Application of oilseed rape chitinase EP3 and coding gene thereof in improving clubroot resistance of cruciferous plants

Abstract

The invention discloses application of oilseed rape chitinase EP3 and a coding gene thereof in improving clubroot resistance of cruciferous plants, and belongs to the technical field of molecular biology. The invention discloses the application of the rape chitinase EP3 in improving the clubroot resistance of plants for the first time. The amino acid sequence of the rape chitinase EP3 is as shown in SEQ ID NO.2; the nucleotide sequence of the coding gene EP3 is shown as SEQ ID NO. 1. Experimental results show that by preparing agrobacterium containing an EP3 gene overexpression vector and using a treating fluid containing the agrobacterium to perform seed soaking and root irrigation treatment, the EP3 gene is overexpressed in a rape plant, and the clubroot resistance of the rape can be remarkably improved. The invention provides a new gene resource and a safe, efficient, simple, convenient and universal prevention and treatment method for preventing and treating clubroot of cruciferous plants, and has remarkable agricultural application value and wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, in particular to application of rapeseed chitinase EP3 and a coding gene thereof in improving the clubroot resistance of cruciferous plants. Background Art

[0002] Clubroot, caused by the fungus Plasmodiophora brassicae Woronin, is a worldwide soil-borne disease that severely damages important cruciferous crops such as rapeseed and cabbage. The prevention and control of this disease still faces numerous challenges. While crop rotation is a recommended management measure, the dormant spores of the fungus can survive for years in the absence of a host, making it difficult to sustain cruciferous crop cultivation in severely infected fields. Chemical pesticides also carry residual risks and have limited applicability. Consequently, both field management and chemical control have failed to fundamentally control clubroot.

[0003] Currently, clubroot-resistant germplasm resources are scarce, and progress in cloning resistance genes and breeding is slow. There is an urgent need to discover new resistance-related genes, especially broad-spectrum resistance genes, to meet the needs of improving host resistance. Furthermore, given that clubroot can infect a variety of commonly grown cruciferous vegetables, including Chinese cabbage, pak choy, cauliflower, cabbage, and rapeseed, establishing broad-spectrum control methods that do not rely on genetic manipulation is of great theoretical and practical significance.

[0004] Chitinases play an important role in plant development and stress tolerance, but their application in disease control is insufficient. Currently, there are no reports on transient overexpression of chitinase EP3 to enhance plant clubroot resistance. Therefore, there is an urgent need to provide information on the role of chitinase EP3 in clubroot control in cruciferous crops. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of rapeseed chitinase EP3 and its encoding gene in improving the clubroot disease resistance of cruciferous plants, so as to solve the problems existing in the above-mentioned prior art. The present invention significantly improves the clubroot disease resistance of rapeseed by overexpressing the EP3 gene in rapeseed plants, providing a new gene resource and a safe, efficient, simple and universal prevention and control method for the prevention and control of clubroot disease in cruciferous plants.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of rapeseed chitinase EP3 in any of the following:

[0008] (1) Improve the resistance of cruciferous plants to clubroot disease;

[0009] (2) Cultivate cruciferous plant varieties with improved clubroot resistance;

[0010] (3) Preparation of products for regulating clubroot resistance in cruciferous plants;

[0011] The amino acid sequence of the rapeseed chitinase EP3 is shown in SEQ ID NO.2.

[0012] The present invention also provides an application of the above-mentioned rapeseed chitinase EP3 encoding gene in any of the following:

[0013] (1) Improve the resistance of cruciferous plants to clubroot disease;

[0014] (2) Cultivate cruciferous plant varieties with improved clubroot resistance;

[0015] (3) preparing products for regulating clubroot resistance in cruciferous plants;

[0016] The nucleotide sequence of the coding gene is shown in SEQ ID NO.1.

[0017] Furthermore, the expression level of the rape chitinase EP3 or its encoding gene is up-regulated in cruciferous plants to improve the clubroot resistance of the cruciferous plants;

[0018] The cruciferous plant is rapeseed or cabbage.

[0019] The present invention also provides an application of an overexpression vector, wherein the overexpression vector overexpresses a gene encoding rapeseed chitinase EP3;

[0020] The nucleotide sequence of the coding gene is shown in SEQ ID NO.1;

[0021] The application is any of the following:

[0022] (1) Improve the resistance of cruciferous plants to clubroot disease;

[0023] (2) Cultivate cruciferous plant varieties with improved clubroot resistance;

[0024] (3) Prepare products for regulating clubroot resistance in cruciferous plants.

[0025] The present invention also provides a use of an engineered bacterium comprising the above-mentioned overexpression vector in any of the following:

[0026] (1) Improve the resistance of cruciferous plants to clubroot disease;

[0027] (2) Cultivate cruciferous plant varieties with improved clubroot resistance;

[0028] (3) Prepare products for regulating clubroot resistance in cruciferous plants.

[0029] The present invention also provides a method for improving the clubroot disease resistance of cruciferous plants, comprising the steps of increasing the expression level of a gene encoding rapeseed chitinase EP3 in the cruciferous plants to improve the clubroot disease resistance of the cruciferous plants;

[0030] The nucleotide sequence of the coding gene is shown in SEQ ID NO.1.

[0031] Furthermore, the method of increasing the expression level of the gene encoding the rapeseed chitinase EP3 comprises the following steps: constructing an overexpression vector of the gene encoding the rapeseed chitinase EP3, transforming the overexpression vector into Agrobacterium, and then infecting cruciferous plants with a treatment solution containing the Agrobacterium;

[0032] The cruciferous plant is rapeseed or cabbage;

[0033] The infection method includes seed soaking and root irrigation.

[0034] The present invention also provides a method for cultivating a crucifer plant with improved clubroot resistance, comprising the steps of overexpressing a gene encoding rapeseed chitinase EP3 in a crucifer plant;

[0035] The nucleotide sequence of the coding gene is shown in SEQ ID NO.1.

[0036] Furthermore, the cruciferous plant is rapeseed or cabbage.

[0037] The present invention also provides a method for preventing and treating clubroot, comprising the following steps:

[0038] constructing an overexpression vector of a gene encoding rapeseed chitinase EP3, transforming the overexpression vector into Agrobacterium, preparing a treatment solution containing the Agrobacterium, and then using the treatment solution containing the Agrobacterium to infect cruciferous plants;

[0039] Wherein, the nucleotide sequence of the coding gene is shown as SEQ ID NO.1;

[0040] The cruciferous plant is rapeseed or cabbage;

[0041] The infection method includes seed soaking and root irrigation.

[0042] The present invention discloses the following technical effects:

[0043] The present invention discloses for the first time the use of rapeseed chitinase EP3 in improving plant resistance to clubroot. The amino acid sequence of rapeseed chitinase EP3 is shown in SEQ ID NO.2; the nucleotide sequence of its encoding gene EP3 is shown in SEQ ID NO.1. Experimental results show that by preparing Agrobacterium containing an EP3 gene overexpression vector, using a treatment solution containing Agrobacterium for seed soaking and root irrigation, and overexpressing the EP3 gene in rapeseed plants, the clubroot resistance of rapeseed can be significantly improved. The present invention provides a new gene resource and a safe, efficient, simple and universal prevention and control method for the prevention and control of clubroot in cruciferous plants, and has significant agricultural application value and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0045] Figure 1 Figure 2 shows the results of the clubroot resistance experiment in the control group (CK) and the EP3 overexpression group (EP3-OX); A shows the root tumor symptoms of cabbage; B shows the disease index statistical results; **** indicates P < 0.0001;

[0046] Figure 2 Figure 1 shows the results of the clubroot resistance experiment for the control group (CK), EP3 overexpression group (EP3-OX), and EP3 silenced group (EP3-VIGS); A shows the root tumor symptoms of rapeseed, with a scale of 1 cm; B shows the disease index statistical results, with **** indicating P < 0.0001;

[0047] Figure 3 Figure 2 is the fluorescence quantitative PCR detection result of the expression level of the root knot fungus gene Pbactin in the control group (CK) and EP3 overexpression group (BnEP3-OX) infected with different root knot fungus dormant spore concentrations; A is the root knot fungus dormant spore concentration of 10 6 spores / mL; B is the concentration of dormant spores of root knotweed fungus 10 7 Spores / mL; C is the concentration of dormant spores of root knotweed fungus 10 8 Spores / mL; *** indicates P < 0.001; **** indicates P < 0.0001;

[0048] Figure 4 The concentration of dormant spores of different root knotweed fungi (10 6 -10 8spores / mL) infection of rapeseed clubroot disease index in the control group (CK) and EP3 overexpression group (BnEP3-OX); *** indicates P < 0.001; **** indicates P < 0.0001. DETAILED DESCRIPTION

[0049] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0050] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0051] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0052] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0053] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0054] The present invention relates to the following biological materials:

[0055] Agrobacterium GV3101: purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0056] pBIB-BASTA-35S-GWR-GFP plant expression vector: Construction process reference Jin, Chuang et al. "Mitogen-Activated Protein Kinase MAPKKK7 from Plasmodiophora brassicae Regulates Low-Light-Dependent Nicotiana benthamiana Immunity." Phytopathology vol. 111, 6 (2021): 1017-1028.

[0057] Swollen roots (infected with Plasmodiophora race 4): Treatment process reference Yang, Hui et al. “Comparing the infection biology and gene expression differences of Plasmodiophora abrasives primary and secondary zoospores.” Frontiers in microbiology vol. 131002976. 1Dec. 2022.

[0058] Cabbage seeds: cabbage variety early maturing No. 5, purchased from Hangzhou Liuhe Seed Co., Ltd.

[0059] Rapeseed seeds: The rapeseed variety Youmanduo was purchased from Sichuan Fule Seed Co., Ltd.

[0060] The present invention relates to the following culture medium:

[0061] LB solid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride; add 15 g / L agar. Sterilize at 121°C for 30 min.

[0062] LB liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride. Sterilize at 121°C for 30 min.

[0063] The clubroot disease index grading standard of the present invention is based on the four-level scale used by Xue et al. (2008): Grade 0, no nodules; Grade 1, a few small nodules (less than 1 / 3 of the roots have small nodules); Grade 2, moderate nodules (1 / 3-2 / 3 of the roots have small to medium-sized nodules); Grade 3, severe nodules (more than 2 / 3 of the roots have medium to large nodules). The disease index is calculated as follows: Disease Index = ∑ (number of diseased plants at each level × relative level value) × 100 / (total number of plants surveyed × representative value of the highest level).

[0064] Example 1 Effects of transient expression of EP3 in host cabbage on infection and symptom formation of root knotweed fungi

[0065] 1. Construction of EP3 plant expression vector

[0066] (1) The EP3 nucleotide sequence was obtained from the website NCBI (National Center for Biotechnology Information). Its CDS sequence is shown in SEQ ID NO. 1, and the amino acid sequence of EP3 protein is shown in SEQ ID NO. 2.

[0067] SEQ ID NO.1:

[0068] ATGTTGACTCACGCTATTTCTAAACCCATCCTCATAGTAACCATTCTATTAGTTCTACAAGCTTTCTATACCACAACAAAGGCTCAAAACTGTGGTTGTTCGCCAGACCTATGTTGTAGTCAGTTCGGTTTCTGCGGTAGCACTTCAGACTATTGTGGTGTAGGTTGTCAACAAGGGCCTTGTTTTGCCCCTCCTCCTGCAAACGGTGTCTCGGTTGATGAAATTGTCACACAAGAATTCTTCAATGGAATCATCGACCAAGCCGAGTCTAGTTGCGCTGGTAATGGATTTTACAGCCGAGGAGCTTTTCTTGAGGCCTTAGAGTCATATTCCCGTTTCGCTAGGATTGGTTCGGTCGATGATTCTAGGCGTGAGATCGCAGCCTTCTTTGCCCATGTCACGCATGAAACTGGACATTTTTGCTACATAGAAGAAATAAACGGACCCTCAAGGGATTATTGCGACGAGAACGCGACGCAGTATCCATGCAATCCCAACAAAGGCTATTACGGCCGCGGACCGATCCAACTCTCTTGGAATTTCAACTACGGGCCAGCTGGAACCGCGATTGGTTTTGACGGTCTCAACGCACCAGAAACAGTAGCCACGGATCCAGTCATATCCTTCAAGACCGCCTTGTGGTACTGGACCAATAGAGTTCAGCCTGTTATCTCACAAGGCTTTGGTGCAACAATCCGAGCCATCAACGGCGCTCTGGAGTGCGACGGAGCCAACTCAGCCACGGTTCAAGCTAGAGTTCGTTACTACACTGAATATTGTCGTCAGTTAGGTGTTGACCCCGGAAACAACCTCATTTGCTAA。

[0069] SEQ ID NO.2:

[0070] MLTHAISKPILIVTILLVLQAFYTTTKAQNCGCSPDLCCSQFGFCGSTSDYCGVGCQQGPCFAPPPANGVSVDEIVTQEFFNGIIDQAESSCAGNGFYSRGAFLEALESYSRFARIGSVDDSRREIAAFFAHVTHET GHFCYIEEINGPSRDYCDENATQYPCNPNKGYYGRGPIQLSWNFNYGPAGTAIGFDGLNAPETVATDPVISFKTALWYWTNRVQPVISQGFGATIRAINGALECDGANSATVQARVRYYTEYCRQLGVDPGNNLIC.

[0071] (2) Vector construction

[0072] Total RNA was extracted from rapeseed plant roots and reverse transcribed into cDNA. The reverse transcribed full-length cDNA was used as a template and amplified with forward and antisense primers containing restriction sites in Table 1 (SEQ ID NOs. 3-4). A PCR product of the target fragment was obtained, which was 822 bp in size. The target fragment was purified and recovered, and the pBIB-BASTA-35S-GWR-GFP vector was digested with restriction endonucleases Kpn I and BsrG I, purified and recovered, and constructed into a vector by recombination and ligation.

[0073] Table 1 Primers used to construct EP3 plant expression vector

[0074]

[0075] (3) Transformation into Escherichia coli DH5α (using heat shock method)

[0076] ① Take 10 μL of the ligation reaction product and add it to 30 μL of competent E. coli DH5α, mix well and place on ice for 30 minutes; ② Heat shock in a 42℃ water bath for 60 seconds, quickly transfer to ice and place on ice for 5 minutes; ③ Add 700 μL of LB liquid medium without antibiotics and shake at 37℃ for 1 hour (200 rpm); ④ Take an appropriate amount of transformed E. coli competent cells and spread them on a plate containing Kan + The LB solid culture medium plate was placed in a 37°C constant temperature incubator and inverted for 16 hours.

[0077] (4) Sequencing and identification

[0078] DH5α single colony was screened and identified as a positive clone by PCR. After the positive single colony was amplified and cultured, the plasmid was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were completely consistent with the nucleotide sequence shown in SEQ ID NO.1.

[0079] (5) Transformation of the recombinant plasmid into Agrobacterium GV3101 (using heat shock method)

[0080] ① Take 30 μL of GV3101 competent cells melted on an ice bath, add 5 μL of the recombinant plasmid constructed above, and place on ice for 10 minutes, in liquid nitrogen for 5 minutes, and in a 37°C water bath for 5 minutes, and then quickly place on ice for 5 minutes; ② Add 900 μL of LB liquid medium without antibiotics and culture at 28°C with shaking for 2-3 hours; ③ Centrifuge at 6000 rpm for 1 minute, remove the excess supernatant, keep 100 μL of the supernatant, mix well and apply it on a plate containing antibiotic Kan + Plate the cells on LB solid medium plates and incubate them upside down at 28°C for 3 days. Single colonies were selected and positive clones were identified by PCR screening using the primers listed in Table 1. Correctly transformed GV3101 bacterial suspensions were stored in a -80°C freezer with 25% glycerol.

[0081] 2. Preparation of dormant spore suspension of Brassica rapa and contaminated soil

[0082] The root tissue infected with the physiological subspecies of root knotweed No. 4 stored at -20°C was first soaked in 70% ethanol for 5 minutes and then rinsed with sterile distilled water for 5 minutes to remove surface contaminants. The disinfected root was cut into small pieces, added with an appropriate amount of distilled water, and homogenized three times with a juicer to fully release dormant spores. The homogenate was filtered through eight layers of sterile gauze, and the filtrate was collected and centrifuged at 500 rpm for 10 minutes to remove large particles of tissue residues. The supernatant was retained and centrifuged at 3100 rpm for 15 minutes to precipitate the root knotweed spores. The supernatant was discarded. The precipitate was resuspended in sterile distilled water to prepare a 1×10- ... 6 Spores / g of contaminated soil were used for subsequent experiments.

[0083] 3. Agrobacterium-mediated transient expression of EP3 in host cabbage

[0084] Take out the GV3101 bacterial suspension obtained in step 1 from the -80°C ultra-low temperature freezer, activate the strain on LB solid medium containing kanamycin (50 μg / mL), pick a single colony and inoculate it into 20 mL LB liquid medium (containing kanamycin), and culture it at 28°C and 200 rpm with shaking until the OD 600 ≈1.0 (about 18h). Centrifuge at 5000 rpm for 5 min, discard the supernatant, and gently resuspend the cells in pre-chilled MMA buffer (8 mmol / L 2-(N-morpholino)ethanesulfonic acid, 10 mmol / L MgCl2·6H2O, 200 μmol / L acetosyringone) to adjust the bacterial concentration to OD 600 =0.6, as the treatment liquid.

[0085] Soak 5g of cabbage seeds in 30mL of the treatment solution and incubate at 28°C, 200rpm, and shaking for 30 hours, until the seeds break open and turn white. Sow the treated cabbage seeds in the soil containing dormant spores of Plasmodium fumigatus (from step 2), planting 9 seeds per hole. At 10 and 20 days of age, apply 500μL of the treatment solution to the base of the stem of each seedling. Perform the same treatment using an MMA solution prepared with Agrobacterium tumefaciens GV3101 containing an empty vector, serving as a blank control.

[0086] IV. Effect of EP3 on the development of clubroot symptoms

[0087] To clarify the effect of EP3 overexpression on the formation of clubroot symptoms, cabbage roots were removed 30 days after inoculation with clubroot fungi, cleaned with water, and the clubroot formation of cabbage under different treatments was observed and counted.

[0088] like Figure 1 As shown in A and B, the results showed that the plants in the control group showed typical symptoms of clubroot, with a large number of significantly enlarged tumors forming on the roots, an incidence rate of up to 64.15%, and a disease index of 49.73; in contrast, the disease condition of the plants overexpressing EP3 was significantly alleviated, with the incidence rate reduced to 39.57%, and the volume of the root tumors formed was significantly smaller than that of the control, with a disease index of 27.49.

[0089] This result proves that overexpression of EP3 can effectively inhibit the occurrence and development of clubroot disease and significantly improve the disease resistance of the host plant.

[0090] Example 2 Effects of transient expression of EP3 in host rapeseed on infection and symptom formation of root knot fungi

[0091] This example investigates the relationship between EP3 expression level and rapeseed's resistance to clubroot.

[0092] (1) Preparation of treatment solution

[0093] Agrobacterium containing the EP3 overexpression plant vector and the silent expression vector (TRV1 / TRV2) were resuspended in MMA (8 mmol / L 2-(N-morpholino)ethanesulfonic acid, 10 mmol / L MgCl2·6H2O, 180 μmol / L acetosyringone) using the method of Example 1, and the OD was adjusted. 600 to 0.6 to prepare the treatment solution.

[0094] (2) Seed treatment

[0095] According to the method of Example 1, the seeds were soaked in the treatment solution and shaken at 200 rpm for 30 h until the seed coat ruptured and germinated. The root irrigation method in Example 1 was used, that is, 500 μL of the treatment solution was dripped at the base of the stem of each seedling at 10 and 20 days of age. An empty vector Agrobacterium treatment was set as a negative control.

[0096] (3) Inoculation and results

[0097] The treated sprouted rapeseed seeds were planted in the soil, and the inoculation concentration was 1×10 6 300 μL of dormant spores of root knot fungus was inoculated into each seedling. On the 30th day after inoculation with root knot fungus, the rape roots were taken and cleaned with water. The root knot formation of rapeseeds under different treatments was observed and counted. Figure 2 As shown in A, the statistical results of the disease index are as follows Figure 2 As shown in B, the results showed that the root nodules of EP3-overexpressing plants (EP3-OX) became smaller and the disease index was lower than that of the control; while the root nodules of EP3-silenced plants (EP3-VIGS) became larger and the disease index increased.

[0098] The above results all indicate that up-regulating EP3 expression can significantly enhance host resistance, while down-regulating expression leads to increased susceptibility.

[0099] Example 3 Effect of transient expression of EP3 on infection of host rapeseed with dormant spores of different concentrations of root knotweed

[0100] This example investigates the effect of the EP3 gene on disease resistance in rapeseed after the host is infected with dormant spores of different concentrations of plasmodium.

[0101] The experiment used the same treatment solution preparation method as Example 1. The rapeseed seeds were soaked in the EP3 treatment solution and shaken at 28°C and 200 rpm for 20-30 hours. After the seeds broke through the skin and germinated, they were transplanted into the soil for cultivation. When the seedlings grew to 7 days old, they were inoculated with three different concentrations of root knot fungus dormant spore suspensions (1×10 6 , 1×10 7 and 1×10 8 spores / mL), and 300 μL was inoculated for each strain.

[0102] When the seedlings were 10 and 20 days old, they were irrigated with EP3 solution twice. Figure 3 ), fluorescence quantitative PCR was used to detect the expression level of Pbactin gene in root knot fungus. Transient overexpression of EP3 could significantly reduce the colonization of root knot fungus in each treatment group. 6spores / mL inoculation concentration, EP3 transient overexpression showed the strongest inhibitory effect (P<0.0001); and as the inoculation concentration increased to 1×10 8 spores / mL, the inhibitory effect was weakened, but there was still a very significant difference compared with the control group (P<0.001).

[0103] The statistical results of the disease index further confirmed that ( Figure 4 ), EP3 overexpression can effectively alleviate clubroot symptoms, especially at 1×10 6 The inhibitory effect on root swelling formation was most significant in the spore / mL treatment group (P<0.0001). These results indicate that the disease resistance mediated by EP3 is concentration-dependent.

[0104] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of a rapeseed chitinase EP3 in any of the following: (1) Improve the resistance of cruciferous plants to clubroot disease; (2) Cultivate cruciferous plant varieties with improved clubroot resistance; (3) preparing products for regulating clubroot resistance in cruciferous plants; The amino acid sequence of the rapeseed chitinase EP3 is shown in SEQ ID NO.

2.

2. Use of the gene encoding rapeseed chitinase EP3 as claimed in claim 1 in any of the following: (1) Improve the resistance of cruciferous plants to clubroot disease; (2) Cultivate cruciferous plant varieties with improved clubroot resistance; (3) preparing products for regulating clubroot resistance in cruciferous plants; The nucleotide sequence of the coding gene is shown in SEQ ID NO.

1.

3. The use according to claim 2, characterized in that Up-regulating the expression of the rape chitinase EP3 or its encoding gene in cruciferous plants to improve the clubroot resistance of the cruciferous plants; The cruciferous plant is rapeseed or cabbage.

4. An application of an overexpression vector, characterized in that: The overexpression vector overexpresses the gene encoding rapeseed chitinase EP3; The nucleotide sequence of the coding gene is shown in SEQ ID NO.1; The application is any of the following: (1) Improve the resistance of cruciferous plants to clubroot disease; (2) Cultivate cruciferous plant varieties with improved clubroot resistance; (3) Prepare products for regulating clubroot resistance in cruciferous plants.

5. Use of an engineered bacterium comprising the overexpression vector according to claim 4 in any of the following: (1) Improve the resistance of cruciferous plants to clubroot disease; (2) Cultivate cruciferous plant varieties with improved clubroot resistance; (3) Prepare products for regulating clubroot resistance in cruciferous plants.

6. A method for improving the resistance of cruciferous plants to clubroot disease, characterized in that: The method comprises the steps of increasing the expression level of a gene encoding rapeseed chitinase EP3 in a cruciferous plant to improve the clubroot resistance of the cruciferous plant; The nucleotide sequence of the coding gene is shown in SEQ ID NO.

1.

7. The method according to claim 6, wherein The method of increasing the expression level of the gene encoding the rapeseed chitinase EP3 comprises the following steps: constructing an overexpression vector of the gene encoding the rapeseed chitinase EP3, transforming the overexpression vector into Agrobacterium, and then infecting a cruciferous plant with a treatment solution containing the Agrobacterium; The cruciferous plant is rapeseed or cabbage; The infection method includes seed soaking and root irrigation.

8. A method for cultivating a cruciferous plant with improved clubroot resistance, characterized in that: The method comprises the steps of overexpressing a gene encoding a rapeseed chitinase EP3 in a cruciferous plant; The nucleotide sequence of the coding gene is shown in SEQ ID NO.

1.

9. The method according to claim 8, wherein The cruciferous plant is rapeseed or cabbage.

10. A method for preventing and treating clubroot, characterized in that: The following steps are involved: constructing an overexpression vector of a gene encoding rapeseed chitinase EP3, transforming the overexpression vector into Agrobacterium, preparing a treatment solution containing the Agrobacterium, and then using the treatment solution containing the Agrobacterium to infect cruciferous plants; Wherein, the nucleotide sequence of the coding gene is shown as SEQ ID NO.1; The cruciferous plant is rapeseed or cabbage; The infection method includes seed soaking and root irrigation.

Images