Salt-tolerant nitrogen-fixing Klebsiella pasteurii and application thereof

Abstract

The invention discloses a salt-tolerant nitrogen-fixing Klebsiella pasteurii and application thereof, and relates to the technical field of microorganisms, and the Klebsiella pasteurii S8812 provided by the invention is a salt-tolerant combined nitrogen-fixing bacterial strain which is screened from corn roots and has outstanding comprehensive performance; the strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on March 21, 2025, and the preservation number of the strain is CGMCC No: 33923. The strain is high in nitrogen fixation activity, strong in salt resistance and capable of tolerating a culture medium environment with the NaCl concentration as high as 7%. Meanwhile, the strain also has the functions of dissolving organic phosphorus, dissolving potassium, producing amylase, producing ammonia, producing siderophore, producing auxin and the like. Greenhouse pot experiments show that the strain has a growth promoting effect on various crops such as wheat and corn, and the plant height, stem length, fresh weight and the like of plants can be remarkably improved. In addition, the strain has a good inhibition effect on rhizoctonia solani, pectobacterium and xanthomonas oryzae.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and in particular to a salt-tolerant and nitrogen-fixing Klebsiella pastoris strain and application thereof. Background Art

[0002] In agricultural ecosystems, approximately 24% of the nitrogen in crop biomass comes from non-symbiotic N2O fixation. Nitrogen-fixing bacteria convert nitrogen from the air into plant-usable ammonium, providing essential nutrients for plant growth and development. Biological nitrogen fixation is categorized into three types based on the relationship between nitrogen-fixing bacteria and plants: symbiotic nitrogen fixation, autotrophic nitrogen fixation, and associative nitrogen fixation. Associative nitrogen-fixing bacteria form loose associations with plant roots, fixing free nitrogen from the atmosphere. These microorganisms are widespread in nature and play a vital role in improving soil fertility and promoting plant growth. Compared to traditional symbiotic nitrogen-fixing bacteria, associative nitrogen-fixing bacteria have a wider host range and can form associative nitrogen-fixing relationships with non-leguminous plants, thus expanding the scope of their nitrogen-fixing activity. Associative nitrogen-fixing bacteria and related research have become a hot topic in agricultural production applications and scientific research.

[0003] The application of nitrogen-fixing bacteria can alleviate the damage caused by high salt stress to plants, promote plant growth, and significantly increase the nitrogen supply capacity of the soil, reduce soil pH and conductivity, and thus improve the microecological environment of plant roots. In addition, nitrogen-fixing bacteria can increase crop yields by increasing the available nitrogen content and urease activity in saline-alkali soils. However, the salinity of the soil directly affects the colonization and bacterial community structure of nitrogen-fixing bacteria. At present, research and application of nitrogen-fixing bacteria are mostly concentrated in soils with lower salinity, while there are few reports on nitrogen-fixing bacteria suitable for saline-alkali environments. The area of ​​saline-alkali land in my country is about 99.13 million hm2. 2 , accounting for about 70% of the total cultivated land area. Among them, severely saline-alkali land with a pH higher than 9.0 and a salt content of more than 0.6% is increasing at a rate of 1.4% per year. To this end, it is necessary to fully tap the resources of nitrogen-fixing microorganisms that can tolerate stress environments, convert nitrogen in the air into nutrients needed by plants, and establish a nutrient retention and relatively self-sustaining system for plant growth in saline-alkali habitats, thereby effectively reducing the use of chemical fertilizers. Therefore, the development and application of salt-tolerant nitrogen-fixing strains are of great significance for increasing crop yields in saline-alkali land.

[0004] Klebsiella spp. is an important member of the Enterobacteriaceae family and has theoretical research value and broad development and application prospects in agriculture and environmental pollutant control. Studies have shown that Klebsiella can induce and regulate K in wheat. + / Na +Compared to other bacteria, Klebsiella can resist salt stress and promote plant growth; it can compete with pathogens for iron ions, limiting their growth and reproduction and reducing the occurrence of diseases and insect pests. However, there is little research on the impact of Klebsiella on the rhizosphere soil environment of crops in saline-alkali soils, and even fewer reports on its application in saline-alkali land improvement, agricultural production, and ecological restoration. Therefore, exploring the specific functions of Klebsiella nitrogen-fixing bacteria, such as efficient nitrogen fixation and salt tolerance, and clarifying its role in promoting plant growth, can provide an important resource basis for improving crop yield and quality and soil fertility in saline-alkali lands. It can also promote the development of ecological agriculture and has broad application prospects. Summary of the Invention

[0005] The present invention aims to provide a salt-tolerant and nitrogen-fixing Klebsiella pastoris strain and its application, so as to solve the above technical problems existing in the prior art.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows:

[0007] The present invention provides a salt-tolerant and nitrogen-fixing Klebsiella pasteurii S8812 strain, which was deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms (CGMCC) on March 21, 2025, with a strain deposit number of CGMCC No: 33923.

[0008] The present invention also provides application of the Klebsiella pastoris S8812 strain in promoting plant growth.

[0009] Preferably, the plants include but are not limited to corn and wheat.

[0010] The present invention also provides use of the Klebsiella pastoris S8812 strain in antibacterial applications.

[0011] Preferably, the antibacterial activity includes inhibition of pathogenic bacteria and pathogenic fungi, wherein the pathogenic bacteria include but are not limited to Xanthophyllomyces oryzae and Pectobacterium solani, and the pathogenic fungi include but are not limited to Rhizoctonia solani.

[0012] The present invention also provides the use of the Klebsiella pastoris S8812 strain in nitrogen fixation, salt tolerance, organic phosphorus solubility, potassium solubility, amylase production, siderophore production, ammonia production and plant growth hormone secretion.

[0013] The present invention also provides a biological preparation containing the above-mentioned Klebsiella pastoriensis S8812 strain and / or metabolites of Klebsiella pastoriensis S8812.

[0014] Preferably, the metabolite is a substance secreted into the culture medium by Klebsiella pastoris S8812.

[0015] The present invention also provides the use of the above-mentioned biological preparation in promoting plant growth and / or inhibiting bacteria, wherein the plants include but are not limited to corn and wheat, the antibacterial effect includes the inhibition of pathogenic bacteria and pathogenic fungi, the pathogenic bacteria include but are not limited to rice bacterial leaf streak fungus and pectobacterium, and the pathogenic fungi include but are not limited to Rhizoctonia solani disease.

[0016] The present invention also provides the use of the above biological preparation in nitrogen fixation and / or salt tolerance and / or organic phosphorus solubility and / or potassium solubility and / or amylase production and / or siderophore production and / or ammonia production and / or plant growth hormone secretion.

[0017] The present invention also provides a biofertilizer prepared using the Klebsiella pastoris S8812 strain and / or the biological preparation.

[0018] In summary, compared with the prior art, the solution of the present invention has the following beneficial effects:

[0019] The strain K. pasteurii S8812 of the present invention has a round colony with neat edges, is opaque, has a milky white front, and a smooth surface. Experiments have shown that the strain K. pasteurii S8812 of the present invention is a stable, efficient, and salt- and alkali-tolerant plant growth-promoting bacterium with a nitrogenase activity of up to 1501.64±81.12 nmol C2H4 (mg protein·h) -1 , and can tolerate culture medium environments with NaCl concentrations up to 7%. This strain has a strong inhibitory effect on pathogenic bacteria such as rice leaf streak pathogens. It can solubilize organic phosphorus and potassium, produce amylase, cellulase, siderophore, ammonia, and IAA, effectively improving the soil nutrient environment and promoting plant growth. Results show that K. pasteurii S8812 is a plant probiotic with high nitrogen fixation activity, strong salt tolerance, and excellent growth-promoting properties. It is easy to cultivate, ferment, preserve, and is environmentally friendly and harmless to humans and animals. This strain has good prospects for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a PCR gel electrophoresis diagram of the detection of the nitrogenase gene nifH of Klebsiella pasteurii S8812 in the present invention (G is a positive control, and S8812 is the amplified product of this strain);

[0021] Figure 2 This is the phylogenetic tree constructed based on the 16SrRNA gene sequence in the present invention;

[0022] Figure 3 This is a bar graph showing the nitrogenase activity detection of Klebsiella pasteurii S8812 in the present invention;

[0023] Figure 4 The salt tolerance test of Klebsiella pasteurii S8812 in the present invention is carried out;

[0024] Figure 5 Determination of soluble organic phosphorus of Klebsiella pasteurii S8812 in the present invention;

[0025] Figure 6 It is the potassium solubility determination of Klebsiella pasteurii S8812 in the present invention;

[0026] Figure 7 Determination of amylase production by Klebsiella pasteurii S8812 in the present invention;

[0027] Figure 8 For the determination of siderophore production by Klebsiella pasteurii S8812 in the present invention;

[0028] Figure 9 The ammonia production assay of Klebsiella pasteurii S8812 in the present invention;

[0029] Figure 10 For the determination of IAA production by Klebsiella pasteurii S8812 in the present invention;

[0030] Figure 11 The present invention is used to determine the ability of Klebsiella pasteurii S8812 to antagonize pathogenic bacteria and fungi (A is Pseudomonas oryzae, B is Pectobacterium, and C is Rhizoctonia solani);

[0031] Figure 12 The present invention is used to determine the wheat growth-promoting ability of Klebsiella pasteurii S8812;

[0032] Figure 13 This is the determination of the corn growth-promoting ability of Klebsiella pasteurii S8812 in the present invention. DETAILED DESCRIPTION

[0033] In order to enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods in the art.

[0035] Unless otherwise specified, the reagents and materials used in the following examples can be obtained from commercial sources.

[0036] The pathogens used in the following embodiments can be collected from the wild by the public or obtained from the Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, to repeat the experiments of this application.

[0037] Explanation of the cited strain:

[0038] 1) Xanthomonas oryzae pv. oryzicola, which causes rice bacterial leaf streak disease (Ye Wenxin, Chang Zheng, Liu Qianqian, et al. Mutation analysis of the xrvA gene encoding a Xanthomonas virulence regulatory protein in Xanthomonas oryzae pv. oryzicola [J / OL]. Molecular Plant Breeding: 1-17 [2024-07-01]), hereinafter referred to as Xanthomonas oryzae pv. oryzicola.

[0039] 2) Pectobacterium carotovorum, which causes carrot soft rot (Su Z, Liu X, Guo Q, et al. Insights into complex infection by two Pectobacterium species causing potato blackleg and soft rot. Microbiological Research. 2022 Aug; 261: 127072. DOI: 10.1016 / j.micres.2022.127072. PMID: 35594651.), hereinafter referred to as Pectobacterium carotovorum.

[0040] 3) Rhizoctonia solani, the fungus that causes rice sheath blight (Wei Hailei, Wang Ye, Zhang Liqun, Tang Wenhua. Identification of biocontrol strains 2P24 and CPF-10 and preliminary analysis of their biocontrol-related traits. Acta Phytopathologica Sinica, 2004, 34:80-85), hereinafter referred to as Rhizoctonia solani.

[0041] The following is the method for preparing the culture medium used in the examples:

[0042] Luria-Bertani (LB) solid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 12 g agar, distilled water to 1000 mL, pH 7.0-7.2.

[0043] Luria-Bertani (LB) liquid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, distilled water to 1000 mL, pH 7.0-7.2.

[0044] Axubei solid culture medium: KH2PO4 0.2 g, MgSO4·7H2O 0.2 g, NaCl 0.2 g, CaCO3 5.0 g, mannitol 10 g, CaSO4·2H2O 0.1 g, agar 12 g, and distilled water to 1000 mL.

[0045] Nitrogen-free culture medium: sucrose 10 g, NaCl 0.12 g, K2HPO4·3H2O 0.5 g, CaCO3 1 g, MgSO4·7H2O 0.2 g, distilled water to 1000 mL, pH 7.2.

[0046] Nutrient Agar (NA) medium: 3 g beef extract, 5 g peptone, 2.5 g glucose, 12 g agar, pH 7.0, distilled water to 1000 mL.

[0047] Nutrient Broth (NB) medium: 3 g beef extract, 5 g peptone, 2.5 g glucose, pH 7.0, distilled water to 1000 mL.

[0048] Potassium-dissolving medium: sucrose 5 g, MgSO4·7H2O 0.5 g, FeCl3 0.005 g, CaCO3 0.1 g, sericite powder 2 g, 1.5% agar, distilled to 1000 mL.

[0049] Sodium carboxymethylcellulose medium: peptone 10 g, yeast powder 10 g, sodium carboxymethylcellulose 10 g, KH2PO4 1 g, NaCl 15 g, agar 12 g, distilled water to 1000 mL;

[0050] CAS blue qualitative detection medium:

[0051] Dissolve 0.012 g of chrome azurol sulphonate (CAS) in 10 mL of deionized water and mix with 2 mL of 1 mmol / LFeCl3 solution to obtain solution a.

[0052] Dissolve 0.015 g of hexadecyl trimethyl ammonium bromide (HDTMA) in 8 mL of deionized water to obtain solution b.

[0053] Slowly add liquid a into liquid b and mix thoroughly to obtain dye solution c;

[0054] Add 10 mL of 0.1 mol / L phosphate solution (2.427 g Na2HPO4·12H2O, 0.5905 g NaH2PO4·2H2O, 0.075 g KH2PO4, 0.125 g NaCl, 0.25 g NH4Cl, 100 mL of deionized water, diluted 10-fold before use) and 6.04 g of piperazine diethanolsulfonic acid (pipes) to a clean Erlenmeyer flask containing 150 mL of distilled water, mix well, and adjust the pH to 6.8 with 50% NaOH solution. Finally, add 4 g of agar powder to obtain medium d.

[0055] Sterilize dye solution c, culture medium d, and 1 mmol / L CaCl₂, 1 mmol / L MgSO₄·7H₂O, 20% glucose, and 10% casamino acids (115°C, 20 min). Add 0.2 mL of the 1 mmol / L CaCl₂, 4 mL of the 1 mmol / L MgSO₄·7H₂O, 6 mL of the 10% casamino acids, and 2 mL of the 20% glucose solution to culture medium d. Slowly add dye solution c and shake thoroughly to obtain a blue qualitative detection medium.

[0056] The Klebsiella pasteurii S8812 provided by the present invention was deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms (CGMCC) on March 21, 2025, with a deposit number of CGMCC No: 33923, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing (Institute of Microbiology, Chinese Academy of Sciences), with a postal code of 100101.

[0057] Klebsiella pasteurii S8812 is an aerobic Gram-negative bacterium, and the 16S rRNA and nifH gene sequences are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0058] SEQ ID No. 1:

[0059]

[0060] SEQ ID No. 2:

[0061] CGCTAATGCATGAACCCATTATGGAGATGGCCGCGGAAGTCGGCTCGGTCGAGGATCTCGAGCTCGAAGACGTGCTGCAAATTGGCTACGGCGACGTGCGCTGCGCGGAATCCGGCGGCCCGGAGCCAGGCGTCGGCTGCGCGGGGCGCGGCGTGATCACGGCGATCA ACTTTCTTGAAGAAGAAGGCGCCTACGAGGACGATCTCGATTTTGTCTTCTATGACGTGCTCGGCGACGTGGTCTGCGGCGGCTTCGCCATGCCTATCCGTGAAAACAAAGCCCAGGAGATCTACATCGTCTGCTCCGGTGAAATGATGGCCATAAATTGCGCGCTC.

[0062] The present invention provides Klebsiella pastoriensis S8812 and / or metabolites of Klebsiella pastoriensis S8812, namely, Klebsiella pastoriensis S8812 bacteria and substances secreted into a culture medium by the bacteria.

[0063] The metabolite preparation method is as follows: strain S8812 is streaked onto LB solid medium, cultured at 28°C for 2 days, and then a single clone is picked and inoculated into LB liquid medium. The mother liquor is cultured overnight at 28°C at 220 rpm. The mother liquor is then transferred to LB liquid medium at a ratio of 1:1000 and cultured under the same conditions for 2 days to obtain the fermentation broth, which is the metabolite of strain S8812.

[0064] The Klebsiella pastoris S8812 culture provided by the present invention has at least one of the following functions B1-B9:

[0065] B1. Nitrogen fixation; B2. Salt tolerance (can tolerate culture medium with a NaCl concentration of 7%); B3. Solubility of organic phosphorus; B4. Solubility of potassium; B5. Production of amylase; B6. Production of siderophore; B7. Production of ammonia; B8. Secretion of plant auxin (IAA); B9. Antagonism against rice leaf streak pathogen; B10. Antagonism against pectinobacterium; B11. Antagonism against Rhizoctonia solani; B12. Promotion of plant lateral root formation; B13. Increase of plant biomass.

[0066] Any of the following applications of the fermentation broth also falls within the scope of protection of the present invention:

[0067] C1. Application of the fermentation liquid in nitrogen fixation; C2. Application of the fermentation liquid in salt tolerance (tolerant to a culture medium with a NaCl concentration of 8%); C3. Application of the fermentation liquid in solubilizing organic phosphorus; C4. Application of the fermentation liquid in solubilizing potassium; C5. Application of the fermentation liquid in producing amylase; C6. Application of the fermentation liquid in producing siderophore; C7. Application of the fermentation liquid in producing ammonia; C8. Application of the fermentation liquid in producing plant auxin (IAA); C9. Application of the fermentation liquid in antagonizing rice leaf streak pathogen; C10. Application of the fermentation liquid in antagonizing pectinobacterium; C11. Application of the fermentation liquid in antagonizing Rhizoctonia solani; C12. Application of the fermentation liquid in promoting the formation of lateral roots in plants; C13. Application of the fermentation liquid in increasing plant biomass.

[0068] The present invention will be described in detail below with reference to the embodiments.

[0069] Example 1 Isolation and identification of Klebsiella pasteurii S8812

[0070] 1. Isolation of strain S8812

[0071] Strain S8812 was isolated from maize roots. First, clean the maize plants, then rinse the roots of upland rice with tap water until the soil is completely clean. Select plants of relatively uniform size and cut the roots with sterilized scissors. Cut the roots into 1 cm long segments and place them in a sterile petri dish to weigh the weight. Each sample weighs 1 g and repeat three times. The weighed samples are placed in a sterile petri dish filled with 75% alcohol by volume and soaked for 30 seconds. Then transfer them to a 25 mg·L -1 Soak the sample in a sterile petri dish containing sodium hypochlorite for 10 minutes. Finally, rinse the sample three times with sterile water.

[0072] The dilution separation method was used to separate and purify the microorganisms in the sample. 1 g of sample was placed in a sterile test tube, and an appropriate amount of sterile steel balls and sterile water were added for oscillation grinding. After grinding, the volume was adjusted to 10 mL and oscillated for 30 min (120 r / min). -1 ) to obtain the sample suspension. Prepare different dilution gradients (1~10 -4 ) of the sample suspension, from 10 -3 ~10 -4 Take 100 μL of each dilution gradient sample and spread it onto Axubei solid medium. Repeat three times for each concentration. Incubate the medium upside down in a 30°C incubator for 3–7 days. Pick a single colony from a plate with an appropriate number of colonies. Purify the strain using the parallel streak method on LB solid medium. Repeat three times to confirm the purified strain S8812.

[0073] 2. Detection of the nitrogenase gene nifH of strain S8812

[0074] The strain S8812 was streaked onto LB solid medium and cultured at 28°C for 2 days. A small amount of monoclonal colonies were picked as templates. The nifH gene was amplified using primers Poly_F: 5'-TGCGAYCCS AARGCBGACTC-3'; Poly_R: 5'-ATSGCCATCATYTCRCCGGA-3'. The length of the amplified product was 360 bp (see Figure 1 ). The nifH gene was amplified according to the following PCR amplification system.

[0075] nifH PCR reaction system (total volume 30 μL): 2×Taq PCR Master Mix 15 μL; Poly_F 1.5 μL; Poly_R 1.5 μL; trace amount of DNA template; ddH2O 12 μL.

[0076] PCR amplification procedure: step 1: pre-denaturation at 94°C for 5 min; step 2: denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min, 35 cycles; step 3: full extension at 72°C for 5 min; storage at 4°C.

[0077] According to the blastx analysis of the PCR-amplified nifH (SEQ ID No. 2) of S8812 at NCBI, the results showed that the amplified sequence had a similarity of 99.12% with the nitrogenase gene sequence. Therefore, the strain S8812 has the nitrogenase gene nifH and is a nitrogen-fixing bacterium.

[0078] 3. Identification of strain S8812

[0079] The strain S8812 was streaked onto LB solid medium and cultured at 28°C for 2 days. A small amount of monoclonal colonies were picked as templates and the 16S rRNA gene was amplified according to the 16S PCR amplification system.

[0080] 16S PCR reaction system (total volume 30 μL): 2× Taq PCR Master Mix 15 μL; 27F 1.5 μL; 1492R 1.5 μL; trace amount of DNA template; ddH2O 12 μL.

[0081] PCR amplification procedure: step 1: pre-denaturation at 94°C for 5 min; step 2: denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min, 35 cycles; step 3: full extension at 72°C for 5 min; storage at 4°C.

[0082] The 16S rRNA sequence of S8812 (SEQ ID No. 1) was compared with that of Klebsiella pasteurii SPARK 836C1 in EZBioCloud. The results showed that the similarity between S8812 and Klebsiella pasteurii SPARK 836C1 was 99.86%. A phylogenetic tree was constructed based on the 16S rRNA sequence of S8812 (SEQ ID No. 1) and the type strain of Klebsiella genus (see Figure 2 ), the strain was found to be similar to Klebsiella pasteurii DSM 109530 T The strains clustered into one branch with close genetic relationship, so strain S8812 was identified as Klebsiella pasteurii.

[0083] Example 2 Determination of nitrogenase activity of Klebsiella pasteurii S8812

[0084] The nitrogenase activity was detected by acetylene reduction method. The strain S8812 to be tested was prepared with nitrogen-free medium to an OD 600nm =0.1 bacterial suspension and placed in a 25mL headspace bottle. After incubation at 28℃ for 2 days, the cotton plug was replaced with a rubber stopper and sealed. 1.5mL of gas was extracted and 1.5mL of C2H2 (final concentration of 1%) was added and incubated for 1 day. 0.2mL of mixed gas was extracted from the bottle and injected into Shimadzu GC28A gas chromatograph to measure the production of C2H2 and C2H4. The headspace bottle without inoculation and filled with C2H2 was used as a control. The chromatographic parameters were: stainless steel chromatography column 2mm×1000mm, column temperature of 150℃, hydrogen ion flame detector, temperature of 20℃, carrier gas of N2, gas volume flow rate of 30mL·min-1. The amount of ethylene generated in the reaction system was determined by gas chromatography and converted into acetylene reduction activity, expressed as ARA (nmol C2H4 (mg protein h) -1 ) represents nitrogenase activity. Nitrogenase activity was calculated using the following formula:

[0085] ARA (nmol C2H4 (mg protein·h) -1 )=(58.0×Se×T×Pe) / (Sb×Te×P×t

[0086] ×a×V)

[0087] Wherein, Se: ethylene peak area; T: absolute temperature in Kelvin (T = 273.13K); Pe: atmospheric pressure under experimental conditions (Pa); Sb: acetylene peak area; Te: temperature under experimental conditions (K); P: absolute atmospheric pressure (P = 101324.72Pa); t: incubation time (d); V: volume (mL); a: protein content (mg).

[0088] The results showed that the nitrogenase activity of strain S8812 was as high as 1337.83±33.27nmol C2H4 (mg protein·h) -1 (See Figure 3 ).

[0089] Example 3 Determination of salt tolerance of Klebsiella pasteurii S8812

[0090] Prepare LB liquid culture media with NaCl concentrations of 2%, 4%, 6%, 8%, and 10% in advance, and use LB culture media with 1% NaCl concentration as a control; pick a single colony of S8812 and inoculate it into LB culture media, culture it at 28°C and 200rpm for 24 hours, then transfer the S8812 single colony to LB culture media with different salt concentrations according to the 1% inoculation amount, and continue to culture it at 28°C and 200rpm for 24 hours. Take out 1ml from the culture bottle every 12 hours to measure its growth. As can be seen from the figure, the S8812 strain has a strong salt tolerance. S8812 grows better at 3% and 4% NaCl concentrations than at 1% NaCl concentration, and has the potential to be a halophile. At a concentration of 5% NaCl, S8812 showed a better growth trend on the second day. The strain S8812 can tolerate a high salt concentration environment and grow (see Figure 4 ).

[0091] Example 4 Determination of the ability of Klebsiella pasteurii S8812 to hydrolyze organic phosphorus

[0092] The activated strain S8812 was inoculated into KB liquid medium and shaken overnight at 28°C and 220rpm. 10μL of culture solution was spotted on a plate of Montgena organophosphate medium, and 10μL of KB liquid medium was spotted as a control treatment. Each treatment was repeated 3 times. After drying, the plate was inverted and cultured in a 28°C incubator for 5 days to observe whether a hydrolysis halo appeared. The results showed that there was no change in the control plate, while an obvious hydrolysis halo appeared around the inoculated colony on the plate inoculated with the culture solution of strain S8812 (see Figure 5 ), indicating that strain S8812 has the ability to hydrolyze organic phosphorus.

[0093] Example 5 Klebsiella pasteurii S8812 has the ability to dissolve potassium

[0094] The activated strain S8812 was inoculated into LB liquid medium and cultured overnight at 28°C and 220 rpm. 10 μL of the culture solution was spotted onto a potassium-dissolving medium plate. 10 μL of the LB liquid medium was spotted as a control treatment. Each treatment was repeated 3 times. After drying, the plate was inverted and cultured at 28°C incubator for 7 days to observe whether oil droplets were formed. The results showed that on the plate inoculated with the culture solution of strain S8812, obvious oil droplets appeared around the inoculated colonies (see Figure 6 ), indicating that strain S8812 has the ability to solubilize potassium.

[0095] Example 6 Klebsiella pasteurii S8812 has the ability to produce amylase

[0096] The activated strain S8812 was inoculated into LB liquid culture medium and cultured overnight at 28°C and 200rpm. 10μl of culture solution was spotted on the amylase detection medium plate, and 10μL of LB liquid was spotted as the control treatment. Each treatment was repeated 3 times. After drying, it was inverted and cultured at 28°C for 3 days. An appropriate amount of Gram's iodine solution was added to cover the surface of the culture medium. After standing for 2 minutes, the Gram's iodine solution was poured out and the presence of a transparent circle was observed. The results showed that there was no change in the control plate, while an obvious hydrolysis transparent circle appeared around the inoculated colony on the test plate inoculated with the culture solution of strain S8812 (see Figure 7 ), indicating that the starch in the plate was decomposed, proving that strain S8812 has the ability to produce amylase.

[0097] Example 7 Klebsiella pasteurii S8812 has the ability to produce siderophores

[0098] The activated strain S8812 was inoculated into LB liquid medium and shake-cultured overnight at 28°C and 220rpm. 10μL of the culture solution was spotted on a CAS blue qualitative detection medium plate and cultured in an incubator at 28°C for 3 days to observe whether a yellow halo was produced around the colony. Since the iron ions chelated by EDTA in the siderophore competition medium turned the culture medium from blue to yellow, the appearance of a yellow halo around the colony indicated the production of siderophore. The results showed that the yellow halo appeared around the colony of strain S8812, proving that strain S8812 has the ability to produce siderophore (see Figure 8 ).

[0099] Example 8 Quantitative determination of ammonia production capacity of Klebsiella pasteurii S8812

[0100] Transfer freshly cultured S8812 to peptone ammonium medium and shake at 28°C, 200 rpm for 48 hours. Take 200 μL of the culture solution and drop it on a white ceramic plate. The control is peptone ammonium medium without bacteria. Add 3 drops of Nessler's reagent to the culture solution and peptone ammonium medium. The appearance of a yellow or brownish-red precipitate indicates that the strain has the ability to produce NH3. The results show that after adding Nessler's reagent to the culture solution of S8812, a clear brownish-red precipitate appears, indicating that S8812 has a significant ability to produce ammonia (see Figure 9 ).

[0101] Example 9 Klebsiella pasteurii S8812 has the ability to produce IAA

[0102] The strain S8812 was inoculated into LB liquid culture medium containing 100 mg / L tryptophan, shaken and cultured at 28°C and 200 rpm for 2 days, then centrifuged at 8000 r / min for 2 minutes, the supernatant was discarded, and the bacterial suspension was resuspended with an equal amount of physiological saline. Next, 100 μL of the bacterial suspension was dropped on a white ceramic plate, and 100 μL of Salkowski colorimetric solution was added at room temperature and kept away from light for 30 minutes before observation. If the color turns red, it means that IAA can be secreted, and the darker the color, the stronger the IAA production ability; if it does not change color, it means that IAA cannot be secreted. The strain S8812 turns pink in the dark, indicating that S8812 has the ability to secrete IAA, thereby promoting the germination of plant seeds and the growth of seedlings (see Figure 10 ).

[0103] Example 10 Determination of the Inhibitory Spectrum of Klebsiella pasteurii S8812

[0104] The information of the tested pathogenic bacteria, fungi and oomycetes is shown in Table 1. The antagonistic ability of strain S8812 against one pathogenic bacteria was tested.

[0105] Table 1 Information on pathogenic bacteria and fungi tested

[0106]

[0107] The antagonistic ability of strain S8812 against the above-mentioned pathogenic bacteria was detected by plate antagonism test. The experimental method is as follows: After melting the NA / LB culture medium with a 1% agar content, cool it to 45°C at room temperature. Add the pathogenic bacteria that have been shaken overnight in the NA / LB liquid culture medium to the stable growth phase to the cooled NA / LB culture medium at a ratio of 1:100, and pour the plate. After drying, inoculate 10μL of the culture solution of strain S8812 (LB liquid shake culture) on the plate. After drying, invert the plate in a 28°C incubator for culture. The plate inoculated with only pathogens was used as a control, and 3 replicates were set for each treatment. After 48 hours of culture, observe and measure the diameter of the inhibition zone.

[0108] The antagonistic activity of strain S8812 against pathogenic fungi was tested using a plate standoff test: Using a 0.7 cm diameter borer, a freshly cultured fungus cake grown on a PDA plate at 25°C was taken. Using an inoculating needle, the cake was picked and inoculated with mycelium facing downwards in the center of the fresh PDA plate. Then, 10 μL of culture medium of strain S8812 (LB shake culture) was inoculated approximately 2.5 cm from the cake. After drying, the plates were incubated upside down at 25°C. Plates inoculated with the pathogen alone served as controls. Three replicates were set for each treatment. The width of the inhibition zone was observed and measured after 5-7 days of incubation.

[0109] The results showed that strain S8812 had a good antagonistic effect on pathogens such as rice leaf streak pathogen Xanthomonas oryzae (see Figure 11 ), indicating that strain S8812 has the ability to resist plant pathogens and has the potential to be developed as a biocontrol agent.

[0110] Example 11 Klebsiella pasteurii S8812 significantly promotes the growth of wheat

[0111] Mix nutrient soil, vermiculite and natural soil (1:1:1) evenly and add them to eight rows of flower pots. After soaking them with water, sow about 4 wheat seeds in each hole, cover them with a small amount of soil, and place them in a greenhouse with a temperature of 25-28℃ and a humidity of 65% to 75%. After about a week, the wheat will grow, and wheat seedlings with consistent growth will be selected for growth promotion experiments.

[0112] Growth promotion experiment: A single colony of S8812 was inoculated into LB medium and cultured at 28°C and 200 rpm for 24 h. Then, the colony was transferred to 50 mL of LB medium at a 1% inoculum volume and cultured at 28°C and 200 rpm for another 24 h. After the culture was completed, S8812 was prepared with distilled water to a concentration of 1×10 8 (OD 600 =0.1) CFU·mL -1 10 mL of the S8812 bacterial suspension was then irrigated into the wheat roots. Each treatment involved 40 plants, with three replicates. Distilled water was used as the control (CK). Growth was observed and recorded daily. On the 21st day after irrigating, the wheat plants' fresh weight, root length, and plant height were measured.

[0113] The results showed that wheat grew well after root irrigation with S8812 suspension, and the fresh weight of wheat plants increased significantly compared with the control group. The average fresh weight of wheat after root irrigation with S8812 suspension reached 0.38±0.10g, which was significantly higher than that of the control group by 0.26 times (see Figure 12 ).

[0114] Example 12 Klebsiella pasteurii S8812 significantly promotes the growth of corn

[0115] Mix nutrient soil, vermiculite and natural soil (1:1:1) evenly and add them to flower pots. After soaking them with water, sow 4 corn seeds in each pot, cover them with a small amount of soil, and place them in a greenhouse with a temperature of 25-28℃ and a humidity of 65% to 75%. After about two weeks, the seedlings will grow out. Select corn seedlings with consistent growth and conduct growth promotion experiments.

[0116] Growth promotion experiment: A single colony of S8812 was inoculated into LB medium and cultured at 28°C and 200 rpm for 24 h. Then, the colony was transferred to 50 mL of LB medium at a 1% inoculum volume and cultured at 28°C and 200 rpm for another 24 h. After the culture was completed, S8812 was prepared with distilled water to a concentration of 1×10 8 CFU·mL -1 Apply 50 mL of the S8812 suspension to the maize roots. Four plants per pot were treated, with three replicates. A control (CK) was used for root irrigation. Daily growth observations were recorded. On the 30th day after root irrigation, plant height, root length, leaf length, stem diameter, fresh weight, and underground weight of the maize were measured.

[0117] The results showed that after root irrigation with S8812 suspension, corn grew vigorously, with an average plant height of 75.29±4.73cm, significantly 0.29 times higher than that of the control group; the average stem length was 44.23±3.35cm, significantly 0.33 times higher than that of the control group (see Figure 13 ).

[0118] The above-described embodiments merely represent preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the spirit of the present invention, and such modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. A salt-tolerant, nitrogen-fixing Klebsiella pasteurii S8812 strain, characterized in that: The strain was deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms (CGMCC) on March 21, 2025, and the strain deposit number is CGMCC No: 33923.

2. Use of the Klebsiella pastoris S8812 strain as claimed in claim 1 in promoting plant growth.

3. The use according to claim 2, characterized in that Such plants include, but are not limited to, corn and wheat.

4. Use of the Klebsiella pastoris S8812 strain as claimed in claim 1 in antibacterial treatment.

5. The use according to claim 4, characterized in that The antibacterial activity includes inhibition of pathogenic bacteria and pathogenic fungi, wherein the pathogenic bacteria include but are not limited to Pseudomonas syringae pv. oryzae and Pectobacterium solani, and the pathogenic fungi include but are not limited to Rhizoctonia solani.

6. Use of the Klebsiella pastoris S8812 strain according to claim 1 in nitrogen fixation, salt tolerance, organic phosphorus solubilization, potassium solubilization, amylase production, siderophore production, ammonia production, and plant growth hormone secretion.

7. A biological agent, characterized in that Containing the Klebsiella pastoris S8812 strain and / or the metabolites of Klebsiella pastoris S8812 according to claim 1.

8. The biological preparation according to claim 7, characterized in that The metabolites are substances secreted into the culture medium by Klebsiella pastoris S8812.

9. Use of the biological agent according to claim 7 or 8 in promoting plant growth and / or inhibiting bacteria, characterized in that: The plants include but are not limited to corn and wheat, and the antibacterial activity includes the inhibition of pathogenic bacteria and pathogenic fungi, wherein the pathogenic bacteria include but are not limited to oryzae leaf streak pathogen and pectinobacterium, and the pathogenic fungi include but are not limited to Rhizoctonia solani.

10. Use of the biological preparation according to claim 7 or 8 in nitrogen fixation and / or salt tolerance and / or organophosphorus solubilization and / or potassium solubilization and / or amylase production and / or siderophore production and / or ammonia production and / or plant growth hormone secretion.

Images