Application of rice gene SPPL1 and / or SPPL2 in improving high-temperature resistance of rice

Abstract

The invention relates to application of rice genes SPPL1 and / or SPPL2 in improving high-temperature resistance of rice. Specifically, rice genes SPPL1 and / or SPPL2 participating in positive regulation and control of high-temperature stress resistance are cloned in rice, so that the rice genes SPPL1 and / or SPPL2 are overexpressed, and compared with a wild plant, the rice gene SPPL1 and / or SPPL2 overexpressed plant shows high-temperature-resistant characteristics, and agronomic characters (such as maturing rate, thousand seed weight, single-plant yield, plot yield and the like) are remarkably improved. Through cloning and discovery of new functions of the rice gene SPPL1 and / or SPPL2, a new gene target and a new resource are provided for improving high-temperature resistance genetic breeding of rice.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to the application of rice genes SPPL1 and / or SPPL2 in improving the high temperature resistance of rice. Background Art

[0002] In recent years, rapid industrialization has led to increased greenhouse gas emissions, resulting in rising temperatures and posing significant challenges to plant growth and agricultural production. The Food and Agriculture Organization of the United Nations (FAO) has stated that due to climate change, global food production has declined by 30% since 2007, and the situation is expected to worsen. Rice is a staple crop in my country, cultivated on a large scale and crucial to national development. Researching the molecular mechanisms of rice's response to high-temperature stress and developing heat-resistant breeding materials are not only fundamental scientific questions in the interaction between plants and the environment, but also crucial national strategic requirements for the revitalization of my country's seed industry. Summary of the Invention

[0003] To address the challenges of the prior art, the present invention identified two high-temperature positive regulatory factors, signal peptide peptidase like 1 (SPPL1) and signal peptide peptidase like 2 (SPPL2), which help improve rice's heat resistance. Molecularly, high temperatures exacerbate protein misfolding, triggering endoplasmic reticulum stress (ER stress). Both SPPL1 and SPPL2 interact with DER1 / DER2, members of the HRD1 complex in the ER-associated protein degradation (ERAD) pathway, participating in the degradation of misfolded proteins in the ER via ERAD.

[0004] On this basis, the present invention provides, in one aspect, the use of the rice genes SPPL1 and / or SPPL2 for improving high-temperature resistance in rice. In another aspect, the present invention also provides a method for improving high-temperature resistance in rice. Furthermore, the present invention provides the use of the rice genes SPPL1 and / or SPPL2 for genetic breeding to improve high-temperature resistance in rice.

[0005] In this regard, the present invention includes but is not limited to the following:

[0006] In one aspect, the present invention provides an application of rice genes SPPL1 and / or SPPL2 in improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the rice genes SPPL1 and / or SPPL2 are overexpressed, and the rice variety improvement is to improve rice high temperature resistance.

[0007] In one aspect, the present invention provides an application of the rice gene SPPL1 in improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the rice gene SPPL1 is overexpressed, and the rice variety improvement is to improve rice high temperature resistance.

[0008] In one aspect, the present invention provides an application of the rice gene SPPL2 in improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the rice gene SPPL2 is overexpressed, and the rice variety improvement is to improve rice high temperature resistance.

[0009] In one aspect, the present invention provides an application of rice genes SPPL1 and SPPL2 in improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the rice genes SPPL1 and SPPL2 are overexpressed, and the rice variety improvement is to improve rice high temperature resistance.

[0010] In another aspect, the present invention provides the use of rice SPPL1 and / or SPPL2 proteins in improving rice high temperature resistance and / or rice variety improvement genetic breeding, wherein the rice variety improvement is to improve rice high temperature resistance.

[0011] In one aspect, the present invention provides a use of rice SPPL1 protein in improving high temperature resistance of rice and / or rice variety improvement genetic breeding, wherein the rice variety improvement is to improve high temperature resistance of rice.

[0012] In one aspect, the present invention provides a use of rice SPPL2 protein in improving high temperature resistance of rice and / or rice variety improvement genetic breeding, wherein the rice variety improvement is to improve high temperature resistance of rice.

[0013] In one aspect, the present invention provides the use of rice SPPL1 and SPPL2 proteins in improving rice high temperature resistance and / or rice variety improvement genetic breeding, wherein the rice variety improvement is to improve rice high temperature resistance.

[0014] In another aspect, the present invention provides a method for using a recombinant vector containing the rice genes SPPL1 and / or SPPL2 for improving rice heat resistance and / or rice variety improvement breeding, characterized in that the rice genes SPPL1 and / or SPPL2 are overexpressed, and the rice variety improvement is to improve rice heat resistance. Preferably, the recombinant vector of the present invention is a recombinant pCAMBIA1301 vector.

[0015] In one aspect, the present invention provides a recombinant vector containing the rice gene SPPL1 for use in improving rice heat resistance and / or rice variety improvement breeding, characterized in that the rice gene SPPL1 is overexpressed, and the rice variety improvement is to improve rice heat resistance. Preferably, the recombinant vector of the present invention is a recombinant pCAMBIA1301 vector.

[0016] In one aspect, the present invention provides a recombinant vector containing the rice gene SPPL2 for use in improving rice heat resistance and / or rice variety improvement breeding, characterized in that the rice gene SPPL2 is overexpressed, and the rice variety improvement is to improve rice heat resistance. Preferably, the recombinant vector of the present invention is a recombinant pCAMBIA1301 vector.

[0017] In one aspect, the present invention provides a recombinant vector containing the rice genes SPPL1 and SPPL2 for use in improving rice heat resistance and / or rice variety improvement breeding, characterized in that the rice genes SPPL1 and SPPL2 are overexpressed, and the rice variety improvement is to improve rice heat resistance. Preferably, the recombinant vector of the present invention is a recombinant pCAMBIA1301 vector.

[0018] In one aspect, the present invention provides a use of a genetically engineered bacterium for improving rice heat resistance and / or rice variety improvement and breeding, characterized in that the genetically engineered bacterium comprises a recombinant vector containing the rice genes SPPL1 and / or SPPL2, overexpressing the rice genes SPPL1 and / or SPPL2, and the rice variety improvement is to improve rice heat resistance. Preferably, the genetically engineered bacterium of the present invention is a genetically engineered Escherichia coli or Agrobacterium.

[0019] In one aspect, the present invention provides a use of a genetically engineered bacterium for improving rice heat resistance and / or rice variety improvement and breeding, characterized in that the genetically engineered bacterium comprises a recombinant vector containing the rice gene SPPL1 and overexpresses the rice gene SPPL1, and the rice variety improvement is to improve rice heat resistance. Preferably, the genetically engineered bacterium of the present invention is a genetically engineered Escherichia coli or Agrobacterium.

[0020] In one aspect, the present invention provides a use of a genetically engineered bacterium for improving rice heat resistance and / or rice variety improvement and breeding, characterized in that the genetically engineered bacterium comprises a recombinant vector containing the rice gene SPPL2 and overexpresses the rice gene SPPL2, and the rice variety improvement is to improve rice heat resistance. Preferably, the genetically engineered bacterium of the present invention is a genetically engineered Escherichia coli or Agrobacterium.

[0021] In one aspect, the present invention provides a use of a genetically engineered bacterium for improving rice heat resistance and / or rice variety improvement and breeding, characterized in that the genetically engineered bacterium comprises a recombinant vector containing the rice genes SPPL1 and SPPL2, overexpressing the rice genes SPPL1 and SPPL2, and the rice variety improvement is to improve rice heat resistance. Preferably, the genetically engineered bacterium of the present invention is a genetically engineered Escherichia coli or Agrobacterium.

[0022] In one aspect, the genetically engineered bacteria of the present invention is genetically engineered Agrobacterium EHA105.

[0023] In another aspect, the present invention provides a method for improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the method comprises: overexpressing rice genes SPPL1 and / or SPPL2, and the rice variety improvement is to improve rice high temperature resistance.

[0024] In one aspect, the present invention provides a method for improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the method comprises: overexpressing the rice gene SPPL1, and the rice variety improvement is to improve rice high temperature resistance.

[0025] In one aspect, the present invention provides a method for improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the method comprises: overexpressing the rice gene SPPL2, and the rice variety improvement is to improve rice high temperature resistance.

[0026] In another aspect, the present invention provides a method for improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that the method comprises: overexpressing rice genes SPPL1 and SPPL2, and the rice variety improvement is to improve rice high temperature resistance.

[0027] In another aspect, the present invention provides a method for obtaining rice plants with improved traits, characterized in that it comprises the following steps:

[0028] (1) using genetically engineered bacteria to infect rice callus; and

[0029] (2) culturing the infected rice callus into rice plants;

[0030] The genetically engineered bacteria comprises a recombinant vector containing rice genes SPPL1 and / or SPPL2, overexpresses the rice genes SPPL1 and / or SPPL2, and the improved trait is enhanced high temperature resistance of rice.

[0031] In one aspect, the present invention provides a method for obtaining rice plants with improved traits, characterized in that it comprises the following steps:

[0032] (1) using genetically engineered bacteria to infect rice callus; and

[0033] (2) culturing the infected rice callus into rice plants;

[0034] The genetically engineered bacteria comprises a recombinant vector containing the rice gene SPPL1, overexpresses the rice gene SPPL1, and the improved trait is enhanced high temperature resistance of rice.

[0035] In one aspect, the present invention provides a method for obtaining rice plants with improved traits, characterized in that it comprises the following steps:

[0036] (1) using genetically engineered bacteria to infect rice callus; and

[0037] (2) culturing the infected rice callus into rice plants;

[0038] The genetically engineered bacteria comprises a recombinant vector containing the rice gene SPPL2, overexpresses the rice gene SPPL2, and the improved trait is enhanced high temperature resistance of rice.

[0039] In one aspect, the present invention provides a method for obtaining rice plants with improved traits, characterized in that it comprises the following steps:

[0040] (1) using genetically engineered bacteria to infect rice callus; and

[0041] (2) culturing the infected rice callus into rice plants;

[0042] The genetically engineered bacteria comprises a recombinant vector containing rice genes SPPL1 and SPPL2, overexpresses the rice genes SPPL1 and SPPL2, and the improved trait is enhanced high temperature resistance of rice.

[0043] The SPPL1 gene involved in the present invention is a signal peptide peptidase-like protein gene on rice chromosome 2, numbered Os02g0823000 (RAP number) or LOC_Os02g57710 (MSU number). The SPPL1 DNA is 5608 bp long and has 14 exons, and its sequence is shown in SEQ ID NO:1. Its coding region CDS is 1638 bp long and its sequence is shown in SEQ ID NO:2. It encodes 359 amino acids and its sequence is shown in SEQ ID NO:3.

[0044] The SPPL2 gene involved in the present invention is a signal peptide peptidase-like protein gene on rice chromosome 6, numbered Os06g0730900 (RAP number) or LOC_Os06g51430 (MSU number). The SPPL2 DNA is 5264 bp long and has 14 exons, and its sequence is shown in SEQ ID NO:4. Its coding region CDS is 1629 bp long and its sequence is shown in SEQ ID NO:5. It encodes 542 amino acids and its sequence is shown in SEQ ID NO:6.

[0045] In one aspect, the rice gene SPPL1 of the present invention encodes the amino acid sequence shown in SEQ ID NO: 3. Preferably, the coding region sequence of the rice gene SPPL1 is shown in SEQ ID NO: 2.

[0046] In one aspect, the rice gene SPPL1 of the present invention encodes the amino acid sequence shown in SEQ ID NO:3.

[0047] In one aspect, the base sequence of the rice gene SPPL1 of the present invention is shown in SEQ ID NO: 1.

[0048] In one aspect, the coding region sequence of the rice gene SPPL1 of the present invention is shown in SEQ ID NO: 2.

[0049] In one aspect, the rice gene SPPL2 of the present invention encodes the amino acid sequence shown in SEQ ID NO: 6. Preferably, the coding region sequence of the rice gene SPPL2 is shown in SEQ ID NO: 5.

[0050] In one aspect, the rice gene SPPL2 of the present invention encodes the amino acid sequence shown in SEQ ID NO:6.

[0051] In one aspect, the base sequence of the rice gene SPPL2 of the present invention is shown in SEQ ID NO:4.

[0052] In one aspect, the coding region sequence of the rice gene SPPL2 of the present invention is shown in SEQ ID NO:5.

[0053] Preferably, the improved high temperature resistance of rice according to the present invention is manifested in that, compared with wild-type plants, under high temperature conditions, the agronomic traits (for example, fruit set rate, 1000-grain weight, yield per plant and yield per plot, etc.) of the plants overexpressing the rice genes SPPL1 and / or SPPL2 according to the present invention are significantly improved.

[0054] Furthermore, the high temperature mentioned in the present invention refers to a maximum daily temperature equal to or greater than 35°C.

[0055] In one aspect, the rice of the present invention is rice variety ZH11 (Zhonghua 11).

[0056] For plants overexpressing the genes SPPL1 and / or SPPL2, SPPL1OE and SPPL2OE were used to obtain the complete SPPL1 and SPPL2 coding region sequences by PCR amplification. These sequences were then ligated into the overexpression vector pCAMBIA1301-UBI at the SmaⅠ restriction site by homologous recombination. The primers were designed as follows:

[0057] SPPL1OE F:TAGAGGATCCGGTACCACCCATGGGCACCAGCTCCGCCGGAGATG;

[0058] SPPL1OE R:TCAGTTCTAGATCGATTCCCCGAGCTTACAGCATCACAATTGGTG.

[0059] SPPL2OE F:TAGAGGATCCGGTACCACCCATGGCCGCCGCCACCGCCGCGGTTTTTG;

[0060] SPPL2OE R:TCAGTTCTAGATCGATTCCCCTGGACTAGTGGGGGCGTCTTCGGCTG.

[0061] The present invention provides an overexpression vector containing the above design.

[0062] The present invention provides Escherichia coli and Agrobacterium containing the above overexpression vector. Preferably, the Agrobacterium of the present invention is Agrobacterium EHA105.

[0063] The present invention provides a method for transforming a vector into the rice variety ZH11 by using Agrobacterium, and screening to obtain genetically modified rice plants. The specific method is as follows: (1) Constructing an engineered bacterium: The constructed vector is transformed into the Agrobacterium strain EHA105 by the freeze-thaw method, and the positive Agrobacterium is obtained by screening with kanamycin and rifampicin. (2) Transforming rice callus and obtaining transgenic positive seedlings: EHA105 infects rice callus and co-cultures them in a 22°C culture room for 3 days. After washing away the Agrobacterium with a carboxybenzyl solution, the rice callus is placed on a screening culture medium containing a suitable antibiotic for culture. After 3-4 weeks of culture, resistant calli can be obtained, and the resistant calli are differentiated into seedlings. (3) Identifying positive plants: The positive plants are identified by Western blotting, and two independent transformed lines are selected for subsequent experiments.

[0064] The present invention has the advantage of cloning the rice genes SPPL1 and / or SPPL2, which are involved in positively regulating heat stress resistance, in rice. Overexpressing these genes results in plants exhibiting heat tolerance and significantly improved agronomic traits (e.g., seed set rate, 1000-grain weight, yield per plant, and plot yield) compared to wild-type plants. The cloning and discovery of new functions of the rice genes SPPL1 and / or SPPL2 provide new gene targets and resources for improving genetic breeding for heat resistance in rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 It shows that the genes SPPL1 and SPPL2 are induced by TM and their proteins are localized in the endoplasmic reticulum:

[0066] (a) and (b) In wild-type plants and the bzip60 mutant, SPPL1 and SPPL2 are upregulated by the ER stress inducer tunicamycin™. In the bzip50 mutant, SPPL1 and SPPL2 are less induced, suggesting that bzip50 plays a role in regulating SPPL1 and SPPL2 expression. (c) Subcellular localization of SPPL1 and SPPL2 shows that both are localized to the ER.

[0067] Figure 2 SPPL1 and SPPL2 are shown to help alleviate ER stress:

[0068] (a) Under normal conditions, there were no differences in plant height, root length, or fresh weight between wild-type plants and plants with either single or double TM. (b) After two weeks of hydroponic culture with 1 μg / mL TM, there were no differences in plant height, root length, or fresh weight between the single TM and wild-type plants, while the double TM showed signs of slow growth, with significantly lower plant height, root length, and fresh weight. (c) Under normal conditions, plants overexpressing SPPL1 (two lines, SPPL1OE-1 and SPPL1OE-2, were propagated and subsequently tested) and plants overexpressing SPPL2 (two lines, SPPL2OE-1 and SPPL2OE-2, were propagated and subsequently tested) showed no differences in plant height, root length, or fresh weight compared to the wild-type. (d) After TM treatment, plants overexpressing SPPL1 and SPPL2 showed increased TM tolerance, with significantly higher plant height, root length, and fresh weight than wild-type plants.

[0069] Figure 3 Shows transcriptome results, which indicate that SPPL1 and SPPL2 are involved in the endoplasmic reticulum stress pathway:

[0070] (a) Transcriptome analysis was performed using four data sets: wild-type ZH11, ZH11-TM, the sppl1 / 2 double mutant, and the sppl1 / 2-TM transcriptome. During the construction of the double mutant, many individual strains were obtained; two strains (sppl1 / 2-1 and sppl1 / 2-2) were selected for subsequent experiments. KEGG pathways were enriched for "Protein processing in the endoplasmic reticulum" and "Chaperones and protein folding catalysts." (b) RT-qPCR validation was performed on selected UPR (Unfolded Protein Response) genes. (c) In the double mutant setting, protein folding-related genes, such as CNX, CRT, and BiP, are significantly upregulated due to the inability to clear misfolded proteins.

[0071] Figure 4 Showing that SPPL1, SPPL2 interact with DER1, DER2:

[0072] (ab) Screening of yeast membrane libraries revealed that SPPL2 interacts with both DER1 and DER2. Furthermore, one-to-one interactions confirmed that SPPL1 also interacts with DER1 and DER2. (cd) In-cell bimolecular fluorescence complementation (BiFC) experiments further confirmed the pairwise interaction between SPPL1 / 2 and DER1 / 2. In this assay, yellow fluorescent protein (YFP) was split into two segments, cYFP and nYFP. SPPL1 or SPPL2 was linked to cYFP, and DER1 or DER2 was linked to nYFP. Fluorescence signals were observed when SPPL interacted with DER proteins. (ef) In vitro pull-down experiments also confirmed that SPPL1 / 2 interacted with DER1 / 2.

[0073] Figure 5 Showing that SPPL1 / 2 is involved in the degradation of the artificial substrate ZmFL2m-GFP

[0074] In maize, the signal peptide of wild-type Floury2 (FL2) is cleaved, while FL2m (Floury2mutation) harbors an amino acid mutation at the signal peptide cleavage site, preventing signal peptidase cleavage and leading to protein retention at the endoplasmic reticulum membrane. This leads to protein folding defects and ER stress. Therefore, an artificial substrate, FL2m, was designed and fused to the green fluorescent protein (GFP), resulting in N-terminal retention and embedding in the endoplasmic reticulum membrane. (a) In rice protoplasts, FL2m-GFP exhibits punctate structures compared to FL2-GFP. When co-transformed with SPPL1 or SPPL2, the punctate structures disappear and colocalize with an endoplasmic reticulum marker. (bc) In rice protoplasts, bimolecular fluorescence complementation (BiFC) confirmed the interaction between SPPL1 / 2 and FL2m-GFP. (de) In transiently expressed tobacco, BiFC confirmed the interaction between SPPL1 / 2 and FL2m-GFP, with interaction observed at punctate structures, suggesting involvement in the degradation of the substrate FL2m-GFP.

[0075] Figure 6 Showing the difference in ZmFL2m-GFP abundance in different backgrounds of stable transgenic plants:

[0076] (ab) In a tobacco transient expression system, co-transfection with SPPL1 or SPPL2 significantly accelerated the degradation of FL2m-GFP, a process that was dependent on the 26S proteasome. CHX (cycloheximide) inhibits protein translation. This means that after total protein extraction, adding CHX inhibits new protein production and maintains a consistent background level. In the case of MG132, because complete protein degradation relies on the 26S proteasome system and MG132 is an inhibitor of this system, adding MG132 prevents protein degradation. (c) By hybridization, FL2m-GFP or FL2-GFP was introduced into different backgrounds (SPPL1 / 2 double mutant or overexpression). Phenotypically, sppl1 / 2 double mutant / FL2m-GFP plants exhibited dwarf stature, while sppl1 / 2 double mutant / FL2-GFP plants showed no significant differences from wild-type plants. (de) Although RNA levels were similar across different backgrounds, at the protein level, FL2m-GFP accumulated significantly in the sppl1 / 2 double mutant background due to inability to degrade.

[0077] Figure 7 Showing that SPPL1 and SPPL2 are involved in high temperature resistance:

[0078] (a) During the seedling stage, high temperature treatment significantly reduced the survival rate of sppl1 / 2 double mutant plants. (b) Overexpression of SPPL1OE or SPPL2OE significantly improved heat tolerance. (cd) During the reproductive stage, under normal growth conditions, agronomic traits of sppl1 / 2 double mutant plants did not differ from those of the wild type; however, high temperature treatment significantly reduced seed set and yield in the mutants. (eh) During the reproductive stage, under normal growth conditions, agronomic traits of plants overexpressing SPPL1OE (ef) or SPPL2OE (gh) did not differ from those of the wild type; however, high temperature treatment significantly improved seed set and yield in the overexpressing plants.

[0079] Figure 8 Showing the field performance of SPPL1 / 2 overexpressing plants:

[0080] (ad) Wild-type ZH11, SPPL1OE, and SPPL2OE overexpressing materials were planted in designated transgenic bases and managed according to normal agronomic practices. At maturity and harvest, photos were taken and agronomic traits such as seed set rate, 1000-grain weight, yield per plant, and yield per plot were evaluated. DETAILED DESCRIPTION

[0081] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. The experimental methods in the following examples without specifying specific conditions are all carried out according to conventional procedures. The molecular biology and biochemical methods involved in the examples are all known technologies, mainly with reference to Current Protocols in Molecular Biology written by Ausubel, and Molecular Cloning: A Laboratory Manual, 4th ED. written by Green MR and Sambrook J. The experimental materials used in the examples are all commercially available products unless otherwise specified.

[0082] Example 1 SPPL1 / 2 helps alleviate endoplasmic reticulum stress

[0083] bZIP50 and bZIP60 function to respond to unfolded proteins. Specifically, when protein folding in the endoplasmic reticulum (ER) is disrupted, misfolded proteins accumulate there. bZIP50 and bZIP60 sense this error and promote the expression of downstream genes, such as chaperone genes (a process known as the unfolded protein response (UPR)). Chaperone gene expression helps misfolded proteins refold correctly. Misfolded proteins can also undergo direct clearance and degradation, known as the ERAD pathway. SPPL1 and SPPL2 are members of the ERAD pathway. For more information, see the paper published by our laboratory: Zhou YF, Qing T., Shu XL, Liu JX, 2022. Unfolded protein response and storage product accumulation in rice grains. Seed Biology, 1:4. Rice mutants with knockout genes bzip50 and bzip60 are available.

[0084] Wild-type Zhonghua 11 (ZH11) and mutant rice lines with knockout genes bzip50 and bzip60 were treated with 5 μg / mL tunicamycin (TM). Root tissues were harvested at different time points (0 h, 2 h, 4 h, and 8 h), and RNA was extracted and quantitatively analyzed for the expression levels of SPPL1 and SPPL2. In wild-type rice, the expression of SPPL1 and SPPL2 was induced by the endoplasmic reticulum stress inducer TM. However, in the bzip50 mutant background, the upregulation of SPPL1 and SPPL2 was minimal, indicating that bzip50 regulates the expression of SPPL1 and SPPL2. Figure 1 a). In addition, both SPPL1 and SPPL2 are induced by high temperature treatment, but the upregulation of SPPL1 and SPPL2 is smaller in the bzip50 mutant background ( Figure 1 b). Subcellular localization experiments showed that both SPPL1 and SPPL2 proteins were localized in the endoplasmic reticulum ( Figure 1 c) This suggests that bZIP50, in addition to regulating molecular chaperones, also regulates the expression of SPPL1 / 2 genes, thereby eliminating erroneous proteins.

[0085] Tunicamycin TM treatment can induce endoplasmic reticulum stress. After 2 weeks of treatment with 1 μg / mL TM, wild-type, SPPL1 or SPPL2 single mutants, SPPL1 and SPPL2 double mutants, and their respective overexpression plants were compared in terms of root length, plant height, and fresh weight. Under normal culture conditions, no significant differences in growth were observed between the materials ( Figure 2 a; Figure 2c). After tunicamycin treatment, the SPPL1 or SPPL2 single mutants were close to the wild type with no significant difference; the SPPL1 and SPPL2 double mutants showed growth defects, with a significant decrease in root length, plant height and fresh weight ( Figure 2 b); Plants overexpressing SPPL1 or SPPL2, SPPL1OE or SPPL2OE, showed TM resistance, and their growth indicators were significantly better than those of wild-type plants ( Figure 2 d) These results indicate that SPPL1 and SPPL2 are ER stress response factors and play a positive regulatory role in maintaining ER homeostasis.

[0086] Example 2 Transcriptome results indicate that SPPL functional loss induces an unfolded protein response

[0087] In order to fully understand the functions of SPPL1 and SPPL2 in maintaining endoplasmic reticulum homeostasis, the mutant effects were comprehensively analyzed through transcriptome data. Wild-type and double mutant plants that were 2 weeks old were taken and treated with 10μg / mL TM for 4 hours, and the root tissues were taken for transcriptome sequencing. Four comparison groups were set up: WT-TM vs WT; sppl1 / 2-TM vs sppl1 / 2; sppl1 / 2 vs WT and sppl1 / 2-TM vs WT-TM. The results showed that tunicamycin is an inducer of endoplasmic reticulum protein misfolding, which triggers endoplasmic reticulum stress. After treatment, the sppl1 / 2 mutant cannot clear the misfolded protein, causing an unfolded misfolded protein response. The differentially expressed genes were enriched in the KEGG pathway to "Protein processing in endoplasmic reticulum" and "Chaperones and fold catalysts" ( Figure 3 ab). The expression levels of protein folding-related genes CNX, CRT, BiP and other molecular chaperone genes in the double mutant background are higher than those in wild-type ZH11 ( Figure 3 c).

[0088] Example 3 SPPL1 / 2 participates in the ERAD pathway by interacting with DER1 / 2 proteins

[0089] In order to further explore how SPPL participates in the endoplasmic reticulum-associated protein degradation (ER associated protein degradation, ERAD) pathway, a yeast membrane system two-hybrid screening library was performed using SPPL2 as a "bait". SPPL1 / 2 is a transmembrane protein located in the endoplasmic reticulum, so the yeast membrane system two-hybrid screening library was used. According to the annotations on the Uniprot website, both SPPL1 and SPPL2 carry signal peptide sequences, with the N segment facing the endoplasmic reticulum cavity and the C terminus facing the cytoplasm. SPPL2 was selected to carry out the membrane system screening library experiment, connected to the vector pBT3-SUC, and transferred into the yeast strain NMY51. After that, the library plasmid was transformed and potential interacting proteins were screened on a four-deficient plate. According to the screening library results, SPPL2 interacted with DER1 and DER2. Further one-to-one yeast interaction experiments verified that SPPL1 and SPPL2 can interact with DER1 and DER2 ( Figure 4 In addition, the bimolecular fluorescence complementation assay (BiFC) was performed in protoplast cells. Figure 4 cd), and in vitro Pull down ( Figure 4 e) all demonstrated that SPPL1 / 2 interacts with DER1 / 2. Therefore, SPPL1 / 2 participates in the ERAD pathway through DER proteins.

[0090] Example 4 Degradation of substrate FL2m-GFP by SPPL1 / 2

[0091] Signal peptide peptidase (SPP) degrades signal peptides on the endoplasmic reticulum membrane, so similar proteins SPPL1 / 2 are likely to be proteases that degrade misfolded membrane proteins, thus playing an important role in the ERAD pathway. To further answer whether SPPL can degrade membrane protein substrates, an artificial mutant protein FL2m-GFP was created. Its mutation site is located at the signal peptide cleavage site. The mutation causes misfolding to be retained in the endoplasmic reticulum membrane. Through transient expression in rice protoplasts, FL2-GFP co-localized with the endoplasmic reticulum marker, but FL2m-GFP showed a dot-like structure free from the endoplasmic reticulum and did not completely overlap with the endoplasmic reticulum marker ( Figure 5 a). At the same time, co-transfection of SPPL1 or SPPL2 with FL2m-GFP can reduce the punctate structure of FL2m-GFP ( Figure 5 a). In rice protoplasts, bimolecular fluorescence complementation experiments showed that FL2m-GFP interacted with SPPL1 or SPPL2 ( Figure 5 b) In the tobacco expression system, BiFC experiments also clearly observed interaction at punctate structures, suggesting that SPPL1 or SPPL2 interacts with FL2m-GFP and participates in its degradation.

[0092] At the protein level, the presence of SPPL1 or SPPL2 can significantly accelerate the degradation of the substrate FL2m-GFP ( Figure 6 ab). When FL2m-GFP was introduced into various backgrounds by hybridization, the sppl1 / 2 double mutant / / FL2m-GFP plants showed significantly shorter plant heights, while the sppl1 / 2 double mutant / / FL2-GFP plants showed no significant differences ( Figure 6 c). Although the expression levels of FL2m-GFP in each material were similar at the RNA level, at the protein level, FL2m-GFP protein accumulated in sppl1 / 2 / / FL2m-GFP plants ( Figure 6 de).

[0093] Example 5 SPPL1 / 2 positively regulates high temperature stress resistance

[0094] Stress, especially high temperature, can easily lead to the accumulation of misfolded proteins, causing endoplasmic reticulum stress. Under normal temperature conditions, both single and double mutants showed no significant differences in plant height and fresh weight compared to wild-type ZH11 plants. After 2 days of high temperature treatment at 45°C and 7 days of recovery to normal temperature, the survival rate of single mutant sppl1 or sppl2 plants was close to that of the wild type, but the double mutant sppl1 / 2 showed high temperature sensitivity, with a significantly reduced survival rate ( Figure 7 a). At the same time, under normal conditions, there was no significant difference between the SPPL1 / 2 overexpressing plants (SPPL1OE or SPPL2OE) and the wild-type ZH11 plants. After the above-mentioned high temperature treatment, both SPPL1OE and SPPL2OE showed enhanced high temperature resistance and significantly improved survival rate ( Figure 7 b).

[0095] During the reproductive period, under normal conditions, there is no difference in agronomic traits between sppl1 / 2 mutants and wild type ( Figure 7 c). At the same time, rice tillers at the same heading stage were selected and marked, and then subjected to a high temperature treatment at 38°C for 3 days, and then to normal temperature until the seeds matured. After the high temperature treatment, the seed setting rate, yield per plant, and 1000-grain weight of Shuangtu were significantly lower than those of the wild type ( Figure 7 d). Plants overexpressing SPPL1OE and SPPL2OE are similar to wild-type plants at normal temperature ( Figure 7 e; Figure 7 g), showed high temperature resistance under high temperature conditions, and agronomic traits were significantly improved ( Figure 7 f; Figure 7 h).

[0096] Example 6 Small-scale field trial of SPPL1 / 2 overexpressing plants

[0097] In June 2024, wild-type ZH11, SPPL1OE, and SPPL2OE materials were planted at the transgenic base of the Agricultural Experiment Station in Changxing County, Huzhou City, Zhejiang Province. They were managed according to normal agronomic measures and harvested in mid-October. Agronomic traits such as seed setting rate, 1000-grain weight, and yield per plant were examined. Figure 8 ab) and SPPL2OE( Figure 8 The field traits of the two independent materials of (cd) were significantly higher than those of the wild type, showing potential for application in rice agricultural production.

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

Claims

1. Application of rice genes SPPL1 and / or SPPL2 in improving rice high temperature resistance and / or rice variety improvement and breeding, characterized in that: The rice gene SPPL1 and / or SPPL2 is overexpressed, and the rice variety is improved to enhance the high temperature resistance of the rice.

2. Application of rice SPPL1 and / or SPPL2 protein in improving high temperature resistance of rice and / or rice variety improvement genetic breeding, wherein the rice variety improvement is to improve high temperature resistance of rice.

3. Use of a recombinant vector containing rice genes SPPL1 and / or SPPL2 in improving rice high temperature resistance and / or rice variety improvement genetic breeding, characterized in that: The rice gene SPPL1 and / or SPPL2 is overexpressed, and the rice variety is improved to enhance the high temperature resistance of the rice.

4. Use of a genetically engineered bacterium in improving the high temperature resistance of rice and / or in genetic breeding for rice variety improvement, characterized in that: The genetically engineered bacteria comprises a recombinant vector containing rice genes SPPL1 and / or SPPL2, overexpresses the rice genes SPPL1 and / or SPPL2, and the rice variety is improved to enhance the high temperature resistance of rice.

5. A method for improving the high temperature resistance of rice and / or improving rice varieties through genetic breeding, characterized in that: The method comprises: overexpressing rice genes SPPL1 and / or SPPL2, and improving the rice variety to enhance the high temperature resistance of the rice.

6. A method for obtaining rice plants with improved traits, characterized in that: The following processing steps are included: (1) using genetically engineered bacteria to infect rice callus; and (2) culturing the infected rice callus into rice plants; The genetically engineered bacteria comprises a recombinant vector containing rice genes SPPL1 and / or SPPL2, overexpresses the rice genes SPPL1 and / or SPPL2, and the improved trait is enhanced high temperature resistance of rice.

7. The use according to any one of claims 1 to 4 or the method according to 5 or 6, characterized in that The rice gene SPPL1 encodes the amino acid sequence shown in SEQ ID NO:

3. Preferably, the coding region sequence of the rice gene SPPL1 is shown in SEQ ID NO:

2.

8. The use according to any one of claims 1 to 4 or the method according to 5 or 6, characterized in that The rice gene SPPL2 encodes the amino acid sequence shown in SEQ ID NO:

6. Preferably, the coding region sequence of the rice gene SPPL2 is shown in SEQ ID NO: 5.

Images