Phytophthora sojae FHA1 protein and application thereof in screening PPI inhibitor

Abstract

The invention discloses an FHA1 protein from Phytophthora spp. And an application of the FHA1 protein in screening of a protein-protein interaction (PPI) inhibitor. The amino acid sequence of the FHA1 protein is shown as a sequence 3. The protein can interact with phytophthora sojae 14-3-3 protein, and plays a key role in the production process of pathogenic bacteria sporangium and zoospore. By targeting the interaction between the FHA1 protein and phytophthora 14-3-3 protein, the interaction between the FHA1 protein and phytophthora 14-3-3 protein is inhibited so as to influence the normal life activity of phytophthora sojae, and the FHA1 protein can be used as a bacteriostatic or bactericide target for screening phytophthora bacteriostat or bactericide.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an FHA1 protein from Phytophthora sojae and an application thereof in screening protein-protein interaction (PPI) inhibitors. Background Art

[0002] Oomycetes are widely distributed, with hosts encompassing both the plant and animal kingdoms. Although morphologically similar to fungi, they are evolutionarily closer to diatoms and brown algae. Plant pathogenic oomycetes infect a wide variety of crops, causing significant agricultural economic losses worldwide. Plant pathogenic oomycetes account for approximately 60% of all oomycetes and can be categorized into genera such as Phytophthora, Pythium, and Peronospora. Phytophthora spp. are particularly detrimental to agricultural production. Soybean Phytophthora sojae is a typical soilborne plant pathogen that can cause seed rot, seedling blight, root rot, and stem rot in soybeans, causing severe damage. Currently, chemical control is the primary method for controlling Phytophthora pathogenic oomycetes that cause crop diseases. Due to phylogenetic differences between oomycetes and filamentous fungi, relatively few specific agents are currently available for controlling oomycetes. Commonly used pesticides in production, such as metalaxyl and dimethomorph, were developed between the 1970s and 1990s. Their long-term, large-scale use in production has led to the growing problem of drug resistance. Therefore, the development of novel target-targeting oomycete fungicides is particularly important and urgent, becoming a major national need in recent years.

[0003] Proteins are the fundamental building blocks of life, composed of amino acids. Genetically encoded amino acids form peptides, which in turn form various proteins, which in turn form living tissues. Proteins also play crucial roles in biological processes, such as catalytic reactions, transport molecules, immune responses to various pathogens, and intercellular signaling. Many of these biological activities are regulated by protein complexes, often controlled by protein-protein interactions (PPIs). PPIs form a complex network within cells, known as the "interactome." It is estimated that the human interactome contains approximately 130,000 to 650,000 types of PPIs. The interactome plays an important role in physiological and pathological processes, including signal transduction, cell proliferation, growth, differentiation, and apoptosis. Abnormal PPIs are associated with numerous human diseases, such as cancer, infectious diseases, and neurodegenerative disorders. While typical drug targets in the past were enzymes, ion channels, or receptors, PPIs have recently emerged as new potential therapeutic targets. Therefore, targeting PPIs is a new direction for disease treatment and a key strategy for new drug development. Over the past few decades, PPI modulators have been considered one of the most challenging tasks in drug discovery. In recent years, some PPI regulators have entered clinical research, and some have been approved for marketing, indicating that regulators targeting PPIs have broad prospects.

[0004] 14-3-3 proteins play a crucial role in PPIs. In most organisms, 14-3-3 proteins are a conserved, ubiquitous family of proteins encoded by diverse genes. In mammals, there are at least seven conserved 14-3-3 protein isoforms, each encoded by a distinct gene. 14-3-3 proteins bind to a variety of ligands, including kinases, phosphatases, and transmembrane receptors. 14-3-3 proteins regulate the activity of over 500 endogenous molecules. Because these endogenous molecules play key roles in cellular metabolism, cell cycle regulation, apoptosis, cell differentiation, transcription, signal transduction, and other important biological events, interfering with their activity can have serious cellular consequences. 14-3-3 proteins can interact with a wide range of proteins, influencing the activity, localization, and stability of downstream proteins. They are involved in diverse biological processes, including neuronal development, cell cycle regulation, apoptosis, cell signaling, and stress responses, making them a prime target for small molecule modulators of PPIs.

[0005] Mizoribine is a novel imidazole nucleoside agent with immunosuppressive activity. It has been approved in Japan and its combination with glucocorticoids has been used for lupus nephritis and rheumatoid arthritis after renal transplantation. Reports have shown that mizoribine can bind to the 14-3-3 protein and affect its conformation, thereby affecting its interaction with target proteins. Summary of the Invention

[0006] The inventors discovered a novel 14-3-3 target protein in Phytophthora sojae, which contains only a forkhead-associated domain (FHA) and is named FHA1. The FHA domain is a small phosphopeptide recognition module consisting of approximately 95-120 residues, folded into an 11-stranded β-sandwich, and is named for the winged helix structure of its DNA binding region. During signal transduction, the FHA domain specifically recognizes phosphothreonine residues, exhibiting varying ligand specificity, including pTXXD motifs and pTXXI / L motifs. In eukaryotes, proteins containing FHA domains are mostly localized to the cell nucleus and participate in the regulation of various life processes. The DNA damage response is a typical signaling cascade in eukaryotes in which the FHA1 protein participates. FHA1 participates in the multi-level regulation of the DNA damage signaling network, including the establishment of the G1, S, and G2 checkpoints, checkpoint maintenance, and the coordination of the localization of signaling molecules at DNA breaks.

[0007] In soybean phytophthora, 14-3-3 protein interacts with FHA1 protein, participates in DNA damage signal response, and then participates in regulating the production of sporangia and zoospores of soybean phytophthora.

[0008] In summary, targeting the interaction between Ps14-3-3 and PsFHA1 to design PPI regulators and develop new oomycete inhibitors has great potential.

[0009] The sequence of the 14-3-3 protein is shown as sequence 1 in the sequence listing. Sequence 1 (Ps14-3-3) in the sequence listing consists of 249 amino acid residues. The DNA sequence (coding gene and cDNA) required to encode the 14-3-3 protein can be specifically shown as sequence 2 in the sequence listing. Sequence 2 (Ps14-3-3) in the sequence listing consists of 751 nucleotides and encodes the protein Ps14-3-3 shown in sequence 1 in the sequence listing.

[0010] Therefore, one of the objects of the present invention is to provide a protein, which is the soybean Phytophthora FHA1 protein, and is named PsFHA1.

[0011] The Phytophthora fumigatus FHA1 protein (such as the soybean Phytophthora fumigatus FHA1 protein, PsFHA1) is the protein of A1), A2), A3), or A4) as follows:

[0012] A1) The amino acid sequences are the proteins shown in 3 in the sequence table;

[0013] A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein as shown in any one of SEQ ID NOs. 3;

[0014] A3) a protein derived from the protein shown in SEQ ID NO: 3 having the same function as that shown in SEQ ID NO: 3, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3;

[0015] A4) an amino acid sequence that has a similarity of more than 85%, preferably more than 90%, and more preferably more than 95% to the amino acid sequence shown in any one of SEQ ID NO: 3 and has the same function as the amino acid sequence shown in any one of SEQ ID NO: 3.

[0016] In order to facilitate the purification of the protein in A1), a tag such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) can be connected to the amino terminus or carboxyl terminus of the protein composed of the amino acid sequence shown in any one of Sequence 3 in the sequence listing.

[0017] The growth and development regulatory proteins in A1)-A4) above are generally natural products, but can also be artificially expressed or synthesized, or their encoding genes can be synthesized and then biologically expressed. The encoding genes for the proteins in A2)-A4) above can be obtained by deleting one or more amino acid residue codons from the DNA sequence shown in SEQ ID NO: 4 in the sequence listing, and / or performing missense mutations of one or more nucleotide pairs, and / or attaching the coding sequence of the aforementioned tag to the 5' and / or 3' ends.

[0018] Among them, in A1), sequence 3 (PsFHA1) consists of 229 amino acid residues.

[0019] A second object of the present invention is to provide a nucleic acid molecule encoding the PsFHA1 protein. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; or RNA, such as mRNA, hnRNA, or tRNA.

[0020] Wherein, the coding gene of the above protein is as follows B1) or B2) or B3):

[0021] B1) are DNA molecules represented by the nucleotide sequences described in Sequence 4 in the sequence listing;

[0022] B2) a cDNA molecule or DNA molecule that has 85% or more, 90% or more, or 95% or more identity with the nucleotide sequence shown in B1) and encodes PsFHA;

[0023] B3) A cDNA molecule or DNA molecule that hybridizes under stringent conditions with the nucleotide sequence defined in B1) or B2) and encodes the above-mentioned PsFHA1 protein.

[0024] In the present invention, the DNA sequence (coding gene and cDNA) required to encode the FHA1 protein of Phytophthora spp. can be specifically as shown in Sequence 4 in the sequence listing. Sequence 4 (PsFHA1) in the sequence listing consists of 696 nucleotides and encodes the protein PsFHA1 shown in Sequence 3 in the sequence listing.

[0025] The third aspect of the present invention provides an original RNA sequence obtained by transcribing any of the above DNA sequences, or a codon-optimized RNA sequence, wherein the sequence of the RNA molecule is as follows C1) or C2):

[0026] C1) an RNA sequence transcribed from the DNA sequence shown in any one of SEQ ID NOs. 4, which has a similarity of 85% or more, preferably 90% or more, more preferably 95% or more, and which has the same function as the RNA sequence transcribed from the DNA sequence shown in SEQ ID NOs. 3;

[0027] C2) An RNA sequence transcribed from the DNA sequence shown in any one of Sequence 4.

[0028] The DNA sequence of the present invention can undergo molecular hybridization with the DNA sequence shown in any one of Sequence 4 in the sequence listing under stringent conditions and encodes a DNA sequence of the protein shown in any one of Sequence 3 in the sequence listing. The above stringent conditions can be hybridization at 65°C using a solution of 6×SSC, 0.5% SDS, followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0029] A fourth object of the present invention is to provide biological materials related to the nucleic acid molecules described above, including recombinant vectors, expression cassettes, recombinant microorganisms, or transgenic plant cell lines. The recombinant vectors may be recombinant expression vectors or recombinant cloning vectors. Among the above-mentioned biological materials, the vectors may be plasmids, cosmids, phages, or viral vectors; the microorganisms may be yeast, bacteria, algae, or fungi, such as Agrobacterium; and the transgenic plant cell lines do not include propagation materials. Specifically, the biomaterials may be any of the following: D1) to D10):

[0030] D1) an expression cassette containing the encoding gene;

[0031] D2) a recombinant vector containing the encoding gene, or a recombinant vector containing the expression cassette described in D1);

[0032] D3) a recombinant microorganism containing the encoding gene, or a recombinant microorganism containing the expression cassette described in D1), or a recombinant microorganism containing the recombinant vector described in D2);

[0033] D4) a transgenic plant cell line containing the encoding gene, or a transgenic plant cell line containing the expression cassette described in D1);

[0034] D5) transgenic plant tissue containing the encoding gene, or transgenic plant tissue containing the expression cassette described in D2);

[0035] D6) a transgenic plant organ containing the encoding gene, or a transgenic plant organ containing the expression cassette described in D2);

[0036] D7) a nucleic acid molecule that inhibits the expression of the coding gene; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the coding gene, or a nucleic acid molecule that silences the coding gene, or may be a sgRNA fragment that encodes and expresses a target gene to be knocked out, such as the sgRNA sequence (coding sequence) CTTCTCCAGCGCCTGAGTGA targeting the PsFHA1 coding gene;

[0037] D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7);

[0038] D9) a nucleic acid molecule that inhibits translation of the above-mentioned RNA molecule;

[0039] D10) producing an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line for the nucleic acid molecule described in D9).

[0040] A fifth object of the present invention is to provide applications of the Phytophthora spp. FHA1 protein and nucleic acid molecules encoding the Phytophthora spp. FHA1 protein or nucleic acid molecules encoding the PsFHA1 protein in biological materials.

[0041] The application is any one or more of the following 1)-3):

[0042] 1) Application in regulating (increasing or decreasing) the yield of sporangia and / or zoospores of Phytophthora;

[0043] 2) Application in interaction with Phytophthora 14-3-3;

[0044] 3) Application in inhibiting and / or killing Phytophthora pathogens.

[0045] Preferably, the application includes achieving the application described in 1)-3) by inhibiting the transcription of the coding gene described in sequence 4 or making it lose its activity, or inhibiting the translation of the RNA molecule, or inhibiting the activity of the FHA1 protein of the Phytophthora parasitica described in sequence 1 or 3 or making it lose its activity.

[0046] In the application, the sporangium and zoospore production is affected by inhibiting the transcription of the above-mentioned coding gene, or inhibiting the translation of the above-mentioned RNA sequence, or inhibiting and / or inactivating the activity of the above-mentioned Phytophthora fumigatus FHA1 protein, thereby inhibiting and / or killing the growth of Phytophthora fumigatus.

[0047] The sixth object of the present invention is to provide the use of the soybean Phytophthora FHA1 protein shown in Sequence 3 in the sequence list and the encoding gene shown in Sequence 4 in the above sequence list as antibacterial or fungicide targets in screening antibacterial or fungicide agents for pepper Phytophthora.

[0048] or applications in screening for protein-protein interaction (PPI) inhibitors;

[0049] The protein-protein interaction (PPI) inhibitor is a substance that can inhibit the interaction between the Phytophthora spp. FHA1 protein and the Phytophthora spp. 14-3-3 protein, wherein the sequence of the Phytophthora spp. 14-3-3 protein is shown in Sequence 1 in the sequence listing.

[0050] A seventh object of the present invention is to provide a method for screening or assisting in screening soybean phytophthora antifungal and / or fungicide or screening protein-protein interaction (PPI) inhibitors, the method comprising applying a test substance to the soybean phytophthora pathogen; when the test substance can inhibit the transcription of the above DNA sequence, or inhibit the translation of the above RNA sequence, or inhibit the activity of the soybean phytophthora FHA1 protein as shown above or inactivate it, the test substance is a candidate for the plant phytophthora antifungal and / or fungicide; or applying the test substance to the soybean phytophthora pathogen; when the test substance can inhibit the interaction between the phytophthora pathogen FHA1 protein and the phytophthora 14-3-3 protein, the test substance is a protein-protein interaction (PPI) inhibitor.

[0051] An eighth object of the present invention is to provide a method for reducing the activity of Phytophthora sojae, comprising the steps of: inhibiting the transcription of the aforementioned coding gene or causing its deletion, or inhibiting the translation of the aforementioned RNA molecule, or inhibiting the activity of the aforementioned Phytophthora fumigatus FHA1 protein or causing its inactivity;

[0052] Wherein, the reducing the activity of Phytophthora sojae is reducing the yield of sporangium and zoospore.

[0053] In the above method, the activity of the protein is inhibited or inactivated by inhibiting or reducing the expression of the gene encoding the FHA1 protein of Phytophthora spp., specifically, by gene knockout or gene silencing.

[0054] Gene knockout refers to the phenomenon of losing the activity of a specific target gene through homologous recombination. Gene knockout is the loss of activity of a specific target gene through changes in its DNA sequence.

[0055] Gene silencing refers to the phenomenon of preventing or under-expressing a gene without damaging the original DNA. Gene silencing can occur at two levels: one is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects; the other is post-transcriptional gene silencing, which is the inactivation of a gene by specifically inhibiting the target RNA at the level after gene transcription. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translation inhibition.

[0056] Preferably, the gene shown in Sequence 4 in the sequence listing is knocked out to inactivate the protein shown in Sequence 3 in the sequence listing.

[0057] In one embodiment of the present invention, the method for knocking out the above-mentioned gene is a gene knockout method based on CRISPR / Cas9.

[0058] Specifically, the CRISPR / Cas9-based gene knockout method is to transfect the target gene's Donor vector, sgRNA expression vector, and Cas9 expression plasmid into soybean phytophthora to screen for recombinant bacteria in which the target knockout protein loses its activity.

[0059] The donor vector (e.g., pBS-PsFHA1-NPTII) is a recombinant vector containing a sequence 800-1500 bp upstream of the target gene to be knocked out, a donor DNA sequence (which can be a gene sequence such as NPTII, GFP, or RFP), and a sequence 800-1500 bp downstream of the target gene to be knocked out, linked in sequence. The sgRNA and Cas9 protein co-expression plasmid is a vector (e.g., pYF515-PsFHA1) encoding a sgRNA fragment targeting the target gene to be knocked out and a DNA sequence expressing the Cas9 protein. The target gene to be knocked out is sequence 4 in the sequence listing, and the sgRNA sequence targeting the PsFHA1 gene is sgPsFHA1: CTCGGACGAGTGCATCCTAG. Preferably, the sgRNA expression plasmid is based on the pYF515 vector as the starting vector, and the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PsFHA1 gene is inserted between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector to obtain the sgRNA expression plasmid.

[0060] In the above application, the substance that inhibits the expression and / or activity of PsFHA1 protein is a substance that inhibits the expression of PsFHA1 protein and / or inhibits the transcription of the gene encoding PsFHA1 protein and / or inhibits the translation of RNA molecules transcribed from the gene encoding PsFHA1 protein.

[0061] Experiments have demonstrated that the PsFHA1 protein provided by the present invention plays an important role in the growth and development of Phytophthora sojae. PsFHA1 knockout mutants were generated using CRISPR / Cas9 gene editing technology. Compared with wild-type and empty-vector strains, the PsFHA1 knockout mutants showed significantly reduced sporangium and zoospore production. PsFHA1-complemented strains showed no significant differences in hyphal growth rate, sporangium production, or zoospore production compared with the wild-type strain.

[0062] The soybean phytophthora PsFHA1 protein of the present invention plays an important role in the production of soybean phytophthora sporangia and zoospores. The interaction between the two may affect the production of soybean phytophthora sporangia and zoospores. Designing drugs targeting their interaction may be a new drug target. The present invention provides a research basis for potential molecular targets for the prevention and control of plant diseases caused by soybean phytophthora and the development of new fungicides. The interactions between proteins provided by the present invention have significant application potential in the prevention and control of soybean blight caused by soybean phytophthora. The new fungicides developed based on such interactions as targets have important practical significance for controlling the occurrence and spread of crop diseases caused by soybean phytophthora. In addition, the protein interaction regulator mizoribine has antibacterial activity against soybean phytophthora. The development of fungicides based on the interaction between 14-3-3 and its interacting proteins has important practical significance for controlling the occurrence and spread of crop diseases caused by soybean phytophthora. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 Protein expression by co-immunoprecipitation of Ps14-3-3 protein.

[0064] Figure 2 Phylogenetic analysis of the PsFHA1 gene.

[0065] Figure 3 Yeast one-to-one verification (A), luciferase complementation experiment (B), and CO-IP (C) results.

[0066] Figure 4 Gel electrophoresis diagram of PsFHA1 gene knockout vector construction.

[0067] Figure 5 Schematic diagram of PsFHA1 gene knockout and PCR verification of PsFHA1 gene knockout transformants.

[0068] Figure 6Figure 3. Sporangium numbers and zoospore production of P. sojae strain P6497 (WT), empty vector control (EV), PsPsFHA2 knockout transformants (PsFHA1-18, PsFHA1-38), and complemented strain (PsFHA1-C). Figure 6 A is the result of sporangium number, B is the result of zoospore production, and C and D are the statistical results.

[0069] Figure 7 The inhibitory effect of mizoribine on Phytophthora sojae and its effect on the interaction between Ps14-3-3 and PsFHA1. DETAILED DESCRIPTION

[0070] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The materials and reagents used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0071] Soybean Phytophthora strain P6497: A standard strain donated by Professor Brett M. Tyler of Oregon State University, USA. It is stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University and is available to the public from China Agricultural University.

[0072] The pTOR241 vector was a gift from Professor Wang Yuanchao's laboratory at Nanjing Agricultural University. It is described in "Chen Han, Regulatory Mechanism and Biological Function of Hexamethylation (6MA) of Adenine in Genomic DNA of Phytophthora, 2019, Nanjing Agricultural University, PhD Dissertation." It is deposited in the Seed Pathology and Fungicide Pharmacology Laboratory, College of Plant Protection, China Agricultural University and is publicly available from China Agricultural University. The p3FLAGN vector, based on the pTOR241 vector as the original backbone, with Avh241 replaced by a 3×FLAG tag, was modified and maintained by the Pathogen and Fungicide Interaction Laboratory at China Agricultural University and is publicly available from China Agricultural University. The pYF3-eGFP vector was a gift from Professor Brett M. Tlyer's laboratory at Oregon State University. The yeast one-to-one vector and luciferase interaction validation vector were purchased from Shanghai Maokang Biotechnology Co., Ltd.

[0073] The method for constructing a gene point mutation vector based on CRISPR / Cas9 and the sequences of the related vectors in this embodiment are disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.”

[0074] The pBluescript II SK+ homology arm vector plasmid (Donor vector) and the sgRNA and Cas9 co-expression plasmid PYF515 used in this example were donated by Professor Brett M. Tyler of Oregon State University, USA, and are stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. They are available to the public from China Agricultural University.

[0075] Antibiotics: Geneticin (G418), 5×104 μg / mL, Ampicillin (Amp), 1×105 μg / mL, oxathiapiprolin (ox), 100 μg / mL. All antibiotic powders were dissolved in deionized water and filtered through a 0.22 μm filter membrane.

[0076] Culture medium or reagent formulation:

[0077] 10% V8 solid medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir to mix, dilute 10 times with deionized water, i.e., add 900 mL deionized water, add 15 g Agar, and sterilize by high pressure moist heat at 121°C for 20 min.

[0078] 10% V8 liquid medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir and mix, centrifuge at 12000 rpm for 5 minutes, take the supernatant, dilute 10 times with deionized water, and sterilize at 121℃ with high pressure moist heat for 20 minutes.

[0079] Nutrient pea broth (NPB): 125 g peas were added to 1 L of deionized water, sterilized at 121°C with high pressure and heat for 20 min, and filtered through gauze to obtain pea nutrient solution; 2.0 g yeast extract, 5.0 g glucose, 5.0 g mannitol, 5.0 g sorbitol, 2.0 g CaCO3, 0.1 g CaCl2, 0.5 g MgSO4, 3.0 g KNO3, 1.0 g K2HPO4, 1.0 g KH2PO4 were mixed, centrifuged at 3000 rpm for 10 min or allowed to stand for 30 min, the supernatant was collected, and the volume was adjusted to 1 L with pea nutrient solution. 15 g agar powder was added to the solid culture medium (NPBA) and sterilized with high pressure and heat for 20 min. Before use, 2 mL of vitamin stock solution (Biotin 6.7 × 10 -7 g / mL; Folic acid 6.7×10 -7 g / mL; L-inositol 4.0×10 -5 g / mL; Nicotinic acid4.0×10 -5 g / mL; Pyridoxine-HCl 6.0×10 -4 g / mL; Riboflavin 5.0×10 -5 g / mL; Thiamine-HCl 1.3×10 -3 g / mL) and 2 ml of trace element stock solution (FeC6H5O7·3H2O 5.4×10 -4 g / mL; ZnSO4·7H2O 3.8×10 -4 g / mL; CuSO4·5H2O 7.5×10 -4 g / mL; MgSO4·H2O 3.8×10 -5 g / mL; H3BO32.5×10 -5 g / mL; Na2MoO4·H2O 3.0×10 -5 g / mL).

[0080] Pea Mannitol Medium (PM): 91.1 g mannitol, 1 g CaCl2, 2 g CaCO3, add approximately 900 mL pea nutrient solution, stir and mix for about 30 minutes, centrifuge at 3000 rpm for 10 minutes or let it stand for 30 minutes, remove the supernatant, and dilute to 1 L with pea nutrient solution. Add 15 g agar powder to the solid medium (PMA) and sterilize with moist heat for 20 minutes.

[0081] Mycelial hydrolysate (20 mL): 10 mL 0.8 M mannitol, 0.8 mL 0.5 M KCl, 0.8 mL 0.5 M 4-morpholineethanesulfonic acid, 0.4 mL 0.5 M CaCl2, 0.12 g cellulase (Calbiochem, cat. No. 219466), 0.12 g lyase (Sigma, cat. No. L1412), dilute to 20 mL with sterile ultrapure water, mix well to dissolve, filter sterilize with a 0.22 μm filter membrane, and prepare before use.

[0082] MMG solution (250 mL): 18.22 g mannitol, 0.76 g MgCl2·6H2O, 2.0 mL 0.5 M 4-morpholineethanesulfonic acid (pH = 5.7), dilute to 250 mL with ultrapure water, and sterilize by filtration with a 0.22 μm filter membrane.

[0083] W5 solution: 0.1 g KCl, 4.6 g CaCl2·2H2O, 2.25 g NaCl, 7.8 g glucose, dissolve in ultrapure water and dilute to 250 mL, sterilize by filtration with a 0.22 μm filter membrane.

[0084] PEG-CaCl2 solution (40% w / v): 12 g PEG 4000, 3.75 mL 0.5 M CaCl2, 3 mL sterile ultrapure water, sterilized by filtration through a 0.22 μm filter membrane.

[0085] Reagents and culture medium used in the Y2H Gold test:

[0086] YPDA, SD / -Trp, SD / -Leu, SD / -Leu / -Trp, SD / -His / -Leu / -Trp, SD / -Ade / -His / -Leu / -Trp culture media: Dissolve each package of solid powder in deionized water to 500 mL, adjust the pH to 5.8, and sterilize by high-temperature and high-pressure sterilization at 115°C for 15 min. Add 4 g of agar powder for every 200 mL of solid culture medium.

[0087] 0.5× YPDA medium: Dissolve each package of solid powder in deionized water to a volume of 1000 mL, adjust the pH to 5.8, and sterilize by high-temperature and high-pressure sterilization at 115°C for 15 min.

[0088] 2×YPDA medium: Dissolve each package of solid powder in deionized water to a volume of 250 mL, adjust the pH to 5.8, and sterilize by high-temperature and high-pressure sterilization at 115°C for 15 min.

[0089] YPD medium: Dissolve 1 g yeast extract and 2 g tryptone in deionized water to a volume of 100 mL. Sterilize by high-temperature and high-pressure sterilization at 115°C for 15 min.

[0090] 20% glucose: Weigh 20 g of glucose and dissolve it to 100 mL. Sterilize by high temperature and high pressure at 115°C for 15 min.

[0091] 5×TBE buffer: 27.5 g boric acid, 54 g Tris Base, 20 mL 0.5 mol / L EDTA (pH = 8.0), dissolve in deionized water and dilute to 1 L, store at room temperature.

[0092] 10×TE: 10 mmol / L EDTA, 100 mmol / L Tris-HCl, adjust the pH to 7.5, and sterilize under high temperature and high pressure at 115°C for 15 min.

[0093] 10×LiAc: Weigh the volume to prepare a 1 mol / L LiAc solution, and sterilize by filtering through a 0.22 μm bacterial filter.

[0094] 1.1×LiAc / TE: 1.1 mL 10×LiAc, 1.1 mL 10×TE buffer, 7.8 mL sterile water, filter sterilize.

[0095] 1.1×PEG / LiAc: 1 mL 10×LiAc, 1 mL 10×TE Buffer, 8 mL 50% PEG3350, filter sterilize.

[0096] ssDNA (2 mg / mL): Weigh 200 mg of high molecular weight DNA and add 100 mL of TE buffer (10 mM Tris-HCl (pH 8.0); 1.0 mM EDTA). Mix by repeated pipetting with a 10 mL pipette to dissolve the DNA in the solution. Stir using a magnetic stirrer for 2-3 hours until the DNA is completely dissolved. Aliquot and store at -20°C. Boil in boiling water for at least 5 minutes before use and immediately cool in an ice bath.

[0097] 0.9% NaCl: Dissolve 0.9 g NaCl in 100 mL deionized water and filter sterilize.

[0098] Preparation of 20 mg / mL X-α-gal stock solution: dissolve 250 mg X-α-gal in 12.5 mL DMF, filter sterilize, and store at -20°C in the dark.

[0099] Preparation of 500 μg / mL AbA stock solution: Dissolve 1 mg AbA in 2 mL of anhydrous ethanol, filter and sterilize, and store at 4°C in the dark.

[0100] Reagents and culture medium used in LCA test:

[0101] LB medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, and dilute to 1 L with deionized water.

[0102] Antibiotics: Kanamycin (Kanamycin, Kan) with a final concentration of 5×104 μg / mL, and a final concentration of 2.5×10 4 Rifampin (Rif) at a concentration of 1 μg / mL was dissolved in deionized water, filtered using a 0.22 μm filter membrane, and stored at -20°C until use.

[0103] 1M MgCl2: Dissolve 101.65 g MgCl2 in 500 mL deionized water and sterilize by high-temperature and high-pressure steam.

[0104] 0.1 M acetosyringone (Acetosyringone, As): Add 0.0294 g As to 1.5 mL DMSO and filter the organic phase through a 0.22 μm filter membrane.

[0105] 0.5 M MES: Add 9.76 g MES to 80 mL deionized water, adjust the pH to 5.6, make up to 100 mL with deionized water, mix by ultrasonication, and sterilize by filtration through a 0.22 μm aqueous filter.

[0106] Agrobacterium suspension: 1 mL 0.5 M MES, 0.5 mL 1 M MgCl2, 0.1 mL 0.1 M As, and 48.4 mL deionized water were added to prepare 50 mL of Agrobacterium suspension.

[0107] Example 1: Identification of the target protein of Phytophthora sojae Ps14-3-3

[0108] The coding gene (cDNA) Ps14-3-3 of the Ps14-3-3 protein is shown in Sequence Table 2. The sequence consists of 751 nucleotides and encodes the protein Ps14-3-3 shown in Sequence 1 in the sequence table. Sequence 2 can be obtained by using the DNA of the soybean standard strain P6497 as a template and designing primers to amplify the Ps14-3-3-Ptor sequence (Ps14-3-3-Ptor-F: 5-CCTTGAGGTTGCTAGCATGGACCGTGACTCCCTTG-3', Ps14-3-3-Ptor-R: 5-AGAAGTAGGCACCCCGCGGTTACTCCACGTCCTGCAC-3') using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Res ources / Online_In-Fusion_Tools). The material for DNA extraction can be the mycelium of the soybean standard strain P6497.

[0109] Use In- The amplified fragments were sequentially fused and ligated into the cloning vector Ptor-3XFLAG (digested with SacII and NheI) using the HD Cloning Kit. The ligation products were transformed into Escherichia coli DH5α competent cells and cultured overnight at 37°C. The cells were amplified using universal primers Ptor-F (sequence: 5'-CCAAGTCCCAACCGACTCTT-3') / Ptor-R (sequence: 5'-GTTCTACAAACGGCCTTCTT-3') and cloned by sequencing. The recombinant expression vector with the correctly connected Ps14-3-3 sequence was named Ps14-3-3-Ptor.

[0110] Ps14-3-3 overexpression transformants were prepared using a CaCl2-PEG-mediated protoplast transformation method. The method for oomycete genetic transformation was disclosed in the document "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139."

[0111] Soybean Ps14-3-3-3×FLAG protein-expressing transformants were selected and inoculated onto V8 solid plates after Western blotting verification. They were cultured at 25°C for 3 days and then transferred to V8 liquid centrifugation medium. After culture at 25°C for 5 days, mycelia were collected to prepare IP samples of Ps14-3-3 protein from Soybean Ps14-3-3.

[0112] The IP steps are as follows:

[0113] Mycelia overexpressing Ps14-3-3 were collected into 2 mL enzyme-free centrifuge tubes, steel beads were added, and the tubes were cooled in liquid nitrogen. The mycelia were ground into powder using a ball mill. Proteins were extracted using 50 mM Hepes (pH = 7.5) buffer. 80 μL of the obtained protein extract was taken as an input control. The remaining sample was enriched with Flag Beads. The supernatant was removed, and the Flag beads were washed and 50 μL of 2× SDS-PAGE Loading Buffer (non-reducing) was added. The tubes were heated at 50°C for 10 min.

[0114] The supernatant was transferred to a new centrifuge tube and 100 mM dithiothreitol (DTT) was added. After IP sample preparation, mass spectrometry analysis of proteins interacting with Ps14-3-3 was performed at the mass spectrometry laboratory of China Agricultural University. Analysis of the identified candidate interacting proteins, combined with functional domain prediction, number of peptide matches, and scoring, identified a candidate interacting protein with Ps14-3-3, PsFHA1.

[0115] Example 2: PsFHA1 gene sequence analysis

[0116] In this example, the PsFHA1 gene was amplified and sequenced using DNA and cDNA from the P6497 strain of Phytophthora sojae. The PsFHA1 protein domain structure was predicted online using the pfam website (http: / / pfam.xfam.org / ) and mapped using IBS1.0.3. The results revealed that amino acids 48-104 of the PsFHA1 protein contain an FHA domain. Phylogenetic analysis of PsFHA1 proteins from mammals, plants, fungi, and oomycetes revealed that PsFHA1 proteins from P. sojae are more closely related to other Phytophthora species in oomycetes and cluster with the forkhead transcription factor Fhl1 from Phytophthora nicotianae. Figure 2 ).

[0117] Sequence analysis of the FHA1 proteins in plant pathogenic oomycetes and those in humans, mice, Arabidopsis thaliana, and yeast revealed that the FHA1 proteins in P. sojae had a high homology with those in other oomycetes, reaching over 80%, and were approximately 30% homologous to those in Homo sapiens and mice (Table 1).

[0118] Table 1 Homology of PsFHA1 and FHA1 proteins in other species

[0119]

[0120] Example 3: Confirmation of the Interaction between Phytophthora sojae Ps14-3-3 and PsFHA1

[0121] In this example, three methods, namely yeast one-to-one verification, luciferase complementation method and immunoprecipitation CO-IP, were used to verify the interaction between Ps14-3-3 and PsFHA1.

[0122] Vector construction:

[0123] The gene (cDNA) encoding the PsFHA1 protein, PsFHA1, is shown in Sequence Listing 4. Sequence 4 consists of 690 nucleotides and encodes the protein PsFHA1, as shown in Sequence 3. The gene (cDNA) encoding the Ps14-3-3 protein, Ps14-3-3, is shown in Sequence Listing 2. It consists of 751 nucleotides and encodes the protein Ps14-3-3, as shown in Sequence 1. Sequences 2 and 4 were obtained using the cDNA of the standard strain P6497 of Phytophthora sojae as a template. Primers were designed using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools). These primers were used to construct vectors for yeast one-to-one verification, luciferase interaction verification, and co-immunoprecipitation verification, respectively. The target gene sequence was amplified from the cDNA of Phytophthora sojae using the corresponding primers in Table 2 to construct yeast vectors pGBKT7-Ps14-3-3 and pGADT7-PsFHA1; the luciferase complementation vectors nLUC-Ps14-3-3 and cLUC-PsFHA1 were constructed; and the fluorescent immunoprecipitation vectors PYF3-Ps14-3-3 and p3FLAGN-HA-PsFHA1 were constructed.

[0124] Use In- The Ps14-3-3 amplified fragment was fused and ligated into the yeast two-hybrid vector pGBKT7 (digested with Nde I and BamH I) using the HD Cloning Kit to obtain pGBKT7-Ps14-3-3. The PsFHA1 amplified fragment was fused and ligated into the yeast two-hybrid vector pGADT7 (digested with Nde I and BamH I) to obtain pGADT7-PsFHA1. The Ps14-3-3 amplified fragment was fused and ligated into the luciferase interaction verification vector pCAMBIA-split-nLUC (digested with Kpn I and Pst I) to obtain nLUC-Ps14-3-3. The PsFHA1 amplified fragment was fused and ligated into the luciferase interaction verification vector pCAMBIA-split-cLUC (digested with Kpn I and Pst I) to obtain cLUC-PsFHA1. The Ps14-3-3 amplified fragment was fused and ligated into the CO-IP vector pYF3-eGFP (digested with Spe I and Apa I). I digested) to obtain PYF3-Ps14-3-3, and the amplified PsFHA1 fragment was fused and ligated into the CO-IP vector p3FLAGN (digested with Nhe I and Sac II) to obtain p3FLAGN-HA-PsFHA1.

[0125] Use In- Use the HD Cloning Kit to ligate the fragments recovered after PCR amplification to the recovered vectors. Ligation was performed at 50°C for 30 minutes. Vector = (0.02 × fragment length in bp) ng = 0.03 pmol, gene fragment = (0.02-0.04 × fragment length in bp) ng = 0.03-0.06 pmol, 2 × Basic Mix 5 μL, and ddH2O to 10 μL. The ligation product was transformed into competent E. coli DH5α cells and cultured overnight at 37°C. The yeast two-hybrid primers pGBKT7-F / R and pGADT7-F / R listed in Table 3 were used for amplification and sequencing verification of clones. The correct recombinant expression vectors were named pGBKT7-Ps14-3-3 and pGADT7-PsFHA1, respectively. The luciferase-complementary primers nLUC-F / R and cLUC-F / R listed in Table 3 were used for amplification and sequencing verification of clones. The correct recombinant expression vectors were named nLUC-Ps14-3-3 and cLUC-PsFHA1, respectively. The immunoprecipitation primers PYF3-F / R and pTOR-F / R listed in Table 3 were used for amplification and sequencing verification of clones. The correct recombinant expression vectors were named PYF3-Ps14-3-3 and p3FLAGN-HA-PsFHA1, respectively. Plasmids were extracted and used for subsequent experiments.

[0126] Yeast one-to-one verification:

[0127] The pGBKT7-Ps14-3-3 and pGADT7-PsFHA1 plasmids, the pGBKT7-Ps14-3-3 and pGADT7 plasmids, and the pGBKT7 and pGADT7-PsFHA1 plasmids were co-transformed into the yeast strain Y2H Gold, spread on SD-Leu-Trp plates, and cultured in a constant temperature incubator at 30°C for 3-5 days. Monoclonal colonies were picked and diluted 10× and 100×, respectively, and then spotted on SD-Leu-Trp and SD-Ade-His-Leu-Trp / X-α-gal plates. The results showed that all three combinations could grow on SD-Leu-Trp plates after co-transfection. After co-transfection of pGBKT7-Ps14-3-3 and pGADT7-PsFHA1 plasmids, they could grow on SD-Ade-His-Leu-Trp medium supplemented with X-α-gal and turned blue. However, after co-transfection of pGBKT7-Ps14-3-3 and pGADT7 plasmids, and pGBKT7 and pGADT7-PsFHA1 plasmids, they could not grow on SD-Ade-His-Leu-Trp medium supplemented with X-α-gal, indicating that Ps14-3-3 interacts with PsFHA1 proteins. Figure 3 A).

[0128] Luciferase complementation validation:

[0129] The successfully constructed nLUC-Ps14-3-3, cLUC-PsFHA1, empty vector nLUC and cLUC plasmids were respectively transformed into Agrobacterium, and the Agrobacterium culture liquid was recovered according to the instructions. After adjusting the OD to 1.0, the nLUC-Ps14-3-3 and cLUC-PsFHA1 culture liquid, the nLUC-Ps14-3-3 and cLUC culture liquid, the nLUC and cLUC-PsFHA1 culture liquid, and the nLUC and cLUC culture liquid were mixed and injected into 6-week-old tobacco plants, and then fluorescence imaging was performed using a LUCK-2019 live imager. The results showed that nLUC-Ps14-3-3 and cLUC-PsFHA1 mixed bacteria solution could emit fluorescence after co-injection, while nLUC-Ps14-3-3 and cLUC, nLUC and cLUC-PsFHA1, and nLUC and cLUC could not emit fluorescence after co-injection, indicating that Ps14-3-3 interacts with PsFHA1 protein ( Figure 3 B).

[0130] Co-IP:

[0131] The gene (cDNA) encoding the Ps14-3-3 protein in this example is shown as Sequence 2 in the sequence listing. Sequence 2 in the sequence listing consists of 751 nucleotides and encodes the protein Ps14-3-3 shown in Sequence 1 in the sequence listing. Sequence 2 can be obtained by using the cDNA of the soybean Phytophthora standard strain P6497 as a template and using the Ta KaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to design primers to amplify the Ps14-3-3-PYF-GFP sequence (Ps14-3-3-PYF-F: 5'-GATAGGCCTCCGCGGACTAGTATG GACCGTGACTCCCTTG-3', Ps14-3-3-PYF-R: 5'-TGCTCACCATTTACTCCACGT CCTGCAC-3', Ps14-3-3-GFP-F: 5'-CGTGGAGTAAATGGTGAGCAAGGGCGAGG-3', Ps14-3-3-GFP-R: 5'-AGAAGTAGGCACCGGTACCGGGCCCCTACTTGTACA GCTCGTCCATGCC-3'). The gene (cDNA) encoding the PsFHA1 protein is shown in Sequence 4 in the sequence listing. Sequence 4 in the sequence listing consists of 690 nucleotides and encodes the protein PsFHA1 shown in Sequence 3 in the sequence listing. Sequence 4 can be obtained by using the cDNA of the soybean Phytophthora standard strain P6497 as a template and manually designing primers using T4 ligase to amplify the PsFHA1-HA sequence (PsFHA1-HA-F: 5'-AGGCG CGCCATGCAGGCGCCCGGGCTGGA-3', PsFHA1-HA-R: 5'-AGCTTTGTTTAAA CTTAAGCGTAGTCTGGGACGTCGTATGGGTAAGCGTAGTCTGGGACGTCGTA TGGGTAAGCGTAGTCTGGGACGTCGTATGGGTACATAGCAGCAATCTTCTGC TTCTTCAGT-3'), wherein the material for cDNA extraction can be the mycelium of the soybean Phytophthora standard strain P6497.

[0132] Use In- The HD Cloning Kit sequentially fused and ligated the Ps14-3-3 amplified fragments into the cloning vector Ptor-3XFLAG (digested with SpeI and ApaI). The ligation products were transformed into Escherichia coli DH5α competent cells and cultured overnight at 37°C. The cells were amplified using universal primers Ptor-F (sequence: 5'-CCAAGTCCCAACCGACTCTT-3') / Ptor-R (sequence: 5'-GTTCTACAAACGGCCTTCTT-3') and cloned by sequencing. The recombinant expression vector with the correctly connected Ps14-3-3 sequence was named Ps14-3-3-GFP. The amplified fragments of PsFHA1 were sequentially fused and ligated into the cloning vector Ptor-3XFLAG (digested with AscI and PmeI) using T4 ligase. The ligation products were transformed into Escherichia coli DH5α competent cells and cultured overnight at 37°C. The universal primers Ptor-F (sequence: 5'-CCAAGTCCCAACCGACTCTT-3') / Ptor-R (sequence: 5'-GTTCTACAAACGGCCTTCTT-3') were used for amplification and sequencing verification of the clones. The recombinant expression vector with the correctly connected PsFHA1 sequence was named PsFHA1-HA.

[0133] Ps14-3-3 and PsFHA1 co-transformants were prepared using a CaCl2-PEG-mediated protoplast transformation method. The method for oomycete genetic transformation is disclosed in the document "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139." The co-transformants were obtained by using the pYF3-Ps14-3-3 vector and the p3FLAGN-HA-Ps14-3-3 (i.e., HA-PsFHA1) vector together and co-transforming them into soybean Phytophthora sojae P6497 through PEG-mediated protoplast transformation. After the protoplasts were revived into mycelium, they were covered with V8 solid culture medium containing 30μg / ml G418 and 0.006μg / ml ox. The plates were placed in the dark at 25°C for incubation. After 2-3 days, resistance-marked mycelium was screened and DNA was extracted for PCR verification. Mutants that were positive for PCR verification were then protein extracted for Western Blot verification. Positive transformants were detected when both proteins were expressed. After continuous attempts, a transformant that stably co-expressed Ps14-3-3 protein and PsFHA1 protein was obtained as the research object. The transformant protein was subsequently extracted and enriched with HABeads, and then Western Blot was performed using GFP antibody to detect the label. When both labels can be detected at the same time, it means that Ps14-3-3 and PsFHA1 have an interaction relationship ( Figure 3 C).

[0134] Table 2 Primers for constructing Ps14-3-3 and PsFHA1 yeast two-hybrid, luciferase complementation, and immunoprecipitation vectors

[0135]

[0136]

[0137] Table 3 Universal primers for verification of Ps14-3-3 and PsFHA1 interaction vectors

[0138]

[0139] Example 4: Construction of a gene knockout and complementation vector for Phytophthora sojae PsFHA1

[0140] The CRISPR / Cas9-based gene knockout vector construction method and the sequences of the related vectors in this embodiment are disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of aneffector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.” The pBluescript II SK+ homology arm vector plasmid (Donor vector) used in this example was donated by Professor Brett M. Tyler of Oregon State University, USA. The expression vector pYF515 fused with sgRNA and Cas9 and the Phytophthora expression vector pTOR fused with 3×Flag tags were provided by the Plant Pathogen and Fungicide Interaction Laboratory, College of Plant Protection, China Agricultural University.

[0141] The pBluescript II SK+ vector is used to carry Donnor and homology arm fragments. The pYF515 vector is used to transcribe and produce sgRNA targeting the target sequence and to express the Cas9 protein used to enzymatically cleave the target fragment. The pTOR vector is used for the complementary expression of Phytophthora protein. Through the CRISPR / Cas9 system based on non-homologous end joining (NHEJ), the target gene sequence can be edited by designing an sgRNA sequence that specifically targets the target protein-encoding gene and a homology arm sequence based on 1000bp upstream and downstream of the target sequence.

[0142] The specific construction methods of the Donor-carrying and homology arm fragment vector pBS-PsFHA1-NPTII, the sgRNA transcription and Cas9 protein expression vector pYF515-PsFHA1, and the complementation vector pTOR-3Flag-PsFHA 1 used in this embodiment are as follows:

[0143] sgRNA primer design: sgRNAs for PsFHA1 and NPTII were designed using the sgRNA website (EuPaGDT (http: / / grna.ctegd.uga.edu / )). Gene CDS sequences were entered and sgRNAs with high scores were selected from the provided sgRNA table. On-target refers to the efficiency of the sgRNA in recognizing and cleaving the target site after cleaving the DNA template; higher scores indicate higher accuracy; off-target refers to off-target effects; higher scores indicate lower off-target rates. Secondary structure analysis of the target sgRNA sequences was performed using RNA structure (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html). Finally, the selected 20-nt sgRNA sequences were designed onto a vector backbone to form complete sgRNA primers, which were then sent to Qingke for synthesis (Table 4).

[0144] Table 4 sgRNA sequences targeting PsFHA1 and NPTII genes

[0145]

[0146] sgRNA expression vector construction:

[0147] (1) Dilute the synthesized sgRNA fragment to 100 μM / mL and prepare the following reaction system to synthesize double-stranded sgRNA: 3 μL of sgRNA forward fragment, 3 μL of sgRNA reverse fragment, 4 μL of 0.5 M NaCl, and 24 μL of ddH2O.

[0148] (2) The above system was reacted at 100°C for 2 minutes, placed at room temperature for 3-4 hours, and then diluted 500 times with ddH2O for subsequent ligation and transformation experiments to construct sgRNA vectors.

[0149] (3) The backbone vector used for the sgRNA vector was the pYF515 expression plasmid vector (gift from Professor Brett Tyler's laboratory at Oregon State University, USA). The pYF515 vector plasmid was double-digested with Nhe I and Bsa I, and the digested vector was cloned using Easy Gel extraction was performed using the Quick Gel Extraction Kit (Beijing Kangwei Biotechnology Co., Ltd.).

[0150] (4) The diluted sgRNA fragment was connected to the vector plasmid after enzyme digestion and recovery. The specific reaction system was as follows: sgRNA fragment 4 μL, pYF515 vector plasmid 50 ng, 5×T4 DNALigase Buffer 2 μL, T4 DNALigase 0.5 μL, ddH2O up to 10 μL.

[0151] Mix gently and react at 25°C for 30 minutes. Then, heat-shock transform E. coli and perform colony PCR using universal primers M13F and RPL41 in Table 6. The resulting product was sent to Qingke for sequencing verification.

[0152] (5) After successful sequencing, the sgRNA vector plasmid was extracted using the Tiangen Endotoxin-Free Plasmid Extraction Kit.

[0153] Primer design for knockout and complement homology arms: Use the website (https: / / www.takarabio.com / learning-centers / cloning / primer-design-and-other-tools) to input the pBluescript II KS+ vector sequence, 1000 bp upstream of the PsFHA1 gene, the NPTII gene or the PsFHA1 gene, and the 1000 bp downstream of the PsFHA1 gene at the corresponding positions to design primers, which were then sent to Qingke Company for synthesis (Table 5).

[0154] Table 5 Primer sequences for constructing PsFHA1 gene knockout homology arm vector and complementation vector

[0155]

[0156] Construction of knockout and complement homology arm vector pBS-NPTII-PsFHA1:

[0157] The pBluescript II KS+ vector was digested with EcoR V and incubated in a water bath at 37°C for 3 h. The steps were the same as in Example 3. PFU high-fidelity enzyme was used to amplify 1000 bp upstream of the PsFHA1 gene, the NPTII gene, and 1000 bp downstream of PsFHA1 (e.g. Figure 4 PsFHA1 gene knockout vector construction gel electrophoresis diagram), the vector and gene product after enzyme digestion were separated using Easy Gel extraction was performed using a Quick Gel Extraction Kit (Beijing Kangwei Biotechnology Co., Ltd.). Homologous recombination ligation and E. coli DH5α transformation were performed using the same procedures as in Example 3. Once a single E. coli colony had grown, colony PCR was performed using the universal primers M13F and M13R in Table 6. The resulting fragments were then sent to Qingke Biotechnology for sequencing verification.

[0158] Construction of homology arm complementation vector pBS-C-PsFHA1: The method for constructing the pBS-NPTII-PsFHA1 vector was the same as that for constructing the pBS-NPTII-PsFHA1 vector. The upstream 1000 bp of the PsFHA1 gene, the PsFHA1 gene sequence, and the downstream 1000 bp of the PsFHA1 gene were ligated into the vector pBluescript II SK+ (digested with EcoR V).

[0159] Table 6 Universal primers for verification of PsFHA1 gene knockout in Phytophthora sojae

[0160]

[0161] Example 5: Obtaining knockout mutants and complementation strains of the PsFHA1 gene sequence of Phytophthora sojae

[0162] PsFHA1 gene knockout mutants were prepared using a CaCl2-PEG-mediated protoplast transformation method. The method for oomycete genetic transformation is disclosed in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139." Knockout transformants were obtained by combining the pYF515-PsFHA1 vector and the homology arm vector of pBS-PsFHA1-NPTII in Example 2 and transferring them into soybean Phytophthora sojae P6497 via PEG-mediated protoplast transformation. After the transferred protoplasts were revived into mycelium, they were covered with V8 solid medium containing 50 μg / mL G418. The plates were incubated in the dark at 25°C. After 2-3 days, mycelium with resistance markers was screened and DNA was extracted for PCR verification using the primers in Table 7. Homozygous knockout mutants were identified if only the homology arm bands were amplified but not the PsFHA1 band (Table 7: Primer diagram and PCR results for screening PsFHA1 gene knockout transformants. Note: Primers F1 and R1 amplify the PsFHA1 gene; primers F2 and R2 amplify the 1000-bp upstream homology arm of PsFHA1 and a portion of the NPTII gene; primers F3 and R3 amplify the 1000-bp downstream homology arm of PsFHA1 and a portion of the NPTII gene). After obtaining homozygous knockout mutants, complementation strains were obtained using protoplast transformation and verified by PCR using the primers in Table 8.

[0163] Table 7 Primers for verification of PsFHA1 gene knockout mutants of Phytophthora sojae

[0164]

[0165] Table 8 Primers for verification of PsFHA1 gene complementation strains of Phytophthora sojae

[0166]

[0167]

[0168] Example 6. Detection of the number of sporangia and zoospores in the PsFHA1 gene knockout mutant and complemented strain of Phytophthora sojae

[0169] The wild-type soybean phytophthora P6497 (WT), the empty vector control (EV), the PsFHA1 gene knockout mutants (PsFHA1-18, PsFHA1-38) obtained in Example 3, and the PsFHA1 complemented strain (PsFHA1-C) were inoculated in the center of a 90mm V8 solid plate, cultured at 25°C in the dark for 3 days, and then cultured at 25°C under alternating strong light / dark conditions for 3 days to induce sporangium production. The morphology of the sporangia in the plate was then observed under a microscope at 100 times the field of view, and the number was recorded by taking photos. The plate that had been treated with light to induce spore production under the same conditions was completely infiltrated with 15ml of sterile pre-cooled on ice, placed in a 4°C refrigerator for 30 minutes, and at room temperature (25°C) for 30 minutes to induce zoospore release. The zoospore suspension in the plate was aspirated and the morphology of zoospore production was observed through a hemocytometer under a microscope at 100 times the field of view, and the number was recorded by taking photos. Three technical replicates were recorded for each strain, and three biological replicates were performed. The results are shown in Figure 2. Figure 6 As shown, the number of sporangia and zoospores of the PsFHA1 knockout mutant was significantly lower than that of the wild type, CK, and complemented strains, that is, the PsFHA1 gene has an effect on the asexual spore development of soybean Phytophthora.

[0170] Example 7: Inhibition of mizoribine on Phytophthora sojae and its effect on the interaction between Ps14-3-3 and PsFHA1

[0171] Wild-type soybean Phytophthora strain P6497 was inoculated on 90 mm V8 solid plates containing different concentrations (0, 0.5 μg / mL, 2.5 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL, 40 μg / mL) of imidazole. After culturing at 25°C in the dark for 3 days, the colony diameter of each strain was measured by the cross-cross method. Three technical replicates and three biological replicates were recorded for each treatment. The results are shown in Figure 2. Figure 7 As shown in the figure, mizoribine has an inhibitory effect on the growth rate of soybean phytophthora mycelium. It can be calculated that its EC50 It is 11.80μg / mL.

[0172] Ps14-3-3 and PsFHA1 cotransformants were cultured in liquid V8 at 25°C, 120 rpm, and in the dark. After 2 days of culture, 10 ppm of mizoribine was added. After another day of culture, the mycelia were collected by filtration. Proteins were extracted with Hepes (pH = 7.5) and enriched with HA beads. The effect of mizoribine on the interaction was detected by Western Blot. Figure 7 Mizoribine affected the interaction strength between Ps14-3-3 and PsFHA1. Under the treatment of 10 μg / mL mizoribine, the interaction strength was weakened to 41% of the original.

Claims

1. The Phytophthora parasitica FHA1 protein is the protein of A1), A2), A3), or A4): A1) The amino acid sequence is the protein shown in SEQ ID NO: 3; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; A3) a protein derived from the protein shown in SEQ ID NO: 3, having the same function as the protein shown in SEQ ID NO: 3, obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 3; A4) an amino acid sequence having a similarity of 85% or more, preferably 90% or more, and more preferably 95% or more to the amino acid sequence shown in SEQ ID NO: 3 and having the same function as the amino acid sequence shown in SEQ ID NO:

3.

2. A gene encoding the FHA1 protein of Phytophthora parasitica according to claim 1; preferably, the encoding gene is the following B1) or B2) or B3): B1) a DNA molecule represented by the nucleotide sequence described in Sequence No. 4 in the Sequence Listing; B2) a cDNA molecule or DNA molecule that has 85% or more, 90% or more, or 95% or more identity with the nucleotide sequence shown in B1), and encodes the Phytophthora fumigatus FHA1 protein of claim 1; B3) A cDNA molecule or DNA molecule that hybridizes with the nucleotide sequence defined in B1) or B2) under stringent conditions and encodes the Phytophthora spp. FHA1 protein of claim 1.

3. The RNA molecule obtained by transcription of the coding gene according to claim 2; preferably, the sequence of the RNA molecule is as follows C1) or C2): C1) an RNA sequence having a similarity of 85% or more, preferably 90% or more, and more preferably 95% or more to the RNA sequence transcribed from the DNA sequence shown in SEQ ID NO: 4, and having the same function as the RNA sequence transcribed from the DNA sequence shown in SEQ ID NO: 4; C2) RNA sequence transcribed from the DNA sequence shown in SEQ ID NO:

4.

4. A biological material containing a nucleic acid molecule related to the coding gene according to claim 2 or the RNA molecule according to claim 3, which is any one of the following D1) to D10): D1) an expression cassette containing the coding gene according to claim 2; D2) a recombinant vector containing the coding gene according to claim 2, or a recombinant vector containing the expression cassette according to D1); D3) a recombinant microorganism containing the encoding gene of claim 2, or a recombinant microorganism containing the expression cassette of D1), or a recombinant microorganism containing the recombinant vector of D2); D4) a transgenic plant cell line containing the encoding gene of claim 2, or a transgenic plant cell line containing the expression cassette of D1); D5) transgenic plant tissue containing the encoding gene of claim 2, or transgenic plant tissue containing the expression cassette of D2); D6) a transgenic plant organ containing the encoding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2); D7) a nucleic acid molecule that inhibits the expression of the gene encoding the gene according to claim 2; D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7); D9) a nucleic acid molecule that inhibits translation of the RNA molecule according to claim 3; D10) producing an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line for the nucleic acid molecule described in D9).

5. Use of the Phytophthora spp. FHA1 protein according to claim 1, the encoding gene according to claim 2, the RNA molecule according to claim 3, or the biomaterial according to claim 4, characterized in that: The application is any one or more of the following 1)-3): 1) Application in regulating the production of sporangia and / or zoospores of Phytophthora; 2) Application in interaction with Phytophthora 14-3-3 protein; 3) Application in inhibiting and / or killing Phytophthora pathogens.

6. The use according to claim 5, wherein: The use described in 1) to 3) is achieved by changing the sequence in the coding gene according to claim 2, or changing the translation of the RNA molecule according to claim 3, or inhibiting and / or inactivating the function of the FHA1 protein of the Phytophthora parasitica according to claim 1.

7. Use of the Phytophthora fumigatus FHA1 protein of claim 1, the encoding gene of claim 2, the RNA molecule of claim 3, the biomaterial of claim 4, or the protein combination or DNA combination of claim 5 as a target for antibacterial or fungicide screening of Phytophthora fumigatus antibacterial or fungicide agents, or in screening for protein-protein interaction (PPI) inhibitors; The protein-protein interaction (PPI) inhibitor is a substance capable of inhibiting the interaction between the Phytophthora spp. FHA1 protein and the Phytophthora spp. 14-3-3 protein according to claim 1, wherein: The sequence of the Phytophthora 14-3-3 protein is shown as Sequence 1 in the sequence listing.

8. A method for screening or assisting in screening for antibacterial and / or fungicidal agents for Phytophthora or screening for protein-protein interaction (PPI) inhibitors, the method comprising applying a test substance to the Phytophthora pathogen; when the test substance can inhibit the expression of the encoding gene according to claim 2, or inhibit the translation of the RNA molecule according to claim 3, or inhibit the expression of the Phytophthora FHA1 protein according to claim 1 or inactivate it, the test substance is a antibacterial and / or fungicidal agent for the Phytophthora; or applying the test substance to the Phytophthora pathogen; when the test substance can inhibit the interaction between the Phytophthora FHA1 protein and the Phytophthora 14-3-3 protein according to claim 1, the test substance is a protein-protein interaction (PPI) inhibitor.

9. A method for reducing the activity of Phytophthora, comprising the steps of: inhibiting the expression of the encoding gene according to claim 2, or inhibiting the translation of the RNA molecule according to claim 3, or inhibiting the expression of the Phytophthora FHA1 protein according to claim 1 or inactivating the protein; in, The reducing the activity of Phytophthora is to reduce the yield of sporangia and / or zoospores of Phytophthora pathogens; Preferably, the function of the protein shown in Sequence 3 in the sequence listing is changed by performing site-directed mutagenesis on the nucleotide sequence of the gene shown in Sequence 4 in the sequence listing of Phytophthora.

10. Use of a substance that inhibits the expression of the Phytophthora FHA1 protein or inactivates it according to claim 1, or a substance that inhibits the interaction between the Phytophthora FHA1 protein and the Phytophthora 14-3-3 protein, in the preparation of a plant phytophthora fungicide; preferably, the substance that inhibits the expression of the Phytophthora FHA1 protein or inactivates it is a substance that inhibits the expression of the Phytophthora FHA1 protein or inactivates it and / or inhibits the expression of the gene encoding the Phytophthora FHA1 protein and / or inhibits the translation of the RNA molecule transcribed from the gene encoding the Phytophthora FHA1 protein; wherein, The sequence of the Phytophthora 14-3-3 protein is shown as Sequence 1 in the sequence listing; Preferably, the substance that inhibits the interaction between the Phytophthora fumigatus FHA1 protein and the Phytophthora fumigatus 14-3-3 protein is imidazoribine.

Images