Traditional Chinese medicine composition for treating sarcopenia by regulating CXCR4 / GPX4 axis to inhibit ferroptosis and preparation method and application thereof

Abstract

The invention discloses a traditional Chinese medicine composition for treating sarcopenia by regulating a CXCR4 / GPX4 axis to inhibit ferroptosis and a preparation method and application thereof, and belongs to the technical field of traditional Chinese medicines. The traditional Chinese medicine composition is prepared from the following raw material medicines in parts by weight: 5-15 parts of eucommia ulmoides, 5-15 parts of herba epimedii, 5-15 parts of fructus psoraleae and 5-15 parts of semen cuscutae. The traditional Chinese medicine composition disclosed by the invention has the traditional effects of tonifying kidney, strengthening yang and strengthening tendons and bones, and is proved to be capable of promoting GPX4 expression and inhibiting ferroptosis of muscle cells by up-regulating CXCR4 expression, so that muscle strength is effectively enhanced, proliferation and differentiation of muscle satellite cells are promoted, oxidative stress is reduced, and the traditional Chinese medicine composition is used for preventing or treating sarcopenia.

Description

Technical Field

[0001] The present invention belongs to the technical field of traditional Chinese medicine, and specifically relates to a traditional Chinese medicine composition for preventing or treating sarcopenia (SP) by regulating the CXCR4 / GPX4 axis to inhibit ferroptosis, a preparation method thereof, and use in the medical field. Background Art

[0002] Sarcopenia (SP) is a progressive, systemic skeletal muscle disease closely associated with aging, with the core pathological hallmark being a decline in skeletal muscle mass, strength, and function. With the accelerating aging of the global population, the prevalence of SP in the elderly continues to rise, severely impacting their quality of life and increasing the healthcare burden on society. SP not only significantly increases the risk of falls, fractures, disability, and death, but also frequently coexists with geriatric diseases such as osteoporosis (OP), exacerbating mobility impairments in the elderly. Despite the growing clinical importance of SP, its pathogenesis is complex and has yet to be fully elucidated, and specific and effective pharmacological interventions are currently lacking.

[0003] Muscle satellite cells (MuSCs), adult stem cells in skeletal muscle, are key effector cells for maintaining muscle homeostasis and regeneration. During the process of muscle wasting (SP), dysfunction of MuSCs, such as decreased proliferation and differentiation and impaired self-renewal, is a core link leading to muscle loss and repair disorders. In recent years, ferroptosis, an iron-dependent, programmed cell death characterized by lipid peroxidation, has gradually attracted attention for its role in muscle wasting diseases. Studies have shown that excessive activation of ferroptosis can directly lead to MuSC dysfunction and death, thereby exacerbating muscle loss and SP progression. Glutathione peroxidase 4 (GPX4), a core antioxidant enzyme that inhibits ferroptosis, has been closely associated with impaired MuSC differentiation and exacerbated muscle atrophy. Therefore, targeted regulation of ferroptosis, particularly by enhancing GPX4 activity, may provide a new strategy for the treatment of SP.

[0004] The signaling axis formed by CXC chemokine receptor 4 (CXCR4) and its ligand CXCL12 (stromal cell–derived factor-1, SDF-1) plays a crucial role in tissue repair, stem cell homing, cell proliferation, and differentiation. In skeletal muscle, CXCR4 is crucial for the self-renewal, activation, proliferation, and differentiation of MuSCs, participating in the repair and regeneration process after muscle injury. CXCR4 may indirectly influence ferroptosis by regulating antioxidant pathways, but its specific mechanism of action in ferroptosis-related MuSC dysfunction remains to be further investigated.

[0005] At present, Western medicine interventions are mainly limited to exercise rehabilitation, nutritional support and hormone replacement therapy, but long-term compliance is poor, and there are potential risks such as cardiovascular events and metabolic disorders. There is still a lack of oral preparations with clear mechanisms, safe and long-term use. Traditional Chinese medicine has a long history and unique advantages in treating chronic complex diseases. Buyang Decoction (BYD) is a classic Chinese medicine prescription. Previous studies by the inventors' team have confirmed the significant therapeutic effect of BYD in osteoporosis models. Given that SP and OP often occur together and may have a common pathophysiological basis, the present invention aims to further explore the therapeutic effect of BYD on SP and its potential molecular mechanism, so as to provide a solid experimental basis and clinical translation prospects for the development of safe, effective and well-defined new Chinese medicines for the prevention and treatment of SP. Summary of the Invention

[0006] The purpose of the present invention is to provide a safe and effective traditional Chinese medicine composition that can prevent and treat sarcopenia by inhibiting muscle cell ferroptosis, as well as a preparation method and use thereof.

[0007] To achieve the above objectives, the present invention employs the following technical solutions: In a first aspect, the present invention provides a traditional Chinese medicine composition for preventing and treating sarcopenia, comprising the following raw materials in parts by weight: 5-15 parts of Eucommia ulmoides; 5-15 parts of Epimedium brevicornum; 5-15 parts of Psoralea corylifolia; and 5-15 parts of Cuscuta chinensis. The composition is used to prevent and treat sarcopenia by upregulating CXCR4 expression and inhibiting GPX4-mediated ferroptosis.

[0008] Preferably, the traditional Chinese medicine composition is made of the following raw materials in parts by weight: 10 parts of Eucommia ulmoides, 10 parts of Epimedium, 10 parts of Psoralea corylifolia, and 12 parts of Cuscuta australis.

[0009] In a second aspect, the present invention provides a method for preparing the Chinese medicine composition described in the first aspect, comprising the following steps: weighing each raw material medicine by weight, decocting with water for extraction, combining the extracts, and concentrating.

[0010] Preferably, the extraction method is water decoction. For example, after mixing the raw materials, add 8-10 times the total weight of the raw materials in water, soak for more than 0.5 hours (preferably 0.5-1 hours), boil over high heat, then simmer over low heat for 1-2 hours, filter, and collect the first filtrate; then add 6-8 times the weight of the raw materials in water to the residue, decoct for 1-2 hours, filter, and collect the second filtrate. Combine the two filtrates.

[0011] Preferably, the concentration method comprises concentrating the combined filtrate under reduced pressure or further drying the combined filtrate to prepare a dry extract or freeze-dried powder.

[0012] In a third aspect, the present invention provides a traditional Chinese medicine preparation for preventing and treating sarcopenia, which is a decoction, granules, pills, tablets, capsules or oral liquid made from the traditional Chinese medicine composition of the first aspect or the composition prepared by the preparation method of the second aspect; preferably a decoction or granules.

[0013] In a fourth aspect, the present invention provides the use of the traditional Chinese medicine composition described in the first aspect or the traditional Chinese medicine composition prepared by the preparation method described in the second aspect in preparing a drug for preventing or treating sarcopenia and / or inhibiting muscle cell ferroptosis and / or preparing a ferroptosis inhibitor.

[0014] The Chinese medicine composition of the present invention is based on the theories of Traditional Chinese Medicine (TCM) that "the kidney governs bone and marrow production, its essence is in hair and enriches muscles" and "the liver governs tendons," and selects medicinal materials that have the effects of tonifying kidney yang, improving essence and blood, and strengthening tendons and bones. Among them, Epimedium is pungent, sweet, and warm in nature and flavor, enters the liver and kidney meridians, and is mainly used to tonify the kidney and strengthen yang, and strengthen tendons and bones. Psoralea corylifolia is pungent, bitter, and warm in nature and flavor, and enters the kidney and spleen meridians. It can not only tonify the kidney and strengthen yang, but also consolidate essence and reduce urination, warm the spleen and stop diarrhea, and is targeted at common complications of kidney yang deficiency. Among them, Epimedium mainly targets kidney yang, while Psoralea corylifolia takes care of both the spleen and kidney meridians. Cuscuta chinensis is neutral in nature and alleviates the warming and drying side effects of Epimedium and Psoralea corylifolia; Eucommia ulmoides is sweet and warm, directing the medicinal power directly to the liver and kidneys, enhancing the warming and tonifying effect without causing internal heat. Cuscuta seeds and Eucommia ulmoides complement each other. The former strengthens essence and kidneys, harmonizing medicinal properties; the latter directs meridians to the liver and kidneys, strengthening tendons and bones. Their combination significantly improves symptoms such as soreness of the waist and knees, and weakness of tendons and bones. Together, these four herbs tonify the kidneys and replenish essence, warm yang and invigorate the spleen, and strengthen tendons and bones, addressing the pathogenesis of sarcopenia, characterized by kidney deficiency, essence deficiency, spleen dysfunction, and malnutrition of tendons and bones.

[0015] The beneficial effects of the present invention are as follows: (1) The Chinese medicine composition provided by the present invention shows significant effects in preventing and treating sarcopenia and has good safety. (2) The present invention reveals for the first time a new mechanism by which the Chinese medicine composition effectively prevents and treats sarcopenia by regulating the CXCR4-GPX4 signaling axis and inhibiting ferroptosis, providing a clear molecular target for the treatment of sarcopenia with Chinese medicine compound. (3) The present invention selects only four core drugs for "tonifying yang and strengthening tendons" and adopts the principle of equal compatibility. On the basis of retaining the essence of traditional tonifying yang theory, it achieves a high degree of simplification of the formula and optimized integration of functions. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Figure 4 is the HPLC detection and analysis of BYD and its key components; Figure A is the HPLC chromatogram in positive ion mode; Figure B is the HPLC chromatogram in negative ion mode; Figures CD are the HPLC chromatograms of blank mouse serum in positive ion (C) and negative ion (D) modes; Figure EF is the HPLC chromatograms of BYD-administered mouse serum in positive ion (E) and negative ion (F) modes; Figure G is the chemical formulas of the top five monomers of BYD decoction in positive and negative ion modes sorted by response value;

[0017] Figure 2 BYD delays OVX-induced muscle strength decline in SP mice; Figure A is a schematic diagram of the experimental design; Figure B is a schematic diagram of the grip strength test and rotarod test; Figures CD are the grip strength and rotarod test results of mice from 1 to 16 weeks (n=6); Figure E is a schematic diagram of the mouse gait experiment; Figure FI is a bar graph of the stride length and swing time results of the left and right paws of mice (n=6); Figure J is a Micro-CT scan of the mouse femur, showing the reconstructed sagittal plane and 3D image of the distal femur; Figure KM is a bar graph of the Micro-CT analysis results of BMD, BV / TV and Tb.Th (n=6); Figure N is a cross-section of myofibers based on Laminin2α immunofluorescence staining Figure 1 is a bar graph of the cumulative results (n=6); Figure O is the HE staining results of paraffin-embedded and sectioned muscle tissue; Figure P is the Laminin2α immunofluorescence staining of paraffin sections of gastrocnemius muscle, red fluorescence indicates Laminin2α expression, and blue fluorescence indicates DAPI nuclear staining; Figure Q is a bar graph of sarcomere length measurement based on TEM results and ImageJ statistical analysis (n=6); Figure R is a TEM micrograph showing the ultrastructure of muscle fibers, A indicates A band, I indicates I band, Z indicates Z line, and S indicates the sarcomere between two Z lines; Figure ST is the mRNA expression levels of MYOD and MYOG in gastrocnemius muscle (n=6), comparative group: OVX;

[0018] Figure 3BYD reverses Erastin-induced GPX4 degradation in MuSCs in vitro and in vivo and inhibits ferroptosis; Figure A shows MRI T1 and T2 results, with edema signals marked by red triangles; Figure B shows a TEM image showing mitochondrial morphology, with red triangles indicating areas of abnormal mitochondrial morphology; Figures CD show DHE staining results and their corresponding analysis graphs (n=6); Figures EF show GPX4 immunohistochemistry results and bar charts of the results (n=6); Figure G shows GPX4 mRNA transcription levels obtained by qPCR (n=6); Figure HI shows the results of a CCK8 experiment used to screen BYD and Erastin concentrations and select the optimal concentration (n=6); Figures JK show schematic diagrams of EdU experiments for observing mouse MuSCs proliferation and statistical analysis of positive results (n=3), with red fluorescence indicating proliferating cells and blue fluorescence indicating cell nuclei; Figure L shows the results of Annexin V-FITC / PI fluorescence staining, with green fluorescence indicating Annexin V-FITC positive areas show early apoptosis, red fluorescence indicates PI positive areas, representing late apoptosis; Figure MN is the statistical analysis of Annexin V-FITC and PI positive results (n=3); Figure OP is the confocal microscope images of MYOG immunofluorescence staining and the corresponding statistical analysis of mean fluorescence intensity (n=3), red fluorescence represents MYOG positive expression, blue represents DAPI cell nuclear staining; Figure QR is the DCFH-DA staining images and the corresponding fluorescence intensity results (n=3), green fluorescence represents intracellular R OS levels, blue represents DAPI nuclear staining; Figure S is a Nile red staining image, the red area indicates intracellular lipid accumulation, and blue represents DAPI nuclear staining; Figure T is a statistical analysis of the mean fluorescence intensity (MFI) of the Nile red-positive area (n=3); Figure U is a statistical analysis of the GPX results (n=3); Figure V is a statistical result of the MDA content measurement (n=3); Figure WX is the qPCR results of GPX4 and MYOG expression (n=3); Figure Y is the Western blot results of GPX4, MYOG, and β-actin; Figure Z is a statistical analysis of the Western blot results of GPX4 and MYOG and the corresponding bar graph (n=3); comparison groups: A–G are compared with OVX (ovariectomy group); H–I are compared with CTRL (control group); J–Z are compared with E group;

[0019] Figure 4 Figure 1 is the in vivo validation of the top five key genes in mice; Figure A is the in vivo validation of CXCR4 in mice, Figure B is the in vivo validation of CCL2 in mice, Figure C is the in vivo validation of CD274 in mice, Figure D is the in vivo validation of CD44 in mice, and Figure E is the in vivo validation of LEP in mice; comparison group: OVX;

[0020] Figure 5In vitro CXCR4 knockout eliminated BYD-mediated ferroptosis resistance of MuSCs; Figures A–B are CXCR4 immunofluorescence staining images and relative mean fluorescence intensity statistics in SP model mice; Figures C–E are CXCR4 / GPX4 double immunofluorescence images and relative mean fluorescence intensity statistics in primary MuSCs cells; Figures F–G are comparison and quantitative statistics of CXCR4 protein expression (WB) in the OVA group after Erastin±BYD treatment (n=3); Figure H is a schematic diagram of lentivirus-mediated CXCR4 knockout; Figures I–J are DHE staining to assess reactive oxygen levels; Figures K–L are Nile Red staining to detect lipid droplets, with the red area representing lipid droplets and the blue area representing cell nuclei; Figures M–N are Edu staining to assess cell proliferation; Figures O–P are MYOG immunofluorescence staining; Figure Q is a graph of MYOG, GPX4, and CXCR4 Heat map of mRNA expression (n=3); Figures R–S show related protein expression (WB) and quantitative analysis (n=3); Figure T shows GPX content quantification (n=3);

[0021] Figure 6 Figure 3: Pharmacological inhibitor AMD3100 inhibits the therapeutic effect of BYD in SP mice. Figure A is a schematic diagram of the experimental design. Figure B is a double immunofluorescence image of CXCR4 / GPX4. Figure C is quantification of CXCR4 staining in paraffin sections of gastrocnemius muscle (n=6). Figure D is CXCR4 mRNA expression in gastrocnemius muscle (n=6). Figures E–F are grip strength and rotarod performance curves (n=6). Figures G–H are statistics of gait parameters of left and right paws at 16 weeks (n=6). Figures I–K are CSA analysis, HE staining, and Laminin 2α staining (n=6). Figures L–M are statistics of skeletal muscle fiber length and TEM morphology (n=6). Figures N–O are MYOD, MYOG mRNA expression statistics (n=6); Figures P–Q are DHE staining to assess ROS levels (n=6); Figure R is mitochondrial TEM image, with red arrows indicating abnormal morphology; Figures S–T are GPX4 immunohistochemistry and quantification (n=6); Figure U is GPX4 mRNA expression statistics in gastrocnemius muscle (n=6), comparison group: OVX;

[0022] Figure 7 Figure 3. Correlation between serum components of BYD-administered mice and compounds in the decoction (serum-decoction component correspondence network diagram). Purple nodes: prototype compounds identified in the BYD decoction; pink nodes: components detected in the serum of mice after BYD administration.

[0023] Figure 8 To assess BYD safety, body weight and major organ examinations were performed. Figure A shows the body weight of mice in each group (bar graph, n=6). Figure B shows the overall anatomical photographs of the heart, liver, spleen, lung, and kidney of mice. Figure C shows HE staining of paraffin sections of the heart, liver, spleen, lung, and kidney. Comparative group: OVX.

[0024] Figure 9 BYD improves osteoporosis, muscle morphology, and gait in mice. Figure A is a schematic diagram of the mouse gait experiment. Figures B–M are bar graphs of gait analysis parameters (left and right paw swing stride, stance time, stance stride length, stride length coefficient of variation, paw contact area, and paw contact area variability). Comparison group: OVX.

[0025] Figure 10 BYD improves OVX-induced bone loss and microstructural damage in mice; Figure A is a coronal reconstruction of the mouse femur by Micro-CT; Figures B–C are the trabecular number (Tb.N) and gaps in the reconstruction results.

[0026] (Tb.Sp) Bar graph (n=6); Comparison group: OVX;

[0027] Figure 11 BYD alleviates OVX-induced muscle atrophy in SP mice; Figure A is a representative image of intact fresh gastrocnemius muscle under a stereomicroscope; Figures B–C are quantifications of gastrocnemius muscle width and length (n=6); Comparative group: OVX;

[0028] Figure 12 Figure 3: Differential gene enrichment and key gene analysis of muscle tissue mRNA sequencing in clinical SP patients; Figure A is a boxplot of gene expression after GSE111016 normalization; Figure B is a volcano plot of differentially expressed genes; Figure C is a PPI network diagram of differentially expressed genes; Figure D is a heat map of ferroptosis-related and important gene expression; Figure E is a violin plot of CXCR4, CD274, CCR2, MT-ATP6, GPX3, SLC1A4, and ACOT6 expression; Figure F is a PPI network of disease-target and drug-target intersection genes; comparison group: NORMAL;

[0029] Figure 13 Figures A–C are bar graphs of MYOG, GPX4, and CXCR4 mRNA expression after BYD intervention and CXCR4 knockout in vitro (n=3); Comparative group: CXCR4-KD.

[0030] Figure 14 This is a diagram showing the mechanism of BYD in the present invention in preventing and treating sarcopenia;

[0031] Figure 15Inhibition of CXCR4 in vivo abolishes BYD's regulatory effects on muscle morphology and GPX4. Figure A shows the quantitative immunofluorescence double staining of CXCR4 and GPX4 in paraffin sections of gastrocnemius muscle (n = 6). Figures B–M show the results of mouse gait analysis (left and right paw swing stride, stance time, stance stride length, stride length coefficient of variation, paw contact area, and paw contact area variability) (n = 6). Figures N–P show muscle length and width statistics and overall anatomical photographs of mice (n = 6). Comparison group: OVX.

[0032] The data are expressed as mean ± standard error of the mean (SEM); * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001; ns = no significant difference. DETAILED DESCRIPTION

[0033] Example 1: Preparation, quality control and characterization of the Chinese medicine composition of the present invention (Buyang Decoction, BYD).

[0034] 1.1 Composition of raw materials: 10 parts by weight of Eucommia ulmoides, 10 parts by weight of Epimedium, 10 parts by weight of Psoralea corylifolia, and 12 parts by weight of Cuscuta australis.

[0035] Table 1: Medicinal composition of Buyang Decoction

[0036]

[0037]

[0038] 1.2 Preparation of BYD Extract (Lyophilized Powder)

[0039] (1) Pretreatment and weighing of medicinal materials: Accurately weigh each medicinal material according to the above weight.

[0040] (2) Soaking and Decoction: Place the mixed herbs in an extraction container and add 8 times the total volume of purified water. Soak at room temperature for at least 30 minutes. Heat over high heat until boiling, then reduce heat and continue decoction for 1.5 hours. Filter and collect the first batch of liquid.

[0041] (3) Second decoction: Add the same amount of purified water to the dregs from the first decoction and repeat the decoction process. Filter and collect the second decoction solution.

[0042] (4) Combining and freeze-drying: Combine the two drug solutions and mix thoroughly. Use a freeze dryer to freeze-dry to obtain BYD freeze-dried powder, which is then dried and stored at -80°C for later use. The yield of the freeze-dried powder is approximately 1.73%.

[0043] 1.3 Analysis of BYD chemical components by liquid chromatography-tandem mass spectrometry (LC-MS / MS)

[0044] (1) Sample preparation: BYD lyophilized powder was weighed and dissolved in purified water to 0.1 mg / mL. The mixture was centrifuged at 20,000 × g for 10 min at 4°C. The supernatant was filtered through a 0.22 μm filter membrane.

[0045] (2) LC-MS / MS analysis results of BYD chemical components: LC-MS / MS analysis results showed that ( Figure 1 A, 1B), a total of 67 compounds were identified in positive ion mode and 68 compounds were identified in negative ion mode. These compounds mainly include carbohydrates, fatty acid esters, flavonoids, terpenes, phenolic acids and organic acids. The HPLC chromatograms of blank mouse serum in positive and negative ion modes are shown in Figure 1. Figure 1 C, 1D. HPLC chromatograms of BYD-administered mouse serum in positive and negative ion modes are shown in Figure 1 E and 1F. In BYD decoction, according to the response value, the chemical formulas of the first several monomers with higher abundance in positive and negative ion modes are as follows Figure 1 As shown in Figure 1, these compounds include isomaltose, isosafrole, umbelliferone, dehydrodieugenol, 5-hydroxymethylfurfural, emodin, eucommiol, liquiritigenin, and N-hexadecanoic acid. These components provide the material basis for the potential pharmacological effects of BYD.

[0046] Example 2: In vivo pharmacodynamic study of BYD on ovariectomy-induced sarcopenia mice

[0047] 2.1 Experimental animals, OVX model establishment, grouping, and drug administration

[0048] (1) Experimental Animals and Housing: SPF female C57BL / 6 mice (6–8 weeks old) were purchased from the Animal Center of Zhejiang Chinese Medical University (Zhejiang, China). All provided mice were 8 weeks old and of similar size and weight. All animal experiments were approved by the Animal Ethics Committee of Zhejiang Chinese Medical University (approval number: IACUC-202404-17) on September 26, 2023. Mice were housed under standard conditions.

[0049] (2) OVX model establishment: When mice were adaptively fed to 10 weeks of age, all mice in the SHAM group underwent bilateral ovariectomy (OVX) under isoflurane anesthesia to establish a sarcopenia mouse model. Mice in the SHAM group underwent only abdominal incision and suture without ovariectomy.

[0050] (3) Grouping and drug administration: For experimental design process, see Figure 2 A. A total of 36 mice were randomly divided into six groups (n = 6 / group): SHAM group; OVX model group; BYD low-dose group (BYD-L, 0.13 g crude drug / kg / d); BYD medium-dose group (BYD-M, 0.26 g crude drug / kg / d); BYD high-dose group (BYD-H, 0.52 g crude drug / kg / d); and alendronate sodium group (ALN, 3 mg / kg / d). Starting from the day after surgery, BYD lyophilized powder and ALN were dissolved in the corresponding amount of purified water for each group and administered orally once daily. The SHAM and OVX model groups were gavaged daily with an equal volume of normal saline. Dosing continued for 16 weeks.

[0051] (4) Sample collection: After 16 weeks of administration, mice were euthanized by carbon dioxide inhalation. Bilateral gastrocnemius muscle and femur samples were quickly collected for subsequent analysis.

[0052] 2.2 Safety Assessment of BYD

[0053] During the administration period, the mice were weighed weekly. The weight growth curves of the mice in each group during the 16-week administration period are shown in the figure below. Figure 8 A. At the end of the experiment, observe the gross morphology of the main organs (heart, liver, spleen, lungs, and kidneys) with the naked eye ( Figure 8 B), and samples were taken for HE staining pathological examination ( Figure 8 C). No obvious abnormalities were observed in the morphological structures of major organs among the groups, indicating that BYD had no significant systemic toxicity to mice at the dose used in this experiment.

[0054] Effects of BYD on muscle function in OVX mice

[0055] 2.3.1 Rotarod Test

[0056] Experimental Methods: Every week from 1 to 16 weeks of drug administration, the motor coordination and balance endurance of mice were assessed using a rotarod apparatus ( Figure 2 B) Before testing, place the mouse on a stationary rotating rod to acclimate. During the actual test, set the rotating rod speed to 50 r / min and the acceleration to 100 r / min. 2 , forward rotation mode (R). The time (latency) for each mouse to fall from the rotating rod was recorded, and the average duration was calculated from three trials for each mouse.

[0057] Experimental results: Figure 2D. Compared with the SHAM group, the rotarod duration of OVX mice was significantly shortened from an early stage. At week 16, the duration in the OVX group was 75% lower than that in the SHAM group (p < 0.001). BYD treatment significantly prolonged the rotarod duration of OVX mice in a dose-dependent manner. The improvement was most pronounced in the high-dose BYD group, with an 89.0% increase in rotarod duration at week 16 compared with the OVX control group (p < 0.001). No significant differences were observed between the ALN and OVX groups.

[0058] 2.3.2 Grip Strength Test

[0059] Experimental method: Every week from 1 to 16 weeks of drug administration, the maximum grip strength of the mice's forelimbs was assessed using a small animal grip strength tester ( Figure 2 B) Before testing, mice were acclimated to the grip dynamometer. During testing, mice grasped a metal bar with their forelimbs while a uniform horizontal pull was applied to their tails until they released their grips. The force recorded at the moment of grip release was defined as the maximum grip force. Three trials were performed for each mouse, and the average value was recorded.

[0060] Experimental results: Compared with the SHAM group, the grip strength of the OVX group decreased significantly from the early stage of the experiment, and decreased by 13.2% compared with the SHAM group at 16 weeks (p < 0.01, Figure 2 C) BYD treatment significantly increased grip strength in OVX mice in a dose-dependent manner. The high-dose BYD group showed a 14.0% increase in grip strength compared to the OVX control group at 16 weeks (p<0.001). No significant improvement was observed in the ALN group compared to the OVX group.

[0061] 2.3.3 Gait Analysis

[0062] Experimental method: During the 16-week period of drug administration, DigiGait TM Small Animal Gait Analysis System quantitatively analyzes the walking pattern of mice ( Figure 2 E, Figure 9 A). Before testing, mice were acclimated to the gait analysis system. During testing, the treadmill speed was set at 18 cm / s, and gait parameters were collected. Data analysis included stride length, swing time, and stance duration, using at least 5 seconds of video recording.

[0063] Experimental results: Compared with the SHAM group, the left and right paw step lengths of the OVX model group mice ( Figure 2 F, 2G) were significantly shortened by 55.3% and 55.0% (both p<0.001); the left and right paw swing time ( Figure 2 H, 2I) were significantly shortened by 32.2% and 37.6% respectively (both p < 0.001); the stance duration was also significantly reduced. Other gait parameters such as cadence, speed, and paw contact area also showed adverse changes ( Figure 9 BYD administration effectively and dose-dependently reversed the deterioration in these OVX-induced gait parameters. The high-dose BYD group recovered 498.6% of stride length (compared to the OVX group, p < 0.001), and parameters such as swing time and stance time also showed significant improvements. The ALN group did not significantly improve most gait parameters.

[0064] Effects of BYD on muscle morphology and histology in OVX mice

[0065] 2.4.1 Examination of the gross shape and size of the gastrocnemius muscle

[0066] Using a stereomicroscope to image the gastrocnemius muscle samples, the width of the gastrocnemius muscle in the OVX model group was significantly reduced by 41.0% (p<0.001) and the length was significantly reduced by 37.1% (p<0.001) compared with the SHAM group ( Figure 11 BYD administration significantly improved gastrocnemius muscle morphology in a dose-dependent manner, with the high-dose group showing a 59.6% increase in width and a 55.5% increase in length compared with the OVX control group (p < 0.001). ALN treatment did not significantly alter these parameters.

[0067] 2.4.2 Gastrocnemius muscle histological HE staining and Laminin 2α immunofluorescence detection

[0068] Hematoxylin-eosin staining ( Figure 2 O) and laminin-2α immunofluorescence ( Figure 2 P) showed that the muscle fiber cross-sectional area (CSA) of ovariectomized sarcopenic mice in the OVX model group was reduced by 60.8% compared with the SHAM group ( Figure 2 N), indicating muscle degeneration. Buyang decoction treatment significantly reversed these structural abnormalities, with a significant increase in muscle fiber cross-sectional area of ​​205.8% compared with the OVX model group (p < 0.001). Alendronate treatment did not significantly affect these histological parameters.

[0069] Table 2: Antibodies and their experimental uses

[0070]

[0071]

[0072] 2.4.3 Transmission electron microscopy (TEM) examination of gastrocnemius muscle ultrastructure

[0073] Sarcomere structure: TEM showed that the sarcomere width of the OVX model group decreased by 27.4% ( Figure 2 Q, p < 0.001), indicating that myofibril integrity was impaired ( Figure 2 Treatment with Buyang Decoction significantly reversed these structural abnormalities, with sarcomere width restored by 25.4% compared with the OVX group (p < 0.001). ALN treatment failed to significantly affect these parameters.

[0074] Mitochondrial morphology: TEM analysis confirmed OVX-induced mitochondrial damage in SP mice ( Figure 3 B), a hallmark of ferroptosis. Mitochondrial morphological changes, including matrix swelling, condensation, and outer membrane rupture, were observed in OVX-induced SP muscle tissue. BYD intervention significantly protected mitochondrial integrity and reduced mitochondrial swelling, indicating that ferroptosis was alleviated.

[0075] Micro-CT analysis of skeletal parameters of 2.5BYD-treated OVX mice

[0076] Micro-CT analysis of femur ( Figure 2 J, Figure 10 A) shows that OVX mice also experience bone degeneration. BMD ( Figure 2 K)、BV / TV( Figure 2 L) and Tb.Th( Figure 2 M) were significantly decreased by 7.1%, 72.8% and 37.2% (p < 0.001), while Tb.N( Figure 10 B) decreased, Tb.Sp( Figure 10 C) increased by 28.2% (p<0.001).These findings suggest that OVX not only induces muscle dysfunction but also exacerbates bone loss.

[0077] Effects of 2.6BYD on the expression of molecular markers in muscle tissue of OVX mice

[0078] 2.6.1 qRT-PCR detection method and results of myogenesis-related factors (MYOD, MYOG) expression

[0079] Total RNA was extracted from gastrocnemius muscle using an RNA extraction kit (AG21024, Aikerui, Hunan, China) and reverse transcribed using a reverse transcription kit (AG11728, Aikerui). qRT-PCR was performed using a SYBR Green Premix Pro Taq HS qRT-PCR kit (AG11701, Aikerui) and specific primers (primer sequences such as SEQ ID NOs. 3-6) to detect the expression of target mRNA. -ΔΔCT Compared with the SHAM group, MYOD ( Figure 2 S) and MYOG( Figure 2 The mRNA expression levels of MYOD and MYOG were reduced by 77.4% and 85.2%, respectively (p < 0.001). BYD administration restored the expression of MYOD and MYOG in a dose-dependent manner. Compared with the OVX group, the high-dose group showed a significant increase of MYOD expression by 299.3% and a substantial increase of MYOG expression by 586.5% (p < 0.01). In contrast, ALN treatment did not significantly alter the expression of muscle-specific genes.

[0080] Table 3: RT-PCR primer sequences

[0081]

[0082] 2.6.2 DHE staining detection of oxidative stress (ROS) levels

[0083] After dewaxing and rehydration, the paraffin sections of gastrocnemius muscle were stained with DHE ( Figure 3 C), the results further revealed the excessive accumulation of ROS in SP muscle tissue: compared with the SHAM group, the ROS level (measured by DHE positive rate) of SP mice induced by OVX increased sharply by 264.6% ( Figure 3 D, p < 0.001). BYD treatment significantly inhibited ROS accumulation, and the high-dose group reduced ROS intensity by 47.4% (p < 0.001).

[0084] 2.6.3 Immunohistochemistry (IHC) and qRT-PCR detection of ferroptosis core protein GPX4 expression

[0085] Immunohistochemical staining ( Figure 3 E) showed that compared with the SHAM group, the GPX4-positive cells in the SP muscle tissue induced by OVX were reduced by 88.9% ( Figure 3 F). BYD treatment restored GPX4 expression and significantly increased the proportion of GPX4-positive cells, with the increase reaching 1079.1% in the high-dose group (p<0.001). Figure 3 G, sequence as shown in SEQ ID NOs. 7-8) showed that OVX-induced GPX4 mRNA levels in SP muscle tissue were significantly downregulated by 88.5% compared to the SHAM group (p < 0.001). BYD administration partially restored GPX4 mRNA levels, with the high-dose group resulting in a significant increase of 595.0% compared to the OVX control group (p < 0.001).

[0086] 2.6.4 Magnetic resonance imaging (MRI) assessment of muscle edema

[0087] Acquire T1 and T2 signal images of the hind limbs of anesthetized mice, such as Figure 3 A, OVX-induced SP mice exhibited marked muscle edema, characterized by T1 hypointensity and T2 hyperintensity (red triangles), consistent with inflammatory tissue changes. ALN treatment failed to alleviate these abnormalities. In contrast, BYD-treated mice exhibited a significant reduction in muscle edema, indicating that BYD effectively inhibits inflammation-induced edema in SP muscle tissue.

[0088] Example 3: Study on the mechanism of action of BYD in treating SP

[0089] 3.1 Experimental verification of the expression of the key target CXCR4 in the OVX mouse model

[0090] Experimental methods: SPF female C57BL / 6 mice were divided into SHAM group, OVX group and BYD high-dose group (0.52g crude drug / kg / d), with n=6 in each group. The OVX model was the same as in Example 2. The animals were sacrificed after 16 weeks of administration, and gastrocnemius muscle samples were collected. Total RNA of gastrocnemius muscle was extracted and reverse transcribed into cDNA. Real-time quantitative PCR was performed using SYBR Green method to detect the mRNA expression levels of CXCR4, CCL2, CD274, and CD44. GAPDH was used as the internal reference gene, and 2 -ΔΔCT The primer sequences are shown in Table 3.

[0091] Experimental results: To verify the core targets predicted by bioinformatics, the present invention conducted gene expression profiling analysis on the gastrocnemius muscle of OVX-induced osteoporosis model mice: CXCR4 ( Figure 4 A): Compared with the SHAM group, the mRNA expression of CXCR4 in the gastrocnemius muscle of mice in the OVX model group was significantly decreased (p<0.05). High-dose BYD treatment significantly upregulated the expression of CXCR4, restoring it to near normal levels (compared with the OVX group, p<0.001). CCL2 ( Figure 4 B): There was no significant difference in CCL2 mRNA expression among the three groups (p>0.05). Figure 4 C): The expression of CD274 mRNA in the OVX group showed an upward trend compared with the SHAM group, but the difference was not statistically significant (p = 0.089); there was no significant change in expression after BYD-H intervention (p > 0.05). Figure 4 D): The expression level of CD44 mRNA was stable among the groups, with no statistical difference (p>0.05). Figure 4 E) LEP mRNA expression in the OVX group showed a downward trend compared with the SHAM group, but did not reach a significant level (p = 0.112); there was no significant change in expression after BYD-H intervention (p > 0.05).

[0092] 3.2 In vitro pharmacodynamics and ferroptosis mechanism of BYD on primary muscle satellite cells (MuSCs)

[0093] 3.2.1 General Methods for Isolation, Culture, and Drug Treatment of MuSCs

[0094] (1) MuSCs isolation and culture: Primary muscle satellite cells were isolated from the hind limb muscles of 2-week-old female C57BL / 6 mice purchased from the Animal Center of Zhejiang Chinese Medical University, following a previously established protocol. The cells were cultured in a proliferation medium consisting of DMEM / F12 (1:1) (CGM104.05, Cellmax, Gansu, China) supplemented with 10% fetal bovine serum (10099141, Gibco, New York, USA) and antibiotics (100 U / mL penicillin, 0.1 mg / mL streptomycin) at 37°C in a humidified incubator with 5% CO2. Cells were not used for in vitro experiments after passage no more than 5 times. Differentiation was induced in DMEM / F12 (1:1) (CGM104.05, Cellmax) supplemented with 2% horse serum (S9050, Solarbia, Beijing, China) and antibiotics at 37°C in a humidified incubator with 5% CO2.

[0095] (2) Drug concentration screening: Cell proliferation was assessed using a CCK-8 assay kit (BA00208, Biosun, Beijing, China). MuSCs were seeded in 96-well plates and treated with different concentrations of BYD (BYD lyophilized powder in Example 1 was dissolved in water) or Erastin. After incubation with CCK-8 reagent, the absorbance at 450 nm was measured using a multi-mode microplate reader. Figure 3 I) and BYD( Figure 3 The results of a CCK8 experiment using a 0.25 μmol / ml concentration of β-actin (H) and the optimal concentration were selected. Erastin at 0.25 μmol / ml significantly inhibited cell viability without causing excessive cell death. BYD at 0.25-1 mg / ml had no significant toxicity to cells and showed potential protective effects. Therefore, subsequent experiments used a gradient of Buyang Decoction (0.25 mg / ml, 0.5 mg / ml, 1 mg / ml) and 0.25 μmol / ml of Erastin for intervention.

[0096] (3) Drug treatment groups: The main groups for subsequent in vitro experiments were: control group (CTRL, given the corresponding solvent); Erastin treatment group (E group, Erastin 0.25 μmol / ml); Erastin combined with BYD low, medium, and high dose treatment groups (E+LOW, E+MEDIUM, E+HIGH, corresponding to Erastin 0.25 μmol / ml combined with BYD 0.25, 0.5, and 1 mg / ml, respectively).

[0097] 3.2.2 Methods and results of BYD's effects on erastin-induced ferroptosis-related phenotypes in MuSCs

[0098] (a) Cell proliferation (EdU proliferation assay): Schematic diagram of the EdU assay for observing the proliferation of mouse MuSCs ( Figure 3 J) and statistical analysis of positive results ( Figure 3 K, n=3) showed that treatment with Erastin (group E) significantly inhibited the proliferation of MuSCs, with the number of EdU-positive cells decreasing by 76.5% compared with the control group (CTRL) (p<0.001). BYD treatment restored the proliferation of MuSCs in a dose-dependent manner, with the highest concentration of BYD (group E+HIGH) significantly increasing the number of EdU-positive cells by 527.8% compared with group E (p<0.001).

[0099] (b) Cell death (Annexin V-FITC / PI cell apoptosis detection): Annexin V-FITC / PI fluorescence staining results ( Figure 3 L) showed that the apoptotic and ferroptotic cell populations increased significantly after exposure to Erastin (group E). The proportion of Annexin V-FITC-positive (green fluorescence, indicating early apoptosis / membrane turnover) MuSCs ( Figure 3 M) increased sharply by 403.9% compared with the CTRL group (p<0.001). The proportion of PI-positive (red fluorescence, representing late apoptosis / necrosis) cells ( Figure 3 BYD treatment significantly reduced the proportion of Annexin V-FITC- and PI-positive cells in a concentration-dependent manner. The highest dose group (E+HIGH group) reduced the apoptotic / ferroptotic cell population by 89.6% compared with the E group (for Annexin V, p < 0.01).

[0100] (c) Myogenic differentiation (MYOG cell immunofluorescence staining): MYOG immunofluorescence staining ( Figure 3 Confocal microscopy images of O) and corresponding statistical analysis of mean fluorescence intensity ( Figure 3 P) shows decreased MYOG expression in erastin-treated MuSCs (group E), confirming impaired ferroptosis-induced myogenic differentiation. BYD administration resulted in a dose-dependent increase in MYOG expression, with the highest dose (group E+HIGH) significantly increasing the number of MYOG-positive cells (or mean fluorescence intensity) by 245.6% compared to group E.

[0101] (d) Intracellular ROS level: DCFH-DA staining image ( Figure 3 Q) and the corresponding fluorescence intensity results ( Figure 3R, n=3) showed that after erastin treatment (group E), intracellular reactive oxygen species levels increased dramatically by 6498.4% compared with the CTRL group (p<0.001). BYD administration dose-dependently reduced the accumulation of reactive oxygen species, with the highest dose (group E+HIGH) reducing reactive oxygen species levels by 99.3% compared with the E group (p<0.001).

[0102] (e) Lipid peroxidation: Nile red staining image ( Figure 3 S) and statistical analysis of mean fluorescence intensity ( Figure 3 Figure 3 (n=3) confirmed excessive lipid peroxidation in Erastin-treated MuSCs (group E). BYD significantly reversed this effect in a dose-dependent manner, reducing Nile red fluorescence intensity.

[0103] (f) Antioxidant index (GSH detection and MDA detection): Kit detection showed that GPX activity ( Figure 3 U) decreased sharply by 737.4% compared with the CTRL group (p < 0.01), while the MDA level ( Figure 3 BYD administration reversed the trend, with the highest dose (E+HIGH group) significantly increasing GPX activity by 200% (p<0.05) and reducing MDA levels by 76.9% (p<0.001).

[0104] (g) GPX4 and MYOG mRNA and protein expression (qRT-PCR and WB)

[0105] Methods: qRT-PCR: Total RNA was extracted and reverse transcribed into cDNA. Real-time quantitative PCR was performed using SYBR Green to detect the mRNA expression of GPX4 and MYOG. GAPDH was used as an internal reference. -ΔΔCT The primer sequences are shown in SEQ ID NOs. 7-8, 5-6, and 1-2. Western blot analysis (WB): Total proteins were extracted, separated by SDS-PAGE, and transferred to a PVDF membrane. The membrane was incubated with a primary antibody against GPX4 (Proteintech, 30388-1-AP, 1:800), a primary antibody against MYOG (Abclonal, A6664, 1:4000), or a β-actin internal control antibody (Huabio, HA722023, 1:20000), followed by incubation with the corresponding secondary antibodies. Protein bands were visualized using a chemiluminescence detection kit (SQ101, Epibio, Shanghai, China) and scanned using a membrane imaging system (ChemiDoc XRS+, Bio-Rad, CA, USA). Band intensities were quantified using Image Lab software (Bio-Rad).

[0106] Results: qRT-PCR analysis showed that after Erastin (Group E) treatment, GPX4 ( Figure 3 W) and MYOG( Figure 3 BYD treatment significantly restored the expression of GPX4 and MYOG. At the highest dose (E+HIGH group), GPX4 and MYOG mRNA levels increased by 326.2% and 291.9%, respectively (p<0.001). Similarly, Western blot ( Figure 3 Y, 3Z) confirmed that GPX4 and MYOG protein levels also followed the same trend, and BYD administration reversed the erastin-induced inhibition in a dose-dependent manner.

[0107] 3.3 Study on the Mechanism of CXCR4 in BYD (In Vitro)

[0108] Effect of BYD on CXCR4 and GPX4 Expression in Erastin-treated MuSCs

[0109] Immunofluorescence double staining showed that compared with the CTRL group, the E group intervention significantly reduced the expression of CXCR4 and GPX4 in MuSCs (the average fluorescence intensity decreased by 68.8% and 63.3%, Figure 5 D and Figure 5 BYD gradually increased the expression of CXCR4 and GPX4 in a dose-dependent manner, and 1 mg / ml BYD (E+HIGH group) significantly increased the expression of CXCR4 and GPX4 (263.7% and 191%, p<0.001).

[0110] Effect of BYD on CXCR4 protein expression in erastin-treated MuSCs

[0111] Western Blot results ( Figure 5 F, 5G) showed that Erastin treatment (group E) significantly downregulated the expression of CXCR4 protein in MuSCs, and BYD could effectively reverse this decrease in a concentration-dependent manner.

[0112] 3.3.3 Construction of CXCR4 Knockdown (CXCR4-KD) MuSCs Model (Lentiviral Transfection)

[0113] Method: As Figure 5For experiments performed with H, the optimal multiplicity of infection (MOI) for lentiviral transduction was determined to be 100. Primary MuSCs were cultured to 90–95% confluence and transfected with Cas9-expressing lentivirus (LVCON249, GENE) in the presence of HitransG P transduction enhancer (REVG003, GENE, Shanghai, China). Forty-eight hours later, transfected cells were selected with 0.8 μg / mL puromycin (REVG1001, GENE) for 72 hours. Following selection, cells were expanded and re-transfected with CXCR4-expressing lentivirus (presumably a CXCR4-targeting sgRNA lentivirus) (GENE, Shanghai) under the same conditions to achieve CXCR4 knockdown. A control group (KD-Control) was also established, transfected with a non-targeting sgRNA lentivirus. Puromycin selection (0.8 μg / mL) was applied for an additional 72 hours to ensure stable CXCR4 knockdown. Transfection efficiency was confirmed by qRT-PCR and Western blot analysis. The CXCR4 knockdown primer sequences and their control sequences are shown in Table 4 .

[0114] Results: The CXCR4-KD MuSCs model was successfully established. Compared with the KD-Control group, the CXCR4 mRNA expression in the CXCR4-KD group was significantly increased ( Figure 13 C) and protein expression ( Figure 5 R, 5S) were significantly decreased.

[0115] Table 4: Lentiviral sgRNA sequences and control sequences

[0116] sequence 5’ STEM 3’ Cxcr4-sgRNA-a (SEQ ID NO. 21) CACC CGGCAATGGATTGGTGATCC Cxcr4-sgRNA-b (SEQ ID NO. 22) aaac GGATCACCAATCCATTGCCG c Control Sequences(SEQ ID NO.23) CGCTTCCGCGGCCCGTTCAA

[0117] 3.3.4 Effects of CXCR4 knockdown on ferroptosis-related phenotypes of MuSCs and the efficacy of BYD (1 mg / ml)

[0118] KD-Control cells and CXCR4-KD cells were respectively set up as untreated group (KD-Control or CXCR4-KD) and BYD-only treatment group (KD-Control+BYD or CXCR4-KD+BYD).

[0119] (a) Intracellular ROS levels (DHE staining of transfected cells): Compared with the KD-Control group, the intracellular ROS levels in CXCR4-KD MuSCs ( Figure 5 BYD treatment could reduce the ROS level in KD-Control cells, but BYD could not effectively reduce the elevated ROS level in the CXCR4-KD group.

[0120] (b) Lipid peroxidation (Nile red staining): Under CXCR4-KD conditions, lipid peroxidation increased by 137.2% compared with the KD-Control group (p < 0.001, Figure 5 L, 5K). BYD treatment reduced lipid peroxidation in KD-Control cells but failed to reverse the increased lipid peroxidation in CXCR4-KD cells.

[0121] (c) Cell proliferation (EdU proliferation assay): Compared with the KD-Control group, CXCR4 knockdown (CXCR4-KD group) significantly reduced cell proliferation (red area represents proliferating cells, blue area represents DAPI nucleus staining) by 72.2% (p < 0.001) ( Figure 5 BYD treatment promoted the proliferation of KD-Control cells, and this decrease could not be rescued by Buyang Decoction treatment.

[0122] (d) Myogenic differentiation (MYOG cell immunofluorescence staining, qRT-PCR, Western Blot): MYOG immunofluorescence staining ( Figure 5 O, red area represents MYOG positive expression, blue area represents cell nucleus) and its statistics ( Figure 5 P, n = 3) further confirmed that CXCR4-KD significantly reduced MYOG expression, indicating that Buyang Decoction promoted MuSC myogenic differentiation by upregulating CXCR4 (p < 0.001). BYD weakened the promoting effect of MYOG in CXCR4-KD cells. qRT-PCR ( Figure 5 Q, Figure 13 A) shows that CXCR4 knockdown significantly reduced MYOG mRNA expression compared with the KD-Control group (MYOG mRNA level decreased by 71.4%, p<0.001). However, under CXCR4 knockdown conditions, BYD treatment could not effectively restore MYOG expression. Western Blot ( Figure 5 R, 5S) results were consistent with the mRNA trend. CXCR4 knockdown significantly reduced MYOG protein expression (reduction by 38.6%, p < 0.05). Under CXCR4 knockdown conditions, BYD treatment could not effectively restore MYOG protein expression.

[0123] (e) GPX4 expression and GPX activity: qRT-PCR ( Figure 5 Q, 13B) and Western blot ( Figure 5R, 5S) analysis showed that GPX4 expression was significantly reduced in the CXCR4 knockdown group. Western blot analysis showed that the protein level decreased by 53.0%; qRT-PCR analysis showed that the mRNA level decreased by 25.97%. BYD failed to effectively upregulate GPX4 expression in CXCR4-KD cells. GPX content (should be activity) detection ( Figure 5 T) showed that GPX activity in the CXCR4 knockdown group was reduced by 94.4% compared with the KD-Control group (p < 0.01). Buyang Decoction applied to CXCR4 knockout cells failed to enhance GPX activity.

[0124] 3.4 In vivo validation of the effect of CXCR4 inhibitor AMD3100 on BYD in the treatment of SP in OVX mice

[0125] (1) Experimental animals, grouping and drug administration Figure 6 A) Thirty-five mice were randomly divided into five groups: SHAM, OVX, AMD3100 (5 mg / kg / d), BYD (0.52 g crude drug / kg / d), and AMD3100 (5 mg / kg / d) + BYD (0.52 g crude drug / kg / d). All groups, except the SHAM group, underwent OVX modeling. AMD3100 powder was dissolved in saline and administered intraperitoneally daily, while BYD was dissolved in purified water and administered orally daily for 16 weeks. After 16 weeks, weekly grip strength and rotarod tests were performed. Tissues were collected at the end of the 16th week for gait analysis and other experiments.

[0126] (2) CXCR4 and GPX4 expression: Gastrocnemius paraffin sections were double-stained with immunofluorescence for CXCR4 (red fluorescence) and GPX4 (green fluorescence). Figure 6 B, 6C, 15A), AMD3100 failed to increase CXCR4 expression compared to the OVX group. Furthermore, AMD3100 abolished the BYD treatment effect by preventing the restoration of CXCR4 expression in SP mice. GPX4 also showed a similar expression pattern, strengthening the functional link between CXCR4 and GPX4. qRT-PCR ( Figure 6 D) shows that the mRNA level of CXCR4 in mice treated with AMD3100 was significantly lower than that in animals treated with BYD. Figure 6 U) also showed that the degree of GPX4 recovery was lower in the AMD3100+BYD group compared with BYD alone.

[0127] (3) Muscle function (rotarod, grip strength, gait analysis): Compared with the SHAM group, the grip strength of the OVX group, the AMD3100 group, and the AMD3100+BYD group ( Figure 6 E) and rotarod residence time ( Figure 6F) were significantly reduced (p<0.01). In contrast, the BYD treatment group alone showed significant improvement in muscle performance, reaching a level comparable to that of the SHAM group. Gait analysis ( Figure 6 G, 6H, Figure 15 BM) showed that BYD intervention alleviated SP-induced impairments in stride length, swing phase, and stance phase. However, the AMD3100-treated group showed no significant improvement compared with OVX mice, indicating that CXCR4 inhibition impaired BYD-mediated functional recovery.

[0128] (4) Muscle morphology (gross morphology, HE staining, Laminin2α immunofluorescence, TEM): The gross morphology of the gastrocnemius muscle is as follows: Figure 15 P, Compared with the control group, the length and width of the gastrocnemius muscle of mice treated with Buyang Decoction increased significantly ( Figure 15 N, Figure 15 O, p<0.001). In contrast, the muscle size of the AMD3100 and AMD3100+Buyang Decoction groups was comparable to that of OVX mice. Figure 6 J, Laminin2α staining results are shown in Figure 6 K, red represents Laminin2α positive expression, blue represents DAPI nuclear staining, CSA statistics are shown in Figure 6 I: Compared with the SHAM group, the CSA of the OVX group was significantly reduced (p<0.001), and both HE staining and Laminin2α staining showed muscle atrophy. Buyang decoction treatment significantly increased myofiber size, while there was no significant difference between the AMD3100 treatment group and the OVX control group. Transmission electron microscopy analysis ( Figure 6 M, 6L) showed that Buyang Decoction treatment restored the reduced sarcomere length in sarcopenic mice. In contrast, AMD3100 treatment abolished this effect.

[0129] (5) Expression of myogenic differentiation factors (MYOD, MYOG): qRT-PCR analysis showed that MYOD ( Figure 6 N) and MYOG( Figure 6 O) mRNA levels were significantly downregulated, while BYD treatment effectively restored its expression. AMD3100 combined treatment inhibited the restoration effect of BYD.

[0130] (6) Oxidative stress (DHE staining) and mitochondrial morphology (TEM): DHE fluorescence staining ( Figure 6 P is the DHE staining result of the paraffin section of gastrocnemius muscle. The red area represents reactive oxygen species, and the blue area represents DAPI cell nucleus staining. Figure 6Q is a statistical graph) showed that the ROS levels in the OVX group, AMD3100 group and AMD3100+BYD group were significantly increased, while BYD treatment effectively reduced the accumulation of ROS. TEM imaging of mitochondria in gastrocnemius muscle ( Figure 6 R) further showed that the OVX group, AMD3100 group, and AMD3100+BYD group had mitochondrial damage (swelling, cristae breakage, and outer membrane rupture), which are characteristic of ferroptosis. In contrast, BYD-treated mice maintained relatively intact mitochondrial structure.

[0131] (7) GPX4 expression: Immunohistochemical analysis of GPX4 ( Figure 6 S, 6T) showed that GPX4 expression was significantly decreased in the OVX, AMD3100, and AMD3100+BYD groups compared with the SHAM group. In contrast, GPX4 levels were significantly increased in BYD-treated mice. qRT-PCR analysis ( Figure 6 U) demonstrated that GPX4 mRNA levels were significantly decreased in OVX and AMD3100-treated mice, as well as in the AMD3100+BYD group, compared with animals treated with BYD alone.

[0132] In summary, in vitro experiments showed that BYD has the following effects: promoting the proliferation and differentiation of muscle satellite cells (MuSCs); reducing the level of oxidative stress and lipid peroxidation in MuSCs induced by Erastin; upregulating the expression of GPX4 and CXCR4 in MuSCs, and reversing the erastin-induced downregulation of GPX4 and CXCR4 expression; knockdown of CXCR4 weakened the protective effect of BYD on MuSCs, including proliferation, differentiation and anti-ferroptosis ability.

[0133] In vivo experiments showed that BYD has the following effects: enhancing muscle strength and exercise endurance of OVX mice; improving gait parameters of OVX mice; increasing the width and length of the gastrocnemius muscle of OVX mice, increasing the cross-sectional area of ​​muscle fibers, and improving the sarcomere structure; upregulating the expression of myogenesis-related factors MYOD and MYOG in the muscle tissue of OVX mice; reducing oxidative stress in the muscle tissue of OVX mice and protecting mitochondrial structure; upregulating the expression of GPX4 and CXCR4 in the muscle tissue of OVX mice; the CXCR4 inhibitor AMD3100 can eliminate the protective effect of BYD in the SP mouse model, including muscle function, morphology, MYOD / MYOG expression, ROS level, GPX4 expression, etc., further confirming the key role of CXCR4.

[0134] These results collectively indicate that the composition can effectively inhibit ferroptosis, protect muscle satellite cell function, promote muscle regeneration, prevent and treat sarcopenia by upregulating the expression of CXCR4 in muscle cells and thereby upregulating the expression of GPX4, and has good safety.

[0135] The raw medicinal materials used in the present invention, Eucommia ulmoides, Epimedium, Psoralea corylifolia, and Cuscuta chinensis, are all qualified medicinal materials that comply with the provisions of the Pharmacopoeia of the People's Republic of China or relevant drug standards and can be purchased from regular medicinal material markets.

Claims

1. A Chinese medicine composition for preventing and treating sarcopenia, characterized in that: The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 5-15 parts of Eucommia ulmoides; 5-15 parts of Epimedium; 5-15 parts of Psoralea corylifolia; and 5-15 parts of Cuscuta chinensis.

2. The Chinese medicine composition according to claim 1, characterized in that: The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 10 parts of Eucommia ulmoides, 10 parts of Epimedium brevicornum, 10 parts of Psoralea corylifolia and 12 parts of Cuscuta chinensis.

3. The Chinese medicine composition according to claim 1 or 2, characterized in that: The traditional Chinese medicine composition is used for preventing and treating sarcopenia by upregulating CXCR4 expression and inhibiting GPX4-mediated ferroptosis.

4. A method for preparing the Chinese medicine composition according to any one of claims 1 to 3, characterized in that: The following steps are involved: Weigh the raw materials according to the weight proportions as claimed in claim 1 or 2, add water to decoct and extract, combine the extracts, and concentrate.

5. The preparation method according to claim 4, characterized in that: The extraction step comprises: adding 8-10 times the amount of water to the raw material drug, soaking for more than 30 minutes, boiling for 1-2 hours, and collecting the filtrate; adding 6-8 times the amount of water to the filter residue, boiling for 1-2 hours, and collecting the filtrate; and combining the two filtrates.

6. The preparation method according to claim 4 or 5, characterized in that: The concentration step comprises concentrating the combined filtrate under reduced pressure, or drying to form a dry extract, or freeze-drying to form a powder.

7. A Chinese medicine preparation for preventing and treating sarcopenia, characterized in that: The traditional Chinese medicine preparation is a decoction, granules, pills, tablets, capsules or oral liquid prepared from the traditional Chinese medicine composition according to claims 1 to 3 or the composition prepared by the preparation method according to claims 4 to 6.

8. The Chinese medicine preparation according to claim 7, characterized in that: The traditional Chinese medicine preparation is a decoction or a granule.

9. Use of the traditional Chinese medicine composition according to any one of claims 1 to 3 or the traditional Chinese medicine composition prepared by the preparation method according to any one of claims 4 to 6 in the preparation of a medicament for preventing or treating sarcopenia.

10. Use of the traditional Chinese medicine composition according to any one of claims 1 to 3 or the traditional Chinese medicine composition prepared by the preparation method according to any one of claims 4 to 6 in inhibiting muscle cell ferroptosis and / or preparing a ferroptosis inhibitor.

Images