, about 4 times to about 8 times, about 4 times to about 9 times, at least about 1.1 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, at least about 4 times, at least about 5 times, or at least about 10 times.

126. The composition of any one of claims 87 to 125, wherein the target protein is a typical isoform of the protein.

127. The composition of any one of claims 87 to 126, wherein the alternatively processed mRNA produced by splicing out the ASCE comprises a premature termination codon (PTC).

128. The composition of any one of claims 87 to 127, wherein the agent is an antisense oligomer (ASO).

129. The composition of claim 128, wherein the ASO is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% complementary to the targeting portion of the mRNA.

130. The composition of claim 128 or 129, wherein the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97% or 100% complementary to at least 8 contiguous nucleic acids of a sequence selected from the group consisting of SEQ ID NOs: 6-10.

131. The composition of any one of claims 128 to 130, wherein the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphodiamidate linkage.

132. The composition of any one of claims 128 to 130, wherein the ASO comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

133. The composition of any one of claims 128 to 130, wherein the ASO comprises at least one modified sugar moiety.

134. The composition of claim 133, wherein each sugar moiety is a modified sugar moiety.

135. The composition of any one of claims 128 to 134, wherein the ASO consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, or 12 to 15 nucleobases.

136. The composition of any one of claims 128 to 135, wherein the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of SEQ ID NOs: 16-1748.

137. The composition of any one of claims 87 to 119, wherein the target gene is NSD1, and wherein the vector encoding the agent encodes a polynucleotide comprising a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5D, Table 5E, Table 5G, and Table 5G-1.

138. The composition of claim 137, wherein the vector encoding the agent is a viral vector.

139. The composition of claim 138, wherein the viral vector is an adeno-associated viral vector.

140. The composition of any one of claims 87 to 119, wherein the vector encoding the agent encodes a polynucleotide comprising an ASO sequence and a snRNA.

141. The composition of claim 140, wherein the snRNA comprises a modified snRNA.

142. The composition of claim 141, wherein the modified snRNA is a modified U1 snRNA or a modified U7 snRNA.

143. The composition of any one of claims 140 to 142, wherein the snRNA comprises U1 snRNA.

144. The composition of claim 143, wherein the target gene is NSD1, and wherein the ASO sequence comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5B, Table 5D, Table 5E, and Table 5G.

145. The composition of any one of claims 140 to 142, wherein the snRNA comprises U7 snRNA.

146. The composition of claim 145, wherein the target gene is NSD1, and wherein the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5G, and Table 5G-1.

147. A composition comprising an ASO comprising a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of SEQ ID NOs: 16-1748.

148. The composition of claim 147, wherein the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphodiamidate linkage.

149. The composition of claim 147, wherein the ASO comprises a phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety.

150. The composition of claim 147, wherein the ASO comprises at least one modified sugar moiety.

151. The composition of claim 150, wherein each sugar moiety is a modified sugar moiety.

152. The composition of any one of claims 147 to 151, wherein the ASO consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, or 12 to 15 nucleobases.

153. A composition comprising a vector encoding a polynucleotide comprising a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5D, Table 5E, Table 5G, and Table 5G-1.

154. The composition of claim 153, wherein the vector encoding the agent is a viral vector.

155. The composition of claim 154, wherein the viral vector is an adeno-associated viral vector.

156. The composition of any one of claims 153 to 155, wherein the vector encoding the agent encodes a polynucleotide comprising an ASO sequence and a snRNA.

157. The composition of claim 156, wherein the snRNA comprises a modified snRNA.

158. The composition of claim 157, wherein the modified snRNA is a modified U1 snRNA or a modified U7 snRNA.

159. The composition of any one of claims 156 to 158, wherein the snRNA comprises U1 snRNA.

160. The composition of claim 159, wherein the ASO sequence comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5B, Table 5D, Table 5E, and Table 5G.

161. The composition of any one of claims 156 to 158, wherein the snRNA comprises U7 snRNA.

162. The composition of claim 161, wherein the ASO comprises a sequence having at least about 80%, 85%, 90%, 95%, 97% or 100% sequence identity to any one of the ASO sequences listed in Table 4, Table 5A, Table 5A-1, Table 5B, Table 5B-1, Table 5G, and Table 5G-1.

163. A pharmaceutical composition comprising a composition according to any one of claims 87 to 162 and a pharmaceutically acceptable excipient and / or delivery vehicle.

164. A method of treating a subject in need thereof or reducing the likelihood of developing a disease or condition, the method comprising: administering to the subject the pharmaceutical composition of claim 163.

Citation Information

Patent Citations

  • Compositions and methods for modulation of SMN2 splicing in a subject

    US20120190728A1

  • Methods for the synthesis of functionalized nucleic acids

    US20140194610A1

  • Method for the delivery of genetic material across the blood brain barrier

    US4866042A

  • Method of synethesizing sulfurized oligonucleotide analogs

    US5151510A

  • Antisense oligonucleotide modulation of raf gene expression

    US5656612A