Application of GhBBX21 gene in promoting anthocyanin accumulation in R1 cotton plant

Abstract

The invention discloses application of a transcription factor GhBBX21 in promoting anthocyanin accumulation in R1 cotton, and belongs to the technical field of biology. A gene CDS sequence is cloned, an overexpression vector 35S: GhBBX21-GFP is constructed, wild type arabidopsis (WT) is transformed by a pseudomonas inflorescence infection method, and an overexpression plant is obtained. Yeast single hybrid experiments prove that GhBBX21 can be combined on a promoter of an important transcriptional gene GhPAP1D for anthocyanin synthesis of R1 cotton. A dual luciferase experiment proves that the GhBBX21 can be used for remarkably promoting the expression of GhPAP1D in the R1 cotton. The results provide effective support for mining important genes related to cotton anthocyanin synthesis and analyzing a cotton anthocyanin synthesis route, and provide important support for improving cotton resistance and increasing cotton ornamental value by utilizing the genes, creating excellent cotton planting resources and cultivating insect-resistant cotton and ornamental cotton varieties.

Description

Technical Field

[0001] The invention belongs to the field of cotton germplasm resource cultivation and biotechnology, and specifically relates to a GhBBX21 transcription factor and its application in regulating anthocyanin accumulation in leaves of red cotton plants (abbreviated as R1 cotton). Background Art

[0002] Anthocyanins are flavonoid pigments in the phenylalanine biosynthesis pathway and are important secondary metabolites in plants. In plants, anthocyanin accumulation in the vacuole imparts vibrant color to flowers, fruits, and vegetative organs, playing a crucial role in attracting pollinators and promoting fruit dispersal. Anthocyanins are also stress protectants against biotic and abiotic stresses, alleviating oxidative damage in plant cells. Cotton is an important economic crop, and anthocyanin accumulation protects cotton plants from pests and diseases and improves their tolerance to abiotic stresses such as ultraviolet light, drought, and salinity. Furthermore, the accumulation of anthocyanins in cotton leaves and flowers is an important agronomic trait used in modern genetic research. Therefore, studying the mechanisms by which anthocyanin accumulation in cotton plants responds to both internal and external factors is of great practical significance.

[0003] Cotton is one of the most widely grown and economically important cash crops in the world. The red plant (R1) gene is a traditional genetic marker for cotton. The red color of R1 cotton is produced by the accumulation of anthocyanins, which are distributed throughout the stems and leaves, giving the entire plant a red color. The R1 gene has been shown to express a key MYB transcription factor involved in the regulation of anthocyanin biosynthesis, namely GhPAP1D. In R1 cotton, the GhPAP1D gene is rapidly upregulated under light. Further studies have shown that in R1 cotton, there is a 228bp tandem repeat sequence upstream of GhPAP1D. However, the mechanism by which the tandem repeat in the GhPAP1D promoter mediates light-induced transcriptional upregulation is still unclear.

[0004] Light is the most important environmental factor in anthocyanin biosynthesis. The BBX family of proteins is a class of zinc finger proteins. In Arabidopsis, apple, and pear, BBX subgroup IV proteins can bind to the constitutive photomorphogenic binding factor HY5, jointly involved in hypocotyl elongation and anthocyanin biosynthesis. Because different plant species have their own evolutionary histories, their gene structures, functions, and regulatory mechanisms are unique. Whether genes in BBX family subgroup IV in cotton share similar functions has not been reported.

[0005] Problems with the existing technology: No prior art reports have reported the functional application of genes from subgroup IV of the BBX family in cotton leaves for anthocyanin synthesis. The present invention cloned the BBX family subgroup IV gene, GhBBX21. The function of GhBBX21 was further investigated through vector construction, subcellular localization experiments, dual-luciferase assays, yeast one-hybrid assays, and stable transformation of Arabidopsis thaliana. The goal is to identify functional genes and explore the regulatory pathways for anthocyanin accumulation in cotton leaves, providing theoretical and technical support for the cultivation of ornamental, insect-resistant, and disease-resistant cotton. Summary of the Invention

[0006] The key technical problem to be solved by the present invention is to provide the GhBBX21 gene and its application in regulating R1 cotton blue pigment synthesis. To solve the above technical problems, the present invention adopts the following technical solutions:

[0007] The present invention provides a GhBBX21 gene isolated from R1 cotton. The CDS sequence of the GhBBX21 gene is shown in SEQ.No.1:

[0008] ATGAAGATCCAGTGCGATGTCTGTAACAAAGAGGAGGCCTCGGTGTTCTGCACCGCCGACGAAGCGGCCCTGTGCGACGCCTGCGACCACCGAGTTCACCACGCCAACAAGCTTGCCTCTAAGCACCAACGCTTTTCCCTTCTCCATCCTTCCTCTTCTAGGCAAGTCCCTCTTTGCGATATCTGTCAGGAGAAACGAGCTTTCTTGTTCTGTCAGCAAGACAGAGCAATTCTGTGCAGAGATTGTGATGTTCCAATTCATGCGGCAAACGAACATACCAAGAAACATAACAGGTTTCTTCTTACAGGGGTTAAACTCTCTCCTACCACCGCTATCTACACATCCTCTTCTTCATCCTCAGTCGCTTCTTTATCCAACGTTGGCCATTCTGTTCCTGAATTCAAGTCTCAACAATCGGTCAAGAACTCTGTCTCTGCTTCTACTTCAAATTTAAATCGAACTTCGCTTGCTAAATCTTCATCAATCAGTACAACATCTGCTGCAGTAACAAATAACAAGAGCGGTGGAGATGACTTGTTAGCAAGTGTAGAGGGTGGTTCAACGAGTAGCATATCGGAATACTTGATAGAGATGCTCCCAGGGTGGCACGTCGAAGATTTTCTTGATTCCTCTTCACCTTCCTTTGGTTTCTGTAAGAGTGATGATTGTATGTTGCCGTTCCTTGATGCTGATCTTGAGAGCAATATGACTACTTCCTCACCAGAAAGTTTGGGGCTTTTGGTTCCCCAATCACCATATTCCTTGTATCCTCCCCAATATTCTTCACAAATGGGAGGGCAAATCGGGTTGAAGGAGACAAACGAAATTATAGGCATGAAAGCTAACAGGAGACGGGTAGATGATTCCTTTACAGTTCCTTGGAGCAGCCCTCAATCCACTAGCTCCAAGAGATCTAAGCGTCTCTGGTAG

[0009] (1) the nucleotide sequence shown in SEQ. No. 1; (2) a polynucleotide sequence that can hybridize with the complementary sequence of SEQ. No. 1 under stringent hybridization conditions; (3) a polynucleotide sequence that has at least 80% homology with the nucleotide sequence of SEQ. No. 1; preferably, a polynucleotide sequence that has at least 85% homology with the polynucleotide sequence of SEQ. No. 1; more preferably, a polynucleotide sequence that has at least 90% homology with the polynucleotide sequence of SEQ. No. 1;

[0010] The present invention provides a method for cloning the GhBBX21 gene and constructing a vector, comprising:

[0011] (1) Selection of plant materials and reagents; (2) RNA extraction and reverse transcription; (3) Primer design and gene cloning; (4) Construction of overexpression vectors, dual-luciferase vectors, and yeast single-hybrid vectors.

[0012] The present invention provides a method for verifying the function of the GhBBX21 gene, comprising:

[0013] (1) Subcellular localization analysis of GhBBX21; (2) Stable transformation of Arabidopsis thaliana with GhBBX21 overexpression vector; (3) Dual-luciferase assay analysis of GhBBX21 activating GhPAP1D; (4) Yeast one-hybrid assay analysis of GhBBX21 binding to the GhPAP1D promoter.

[0014] The application of the GhBBX21 gene is to promote the accumulation of anthocyanins in R1 cotton and Arabidopsis plants.

[0015] The application of the GhBBX21 gene promotes the accumulation of anthocyanins in R1 cotton plants by positively regulating the GhPAP1D gene.

[0016] Beneficial Effects: The present invention successfully cloned the GhBBX21 gene through gene cloning and constructed an overexpression vector, a dual-luciferase assay vector, and a yeast single-hybrid vector. Subcellular localization experiments revealed that GhBBX21 is nuclear localized. Yeast single-hybrid assays demonstrated that GhBBX21 binds to the GhPAP1D promoter. Dual-luciferase assays demonstrated that GhBBX21 activates the expression of the downstream gene GhPAP1D, thereby promoting anthocyanin synthesis.

[0017] Further stable transformation experiments in Arabidopsis thaliana showed that the GhBBX21 gene can promote the accumulation of anthocyanins in Arabidopsis thaliana during the seedling stage. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1The figure shows the gel electrophoresis of GhBBX21 subcellular localization and dual-luciferase PCR fragments, where M: Marker III; 1: GhBBX21 subcellular localization PCR fragment; 2: dual-luciferase PCR fragment;

[0019] Figure 2 This is the gel electrophoresis diagram of the PCR of the bacterial solution of Escherichia coli transformed with the GhBBX21 gene subcellular localization vector, where M: Marker III; 1: negative control; 2: GhBBX21;

[0020] Figure 3 This is the PCR gel electrophoresis diagram of the bacterial solution of Escherichia coli transformed with the GhBBX21 dual-luciferase vector, where M: Marker III, 1: negative control, 2: GhBBX21 gene;

[0021] Figure 4 This is the gel electrophoresis of the 632 bp promoter of the GhPAP1D gene in R1 cotton, which was amplified by PCR. Where: M: Marker2000; 1: negative control; 2: promoter of the GhPAP1D gene in R1 cotton;

[0022] Note: The 632 bp promoter sequence before the ATG of the GhPAP1D gene is: CATGCTATCAAAATGACT;

[0023] Figure 5 This is the PCR gel electrophoresis diagram of the bacterial solution after the 632 bp promoter before the ATG of the GhPAP1D gene of R1 cotton was constructed into the dual-luciferase vector pGreen0800-LUC and transformed into Escherichia coli. Among them, M: Marker2000; 1: negative control; 2: GhPAP1D gene promoter;

[0024] Figure 6 is the structure diagram of the dual luciferase vector, in which: Figure 6 a: Schematic diagram of the construction of the effector vector pGreenII 62-SK;

[0025] Figure 6 b: Schematic diagram of the construction of the reporter vector pGreen0800-LUC;

[0026] Figure 7 This is a schematic diagram of the construction of the yeast single-hybrid pAbAi vector. The promoter of the R1 cotton GhPAP1D gene was connected to the pAbAi vector by homologous recombination, with the restriction sites SacI and XhoI.

[0027] Figure 8 Schematic diagram of the construction of yeast single hybrid pGADT7 vector. The GhBBX21 gene from R1 cotton was linked to the pGADT7 vector by homologous recombination, with EcoRI and BamHI restriction sites.

[0028] Figure 9 This is the agarose gel electrophoresis of the linearized product of the yeast single hybrid bait vector, where: M: Marker10000, I: plasmid pAbAi-proGhPAP1D R1 ,2: plasmid pAbAi-proGhPAP1D R1 Enzyme digestion products;

[0029] Figure 10 is the subcellular localization map of GhBBX21;

[0030] Figure 11 The results of yeast one-hybrid experiment: 1.pGADT7+pAbAi-proGhPAP1D R1 ;2.pGADT7-GhBBX21+pAbAi-proGhPAP1D R1 ; 3.+.pGADT7-rec-53+pAbAi-P53; 4.-.pGADT7+pAbAi-P53, AbA concentration is 200 ng / mL);

[0031] Figure 12 GhBBX21 to proGhPAP1D R1 In the activated dual-luciferase assay, the 62SK empty vector was used as a control;

[0032] Figure 13 The phenotype (13a) and anthocyanin content (13b) of the T3 generation transgenic Arabidopsis plants stably transformed with 35S:GhBBX21-GFP are shown. DETAILED DESCRIPTION

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0034] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0035] In order to make the purpose, scheme and advantages of the patent of the present invention clearer, the present invention is further described in detail below with reference to the accompanying drawings and specific implementation cases. In order to avoid obscuring the technical scheme of the patent of the present invention due to unnecessary details, only the technical schemes and processing steps closely related to the scheme of the patent of the present invention are shown in the embodiments, and other details that are not closely related are omitted.

[0036] 1. Material Preparation

[0037] 1.1 Experimental Materials

[0038] R1 cotton, Gossypium hirsutum L. cvT586, used for DNA and RNA extraction, was planted in the experimental field of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. Seeds of wild-type Arabidopsis thalianacol-0 and transgenic lines were sterilized with ethanol and sodium hypochlorite, sown on MS medium, and placed at 4°C for 48 hours. They were then transferred to 21°C and cultured under a 16 / 8-hour light / dark cycle. After two weeks, they were moved to nutrient pots for culture for subcellular localization and dual-luciferase experiments. Tobacco (Nicotiana benthamiana) seedlings were grown in a growth chamber at 28°C with a 12-hour light / 12-hour dark cycle.

[0039] 1.2 Vectors and strains

[0040] The subcellular localization and stable transformation vector pBI121-GFP used was a long-term storage vector of the research group. The dual luciferase vectors pGreen0800-LUC and pGreenII 62-SK were purchased from Shanghai Kelei Biotechnology Co., Ltd., and the yeast single hybrid vectors pAbAi and pGADT7 were purchased from Takara. The competent Escherichia coli (E. coli) DH5α, competent Agrobacterium tumefaciens (A. tumefaciens) GV3101 and GV3101 (pSoup-p19) and yeast strain Y1HGold used were all purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0041] 2 Experimental methods

[0042] 2.1 Extraction of R1 cotton DNA

[0043] The CTAB method modified by Song Guoli et al. was used to extract R1 cotton genomic DNA. The Tris stock solution formula is shown in the table below:

[0044] Reagents Dosage per liter Tris base 121.10g Concentrated HCl 42mL <![CDATA[ddH2O]]> 800mL

[0045] The preparation of EDTA stock solution is shown in the table below:

[0046] Reagents Dosage per liter <![CDATA[Na2EDTA]]> 186.10g NaOH 20g <![CDATA[ddH2O]]> 800mL

[0047] The lysis buffer formula is shown in the table below:

[0048]

[0049]

[0050] The specific steps are as follows

[0051] (1) Young cotton leaf samples collected from the field were placed in a 2 mL centrifuge tube, pre-cooled in liquid nitrogen, and then ground into powder using a sample grinder.

[0052] (2) After grinding, add 800 μL of lysis buffer preheated at 65°C to each sample and shake vigorously.

[0053] (3) After adding the lysis solution and shaking the sample, place it in a 65°C water bath for 30 minutes. Take out the centrifuge tube and shake it every 10 minutes to ensure full contact between the extract and the material.

[0054] (4) After water bath, add 800 μL of 24:1 (chloroform:isoamyl alcohol, V / V) extractant, invert the centrifuge tube 70 times to fully mix the mixture in the tube, and centrifuge at 12000 rpm for 10 min.

[0055] (5) Slowly aspirate the supernatant, transfer it to a new 2 mL centrifuge tube, add 24:1 (chloroform:isoamyl alcohol, V / V), and repeat step (4).

[0056] (6) Transfer the supernatant to a new 2 mL centrifuge tube, add 0.6 times the volume of -20°C pre-cooled isopropanol, and slowly invert the tube until a flocculent precipitate is precipitated.

[0057] (7) Transfer the flocculent precipitate into a new 1.5 mL centrifuge tube, wash it three times with 70% alcohol to whiten the DNA precipitate, then wash it once with anhydrous alcohol, pour off the alcohol, and air-dry it at 37°C.

[0058] (8) Add 300 μL of sterilized ddH2O and shake, then let it stand at room temperature to dissolve. This is the DNA storage solution, which should be stored in a -20°C refrigerator until use.

[0059] (9) DNA storage solution was tested for concentration and purity using Nanodrop 2000 ultra-micro spectrophotometer. 260 / 280 The samples with the value between 1.8 and 2.0 were used for the next experiment.

[0060] 2.2 RNA extraction

[0061] Extract RNA from young leaf tissue using the Polysaccharides and Polyphenolics-rich Plant Total RNA Extraction Kit (TIANGEN). The specific steps are as follows:

[0062] (1) Homogenization: 50-100 mg of plant material was quickly ground into powder in liquid nitrogen, and 500 μL of lysis buffer SL (β-mercaptoethanol was added before use, i.e., 25 μL of β-mercaptoethanol was added to 475 μL of lysis buffer) was added, and the mixture was immediately vortexed and vigorously shaken to mix.

[0063] (2) Centrifuge at 12,000 rpm (~13,400 × g) for 2 min.

[0064] (3) Transfer the supernatant to the CS filter column and centrifuge at 12,000 rpm (~13,400 × g) for 2 min. Carefully pipette the supernatant from the collection tube into a new RNase-free centrifuge tube, avoiding contact of the pipette tip with the cell debris precipitate in the collection tube.

[0065] (4) Slowly add 0.4 times the volume of the supernatant to anhydrous ethanol and mix well (precipitate may appear at this time). Transfer the resulting solution and precipitate to the adsorption column CR3 and centrifuge at 12000 rpm (~13,400 × g) for 15 seconds. Pour away the waste liquid in the collection tube and place the adsorption column CR3 back into the collection tube.

[0066] (5) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm (~13,400 × g) for 15 s, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube.

[0067] (6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and place it in a new RNase-Free centrifuge tube, add 70 μL of RDD buffer, and mix gently.

[0068] (7) Add 80 μL of DNase I working solution to the center of adsorption column CR3 and let it stand at room temperature for 15 min.

[0069] (8) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm (~13,400 × g) for 15 s, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube.

[0070] (9) Add 500 μL of rinse solution RW to the adsorption column CR3 (please check whether ethanol has been added before use), centrifuge at 12,000 rpm (~13,400 × g) for 15 s, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube.

[0071] (10) Repeat step 9.

[0072] (11) Centrifuge at 12,000 rpm (~13,400 × g) for 2 min. Place the adsorption column CR3 in a new RNase-free centrifuge tube. Add 30–50 μL of RNase-free ddH2O to the middle of the adsorption membrane. Allow to stand at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400 × g) for 1 min to obtain the RNA solution. Store at -80°C until use.

[0073] (12) Gel electrophoresis was used to check the purity and integrity of RNA. Nanodrop 2000 ultra-micro spectrophotometer was used to detect the concentration and purity. 260 / 280 The samples with the values ​​between 1.8 and 2.0 were used for the next experiment.

[0074] 2.3 Reverse transcription of cDNA

[0075] The reverse transcription kit used was the Takara Prime Script 1st Strand cDNA Synthesis Kit. The reaction system and steps were as follows:

[0076] Prepare the reaction mixture according to the following table:

[0077] Reagents Dosage OligodT 1.0 μL Random6mers 1.0 μL dNTP 1.0 μL Total RNA 3.0 μg <![CDATA[RNasefreedH2O]]> up to 10 μL

[0078] (2) After keeping at 65℃ for 5 minutes, cool rapidly on ice.

[0079] (3) Prepare 20 μL of reaction solution according to the table below.

[0080] Reagents Dosage The above denatured reaction solution 10 μL 5×PrimeScriptBuffer 4μL RNase Inhibitor (40U / μL) 0.5μL (20U) PrimeScript RTase (200 U / μL) 1μL (200U) <![CDATA[RNasefreeddH2O]]> up to 20 μL

[0081] (4) Mix slowly and perform reverse transcription under the following conditions: 42°C for 60 min; 70°C for 15 min. Cool on ice and store at -20°C until ready for use.

[0082] 2.4 Amplification of PCR products

[0083] The specific primer sequences used in vector construction are shown in the following table:

[0084]

[0085] The GhBBX21 gene PCR amplification product was obtained by amplifying the cDNA of R1 cotton using GhBBX21 gene-specific primers. The promoter fragment of the gene was PCR amplified by amplifying the DNA of R1 cotton using GhPAP1D promoter-specific primers. The DNA polymerase used was high-fidelity Prime STAR G×L DNA Polymerase, purchased from Takara Biotechnology Co., Ltd. The PCR system is shown in the following table:

[0086] Reagents Dosage PrimeSTARGXLDNAPolymerase(5U / μL) 0.3μL 5× PrimeSTARGXL Buffer 3.0μL dNTP (2.5 mM) 1.2 μL PCRForwardPrimer (10 μM) 0.4μL PCR Reverse Primer (10 μM) 0.4μL Template DNA 1.0 μL <![CDATA[ddH2O]]> 8.7μL

[0087] PCR reactions were performed on a TaKaRa PCR thermal cycler using the following protocol: first, denaturation at 98°C for 5 minutes; second, denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, and extension at 68°C for 1 minute per 1 kb (30 cycles); and third, extension at 68°C for 5 minutes. PCR products were confirmed by gel electrophoresis and purified for use in subsequent experiments.

[0088] 2.5 Construction of recombinant vector

[0089] Vectors and restriction enzyme cutting sites used:

[0090] Construction of the overexpression vector 35S:GhBBX21: The CDS sequence of GhBBX21 containing the terminator was amplified and inserted into the pBI121 vector via homologous recombination, with the restriction enzyme sites being XbaI and BamHI. Construction of the subcellular localization vector 35S:GhBBX21-GFP: The CDS sequence of GhBBX21 without the terminator was amplified and inserted into the pBI121-GFP vector via homologous recombination, with the restriction enzyme sites being XbaI and BamHI. Construction of the dual-luciferase vectors 35S:GhBBX21 and 35S:REN / proGhPAP1DR1:LUC: The full-length CDS sequence of GhBBX21 was inserted into the effector vector pGreenII via homologous recombination. 62-SK, with HindIII and BamHI restriction sites, to construct the 35S:GhBBX21 recombinant vector plasmid. proGhPAP1DR1 was amplified and cloned into the pGreen0800-LUC vector, with HindIII and BamHI restriction sites, to construct the 35S:REN / proGhPAP1D R1 :LUC vector; yeast single hybrid vector pAbAi-proGhPAP1D R1 and construction of pGADT7-GhBBX21: proGhPAP1D R1 The full-length CDS sequence of GhBBX21 was constructed into pGADT7 by homologous recombination with restriction enzyme sites of EcoRI and BamHI, and ligated into pAbAi vector by homologous recombination with restriction enzyme sites of SacI and XhoI.

[0091] Connection between vector, gene and promoter:

[0092] For recombinant vector construction -Uni Seamless Cloning and Assembly Kit. Mix the digested vector and purified PCR product according to the reaction system in the table below and react at 50°C for 15 minutes.

[0093] Reagents Dosage 2×AssemblyMix 5μL Linearizedvector 0.2 pmol insearts 0.4 pmol <![CDATA[ddH2O]]> Add to 10 μL

[0094] 2.6 Transformation into competent E. coli DH5α

[0095] The recombinant plasmid was transformed into E. coli competent cells. The steps are as follows:

[0096] (1) Thaw competent E. coli DH5α stored at -80℃ on ice.

[0097] (2) Add the homologous recombination ligation product to the competent medium (the ligation product should not exceed 10% of the total volume), mix gently and incubate on ice for 30 minutes.

[0098] (3) Heat shock at 42°C for 90 seconds, then quickly place on ice for 2–3 minutes.

[0099] (4) Add 800 μL of antibiotic-free LB liquid medium and culture at 37°C and 180 rpm for 1 h.

[0100] (5) Centrifuge at 12000 rpm for 30 seconds to enrich the bacterial solution, leaving 100-200 μL of liquid in the tube. Use a sterile pipette tip to slowly blow and suspend the precipitate. Use sterilized glass beads to evenly spread the bacterial solution on the corresponding resistance solid LB culture medium and seal it. The preparation method of LB culture medium is shown in the table below.

[0101] Reagents Dosage Tryptone 10g Yeast Extract 5g NaCl 10g <![CDATA[ddH2O]]> Add to 1L

[0102] (6) Incubate at 37°C for 12-16 hours, pick a single white colony and amplify it, perform PCR on the bacterial solution, and perform gel electrophoresis. The correct bands will be sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.

[0103] (7) The sequencing results were compared and analyzed using ClustalX 1.81win software. The successfully aligned bacterial suspension was amplified and shaken. A portion was used to extract the recombinant plasmid, and a portion was added with 50% glycerol at a volume ratio of 1:1 for bacterial preservation and placed in a -80°C refrigerator.

[0104] 2.7 Extraction of recombinant plasmid in small quantities

[0105] The TIANprep Mini Plasmid Kit from TIANGEN was used for small-scale plasmid extraction. The specific steps are as follows:

[0106] (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CP3 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0107] (2) Take 1-5 mL of overnight cultured bacterial solution, add it to a centrifuge tube, centrifuge at 12000 rpm for 1 min, and remove the supernatant (if the bacterial solution is large, the bacterial precipitate can be collected into one centrifuge tube through multiple centrifugation).

[0108] (3) Add 250 μL of solution P1 (to which RNase A has been added) to the centrifuge tube containing the bacterial pellet and use a pipette or vortex oscillator to thoroughly suspend the bacterial pellet.

[0109] (4) Add 250 μL of solution P2 to the centrifuge tube and gently invert the tube 6-8 times to fully lyse the cells. The cell suspension should become clear and viscous at this point. The lysis time should not exceed 5 minutes to avoid plasmid damage. If it does not become clear, it may be due to an excessive number of cells and incomplete lysis. Reduce the amount of cells.

[0110] (5) Add 350 μL of solution P3 to the centrifuge tube and gently invert the tube 6-8 times to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 minutes. Note: Mix immediately after adding P3 to avoid local precipitation. If there is still a small amount of white precipitate in the supernatant, centrifuge again and remove the supernatant.

[0111] (6) Use a pipette to transfer the supernatant collected in the previous step to the adsorption column CP3 (place the adsorption column in the collection tube), being careful not to aspirate the precipitate. Centrifuge at 12,000 rpm for 30–60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube.

[0112] (7) Optional step: Add 500 μL of deproteinized solution PD to the adsorption column CP3, centrifuge at 12,000 rpm for 30–60 s, discard the waste liquid in the collection tube, and return the adsorption column CP3 to the collection tube. This step is recommended for the host strain BL21. If the host strain is DH5α, this step can be omitted.

[0113] (8) Add 600 μL of rinse solution PW to the adsorption column CP3 (please check whether anhydrous ethanol has been added first), centrifuge at 12000 rpm for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube.

[0114] (9) Repeat step 8.

[0115] (10) Place the adsorption column CP3 in a collection tube and centrifuge at 12,000 rpm for 2 min to remove any remaining rinse solution. Uncap the adsorption column CP3 and place it at room temperature for several minutes to completely dry any remaining rinse solution from the adsorption material.

[0116] (11) Place the adsorption column CP3 in a clean centrifuge tube and drop 50–100 μL of elution buffer EB onto the middle of the adsorption membrane. Allow to stand at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, and collect the plasmid solution in a centrifuge tube. To increase the plasmid recovery rate, the resulting solution can be added back to the adsorption column, allowed to stand at room temperature for 2 min, centrifuged at 12,000 rpm for 2 min, and collect the plasmid solution in a centrifuge tube.

[0117] (12) Check the purity of the product by gel electrophoresis, and use Nanodrop 2000 ultra-micro spectrophotometer to detect the concentration and purity. After packaging, store at -20℃ for future use.

[0118] 2.8 Bacillus pyogenes

[0119] The overexpression vector and subcellular localization vector were used to transform Bacillus pyogenes GV3101, and the dual-luciferase vector was used to transform Bacillus pyogenes GV3101 (pSoup-19). The specific steps are as follows:

[0120] (1) Take the competent Agrobacterium stored at -80℃ and place it in the room temperature or in the palm of your hand for a while until it partially melts. When it is in an ice-water mixture, insert it into ice.

[0121] (2) Add 0.01-1 μg of plasmid DNA per 100 μL competent medium, gently stir the bottom of the tube to mix, and then place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0122] (3) Add 700 μL of antibiotic-free LB liquid medium and culture at 28°C with shaking for 2 to 3 hours.

[0123] (4) Centrifuge at 8000 rpm for 1 min to collect the bacteria. Take about 100 μL of the supernatant and gently pipette to resuspend the bacteria. Spread the plate on an LB plate containing three antibodies (Kan / Gen / Rif), and invert it in a 28°C incubator for 2 to 3 days.

[0124] (5) Pick a single clone and place it in LB liquid medium containing three antibodies (Kan / Gen / Rif), and shake it at 28°C and 200 rpm for 16-20 h.

[0125] (6) After PCR, the bacterial solution was verified by gel electrophoresis, and the correct bands were used for bacterial preservation and the next step of the experiment.

[0126] 2.9 Subcellular localization experiments

[0127] Agrobacterium GV3101 containing the 35S:GhBBX21-GFP recombinant vector was shaken at 28°C and 200 rpm until the OD 600 = 0.6-1.0, centrifuged at 6000 rpm for 10 minutes, and resuspended in resuspension buffer to an OD of 0.8. After 2 hours of rest, the cells were injected into tobacco leaves and incubated at 28°C under normal light for two days. Observed using a confocal microscope, the GFP fluorescence excitation wavelength was set at 488 nm and the emission wavelength was between 500 and 530 nm. The resuspension buffer consisted of 100 mL of MS, 10 mM MgCl2, 100 μM AS, and 10 mM MES, and the pH was adjusted to 5.8.

[0128] 2.10 Arabidopsis transformation experiment

[0129] (1) Arabidopsis genetic transformation method

[0130] 1) Inoculate Agrobacterium GV3101 containing the 35S:GhBBX21 recombinant plasmid into 3 mL of LB liquid medium containing three antibodies and culture overnight at 28°C and 200 rpm;

[0131] 2) Inoculate 0.1 mL of Agrobacterium tumefaciens into 100 mL of liquid culture medium containing triple antibodies (Kan / Gen / Rif) at a ratio of 1:1000 and culture overnight at 28°C until OD 600 =1.0.

[0132] 3) Transfer the Agrobacterium to a centrifuge tube, centrifuge at 8000 rpm / min for 10 min, discard the supernatant, and collect the bacteria.

[0133] 4) Add an equal volume of impregnation solution (100 mL of 1 / 2 MS, 5 g of sucrose, 20 μL of Silwet L-77, 10 μL of 1 MAS, pH 5.8) to resuspend the cells and incubate at room temperature in the dark for 2 h.

[0134] 5) Select healthy Arabidopsis plants and place them upside down in a container containing the Agrobacterium suspension, immersing the inflorescence completely in the suspension for 45 seconds.

[0135] 6) The infected Arabidopsis thaliana was cultured in the dark for 24 hours and then placed under a 12-hour light / 12-hour dark cycle for further culture.

[0136] (2) Acquisition and identification of transgenic Arabidopsis positive seedlings

[0137] 1) The harvested T0 generation transgenic Arabidopsis seeds were air-dried at room temperature for 15 days, spotted on a MS culture dish containing 50 μg / mL Kan, and cultured in the dark at 4°C for 2 days.

[0138] 2) Grow in a light incubator for 10 days. At this time, yellow seedlings and green seedlings can be identified. Green seedlings are positive seedlings.

[0139] 3) Move the green seedlings that are growing well into nutrient soil and continue to cultivate them.

[0140] 4) Rosette leaves of 4-week-old wild-type Arabidopsis thaliana and transgenic seedlings were cut and DNA was extracted for PCR detection. Positive seedlings with correct bands were continued to be cultured.

[0141] 5) Harvesting positive seedlings is the T1 generation. The harvested seeds continue to be screened and identified until the T3 generation for subsequent phenotypic observation and related experiments.

[0142] 2.11 Determination of anthocyanin content

[0143] Anthocyanin content was determined using a method reported in the literature with minor modifications (Zhu et al., 2009). The extraction solution consisted of 40% methanol, 10% acetic acid, and 50% ddH2O. 100 mg of fresh cotton leaves were frozen in liquid nitrogen and then rapidly ground into powder. Add 5 mL of the extract and incubate at 4°C in the dark for 2 h. The mixture was then centrifuged at 13,000 rpm for 10 min, and the supernatant was measured on a Nanodrop 2000. Absorbance values ​​(A530) and (A657) were measured, and anthocyanin content was calculated using the formula (A530 - 0.25 × A657) / fresh weight.

[0144] 2.12 Dual luciferase assay

[0145] (1) Transient transformation of tobacco:

[0146] Agrobacterium GV3101 (pSoup-p19) containing 35S:GhBBX21 and 35S:REN / proGhPAP1DR1:LUC was shaken at 28°C and 200 rpm to OD600 = 1.0, centrifuged at 6000 rpm for 10 min, and resuspended in a resuspension solution to adjust the OD value to 1.0. The volume ratio of 35S:GhBBX21 to 35S:REN / proGhPAP1DR1:LUC was 9:1 and mixed. The resuspension of the mixture of 35S:REN / proGhPAP1DR1:LUC and an empty vector was used as a control. The mixed resuspension was kept in the dark at 28°C for 2 h and then injected into tobacco. The injected tobacco was cultured at 28°C under normal light conditions for 3 days. The leaves were taken and stored at -80°C. The resuspension composition was as follows: 10 mM MgCl2, 100 μM AS and 10 mM MES, pH adjusted to 5.8;

[0147] (2) Dual luciferase activity assay

[0148] Dual-luciferase activity assay was performed using Promega ReporterAssay System kit. The specific steps are as follows:

[0149] 1) Reagent preparation:

[0150] 1×PLB Lysis Buffer: Dissolve 1 volume of 5× Passive Lysis Buffer in 4 volumes of sterile ddH2O (prepare for immediate use).

[0151] LARII reagent: Dissolve Luciferase Assay Substrate in 10 mL of Luciferase Assay Buffer II, aliquot, and store in a -80°C refrigerator.

[0152] Stop& Reagent (prepared and used immediately): Mix 1 volume of 50×Stop& The substrate was dissolved in 50 times the volume of Stop& Buffer.

[0153] 2) Extraction of tobacco total protein

[0154] Take 100 mg of plant material and quickly grind it into powder in liquid nitrogen. Add 300 μL of 1×PLB lysis buffer, immediately vortex to mix, and place it on ice for 20 minutes, vortexing once every 5 minutes; centrifuge at 8000 rpm at 4°C for 20 minutes; take 2 μL of the supernatant, add 198 μL of 1×PLB lysis buffer to dilute, and place it on ice.

[0155] 3) Luciferase activity assay

[0156] Before measuring enzyme activity with a microplate reader, the lysate, LARII reagent and Stop& The reagent was placed at room temperature for 30 minutes. The microplate reader was programmed to set a 2s delay measurement and a 10s reading. 20μL of diluted lysate and 50μL of LARII were added to the microplate. Mixed by pipetting 2-3 times, the LUC value was measured. 50μL of Stop& Mix the reagent and measure the Renilla luciferase (REN) level. Each experiment was performed with three biological replicates and six mechanical replicates. Calculate the LUC / REN ratio.

[0157] 2.13 Yeast one-hybrid assay.

[0158] (1) The preparation of YPDA medium used for yeast single hybrid is shown in the following table:

[0159] Reagents Dosage Peptone 20g Yeastextract 10g D-glucose 20g Ade (0.2%) 15mL <![CDATA[RNasefreedH2O]]> upto1L

[0160] The preparation of SD / Ura solid medium is shown in the following table:

[0161] Reagents Dosage SD / UreBroth 14g Agarpowder 20g <![CDATA[RNasefreeddH2O]]> up to 500mL

[0162] (2)pAbAi-proGhPAP1D R1 Convert Y1HGold.

[0163] 1) Single enzyme digestion of pAbAi-proGhPAP1D R1 The plasmid system is shown in the table below. After overnight digestion at 37°C, the plasmid was purified and the concentration was measured before use.

[0164] Reagents Dosage pAbAi-promoter plasmid 85μL 10XTangoBuffer 10 μL BstBIenzyme 5μL

[0165] 2) Denature the carrier DNA at 95-100°C for 5 minutes and cool on ice until ready for use.

[0166] 3) Remove Y1HGold competent cells from the -80°C freezer and add 2 μg of pre-chilled linearized pAbAi-proD5 plasmid, 10 μL of denatured carrier DNA, and 500 μL of PEG / LiAc in that order, and pipette to mix thoroughly.

[0167] 4) Place in a 30°C water bath for 30 min, mixing thoroughly every 10 min using a pipette.

[0168] 5) Add 20 μL of DMSO, mix well, and incubate in a 42°C water bath for 15 min. After 7.5 min, pipette to mix once.

[0169] 6) Centrifuge at 9000 rpm for 5 minutes, discard the supernatant, and add 1 mL of YPD plus. Mix by pipetting and incubate at 30°C on a shaker for 90 minutes.

[0170] 7) Centrifuge at 9000 rpm for 45 seconds to collect the cells, and resuspend them in 100 μL of 0.9% (w / w) NaCl solution.

[0171] 8) Apply 80 μL of the culture to an SD / Ura plate. Dilute and mix the remaining 20 μL with 80 μL of 0.9% (w / w) NaCl solution, and apply 80 μL to an SD / Ura plate. Dilute and mix the remaining 20 μL with 80 μL of 0.9% (w / w) NaCl solution, and apply 80 μL to an SD / Ura plate.

[0172] 9) Incubate at 30°C for 48 to 96 hours.

[0173] (3) Find the lowest AbA concentration that inhibits the growth of the bait strain.

[0174] 1) Select a larger, rounder yeast colony from the SD / Ura plate and perform PCR on the culture medium to verify the correct insert band. Takara's Matchmaker Insert Check PCRMix I kit was used for PCR. Y1HGold was used as a negative control. The PCR mixture consisted of 50 μL of PCR, 25 μL of Matchmaker Insert Check PCRMix I, and 25 μL of ddH2O. A small amount of yeast was picked up with a sterile toothpick and added to the mixture. The reaction procedure was a three-step process: Step 1: 98°C for 5 minutes, one cycle; Step 2: 98°C for 10 seconds, 55°C for 30 seconds, and 68°C for 2 minutes, 30 cycles; Step 3: 68°C for 5 minutes. 2) The remaining fragment was scraped off and placed in a 1.5 mL centrifuge tube. The fragment was resuspended in 0.9% NaCl solution and the OD value was measured. When the OD value was adjusted to 0.002, the fragment containing AbA at concentrations of 0, 100, 200, 300, and 500 μg / L was applied. -1 Plate the culture medium on a SD / Ura plate and invert at 30°C for 48 to 96 hours.

[0175] (4) Co-transformation verification:

[0176] 1) Pick a single colony with a diameter of 2-3 mm and place it in 3 mL of YPDA medium. Incubate at 30°C, 250 rpm, and 8 h. 2) Pipette 2-5 μL of the culture into 50 mL of YPDA (in a 250 mL Erlenmeyer flask). Incubate at 30°C, 250 rpm, and 16-20 h until the OD reaches 0.15-0.3.

[0177] 3) Divide the bacterial suspension into two 50 mL centrifuge tubes and centrifuge at 700 × g for 5 min at room temperature. Remove the supernatant and resuspend the cells in 100 mL of fresh YPDA. Incubate at 30°C, 250 rpm, for 3–5 h, until the OD value reaches 0.4–0.5.

[0178] 4) Centrifuge at 700 × g for 5 min at room temperature, remove the supernatant, and resuspend the yeast in 60 mL of ddH2O.

[0179] 5) Centrifuge at 700 × g for 5 min at room temperature, remove the supernatant, and resuspend the yeast in 3 mL of 1.1 × TE / LiAc solution. Denature the carrier DNA twice.

[0180] 6) Centrifuge the yeast suspension at 13,000 rpm for 15 seconds, remove the supernatant, add 600 μL of 1.1×TE / LiAc, and pipette to mix well.

[0181] 7) Take 50 μL of the yeast resuspension obtained in the previous step, add 10 μL of pre-denatured Carry DNA and 200 ng of prey plasmid to the bacterial suspension, and gently mix with a pipette tip.

[0182] 8) Add 300 μL of 1×TE / LiAc / PEG and mix well.

[0183] 9) Incubate in a water bath at 30°C for 30 min, gently mixing every 10 min.

[0184] 10) Add 20 μL of DMSO to each tube and mix gently.

[0185] 11) Heat shock in a 42°C water bath for 15 min, mixing by inverting every 5 min.

[0186] 12) Centrifuge at high speed for 15 seconds, discard the supernatant, resuspend the cells in 1 mL of YPD plus, and recover at 250 rpm at 30°C for 1 hour.

[0187] 13) Centrifuge at high speed for 15 seconds and discard the supernatant.

[0188] 14) Resuspend the cells in 100 μL of 0.9% NaCl and spread on a SD / Leu / AbA plate.

[0189] 15) Culture in a 30°C incubator for 3-5 days until positive clones emerge.

[0190] (5) Dilution and seeding:

[0191] 1) Pick single colonies from the plates coated with the self-activation, co-transformation experimental group, and co-transformation positive / negative control groups, inoculate them into 10 mL of SD / -Leu liquid medium, and culture at 30°C, 250 rpm, for 16 h.

[0192] 2) Add 300 μL of bacterial solution to 50 mL of Leu and incubate at 30°C, 250 rpm for 8-12 hours until the OD600 reaches 0.4-0.6.

[0193] 3) For each of the experimental and control groups, add 90 μL of 0.9% NaCl to four 0.2 ml PCR tubes, numbered A, B, C, and D. Add 10 μL of the shaken bacterial solution to tube A and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube B and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube B and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube C and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube D and mix thoroughly.

[0194] 4) Take 10uL of bacterial solution from each of tubes A, B, C, and D and spot it onto the SD / -Leu and SD / -Leu / Aba plates. Incubate at 30°C for 3 days and observe the growth of bacterial plaques. Figure 11shown.

Claims

1. The use of the GhBBX21 gene in promoting anthocyanin accumulation in R1 cotton plants is characterized by: The CDS sequence of the GhBBX21 gene is shown in SEQ No. 1 in the sequence listing, and the accumulation of anthocyanins is improved by increasing the expression of the GhBBX21 gene in R1 cotton.

2. A method for cloning the GhBBX21 gene and constructing a vector according to claim 1, comprising: (1) Plant material and reagent selection; (2) RNA extraction and reverse transcription; (3) Primer design and gene and promoter cloning; (4) Construction of subcellular localization vector, overexpression vector, dual luciferase vector and yeast single hybrid vector.

3. The GhBBX21 gene cloning and vector construction method according to claim 2, characterized in that: Cotton materials: R1 cotton, i.e., upland cotton variety T586, used for DNA and RNA extraction; Arabidopsis materials: seeds of Arabidopsis thaliana col-0 and transgenic lines were sterilized with ethanol and sodium hypochlorite, sown on MS medium, kept at 4°C for 48 h, then transferred to 21°C, cultured under 16 / 8 h light / dark cycle, and transferred to nutrient pots after two weeks for culture; Tobacco materials: For subcellular localization and dual-luciferase experiments, tobacco (Nicotiana benthamiana) seedlings were grown in a growth chamber at 28°C with a 12 h light / 12 h dark cycle; The reagents selected are as follows: the vector pBI121-GFP used for subcellular localization and the stable transformation vector pBI121 are long-term laboratory storage vectors, the dual luciferase vectors pGreen0800-LUC and pGreenII 62-SK, the yeast single hybrid vectors pAbAi and pGADT7 are all commercially purchased, the Escherichia coli (E. coli) competent DH5α, the Agrobacterium tumefaciens (A. tumefaciens) competent GV3101 and GV3101 (pSoup-p19) and the yeast strain Y1HGold are commercially purchased.

4. The method for GhBBX21 gene cloning and vector construction according to claim 2, wherein: The RNA extraction and reverse transcription process is as follows: RNA extraction: Young leaf tissue was collected and RNA was extracted using a polysaccharide and polyphenolics-rich plant total RNA extraction kit (Polysaccharides and Polyphenolics-rich, TIANGEN). The steps are as follows: (1) Homogenization: Grind 50-100 mg of R1 cotton young leaves into powder in liquid nitrogen, add 500 μL of lysis buffer SL, add β-mercaptoethanol to lysis buffer SL before use, and add 25 μL of β-mercaptoethanol to 475 μL of lysis buffer, and mix thoroughly by vortexing. (2) Centrifugation at 12000 rpm for 2 min; (3) Transfer the supernatant to the CS filter column and centrifuge at 12,000 rpm for 2 min. Pipette the supernatant from the collection tube into a new RNase-free centrifuge tube, avoiding contact of the pipette tip with the cell debris precipitate in the collection tube. (4) Slowly add 0.4 times the volume of the supernatant to anhydrous ethanol, mix well, and transfer the resulting solution and precipitate to the adsorption column CR3. Centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube. (5) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 15 s, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube; (6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and place it in a new RNase-free centrifuge tube, add 70 μL of RDD buffer, and mix gently; (7) Add 80 μL of DNase I working solution to the center of adsorption column CR3 and incubate at room temperature for 15 min. (8) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 15 s, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube; (9) Add 500 μL of rinse solution RW to the adsorption column CR3. Add ethanol to the 500 μL rinse solution RW before use. Centrifuge at 12,000 rpm for 15 s. Discard the waste liquid in the collection tube and return the adsorption column CR3 to the collection tube. (10) Repeat step 9 once; (11) Centrifuge at 12000 rpm for 2 min, place the adsorption column CR3 in a new RNase-free centrifuge tube, add 30-50 μL RNase-free ddH2O dropwise to the middle of the adsorption membrane, let stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min to obtain RNA solution, and store at -80°C for later use; (12) Gel electrophoresis was used to check the purity and integrity of RNA. Nanodrop 2000 ultra-micro spectrophotometer was used to detect the concentration and purity. 260 / 280 Samples with values ​​between 1.8 and 2.0 were used for the next experiment; Reverse transcription of cDNA: The reverse transcription kit used was the Takara Prime Script 1st Strand cDNA Synthesis Kit. The reaction system and steps were as follows: (1) Prepare the reaction mixture according to the table below: (2) Keep warm at 65°C for 5 min and cool on ice; (3) Prepare 20 μL of reaction solution according to the following table: (4) Mix well and perform reverse transcription reaction under the following conditions: 42°C for 60 min; 70°C for 15 min, then cool on ice and store at -20°C until use.

5. The method for GhBBX21 gene cloning and vector construction according to claim 2, wherein: Primer design and gene and promoter cloning: Primer design: The specific primer sequences used in vector construction are shown in the following table: Gene and promoter cloning: The GhBBX21 gene PCR amplification product was obtained by amplifying the cDNA of R1 cotton using GhBBX21 gene-specific primers. The promoter fragment of the gene was PCR amplified by amplifying the DNA of R1 cotton using GhPAP1D promoter-specific primers of R1 cotton. The DNA polymerase used was high-fidelity Takara Prime STAR G×L DNA Polymerase. The PCR system is shown in the following table: The PCR reaction was carried out on a PCR thermal cycler with the following procedure: first step, pre-denaturation at 98°C for 5 min; second step, denaturation at 98°C for 10 s, annealing at 55°C for 15 s, and extension at 68°C for 1 min / 1 kb; 30 cycles; third step, extension at 68°C for 5 min. The PCR product was confirmed by gel electrophoresis and purified and recovered for use in the next experiment.

6. The method for GhBBX21 gene cloning and vector construction according to claim 2, characterized in that: The construction process of overexpression vector, subcellular localization vector, dual luciferase vector and yeast single hybrid vector is as follows: Vectors and restriction enzyme cutting sites used: Construction of the overexpression vector 35S:GhBBX21: The CDS sequence of GhBBX21 containing the terminator was amplified and inserted into the pBI121 vector via homologous recombination, with the restriction enzyme sites being XbaI and BamHI. Construction of the subcellular localization vector 35S:GhBBX21-GFP: The CDS sequence of GhBBX21 without the terminator was amplified and inserted into the pBI121-GFP vector via homologous recombination, with the restriction enzyme sites being XbaI and BamHI. Construction of the dual-luciferase vectors 35S:GhBBX21 and 35S:REN / proGhPAP1DR1:LUC: The full-length CDS sequence of GhBBX21 was inserted into the effector vector pGreenII via homologous recombination. 62-SK, with HindIII and BamHI restriction sites, to construct the 35S:GhBBX21 recombinant vector plasmid. proGhPAP1DR1 was amplified and cloned into the pGreen0800-LUC vector, with HindIII and BamHI restriction sites, to construct the 35S:REN / proGhPAP1D R1 :LUC vector; yeast single hybrid vector pAbAi-proGhPAP1D R1 and construction of pGADT7-GhBBX21: proGhPAP1D R1 The full-length CDS sequence of GhBBX21 was constructed into pGADT7 by homologous recombination with restriction enzyme sites of EcoRI and BamHI, and ligated into pAbAi vector by homologous recombination with restriction enzyme sites of SacI and XhoI; Connection between vector, gene and promoter: For connecting vectors with genes and promoters For the Seamless Cloning and Assembly Kit, mix the digested vector and purified PCR product according to the reaction system in the table below and react at 50°C for 15 minutes. Transformation into competent E. coli DH5α: The recombinant plasmid was transformed into E. coli competent cells. The steps are as follows: (1) Thaw competent E. coli DH5α stored at -80°C on ice; (2) Add the homologous recombination ligation product to the competent medium (the ligation product should not exceed 10% of the total volume), mix gently, and incubate on ice for 30 minutes; (3) Heat shock at 42°C for 90 seconds, then quickly place on ice for 2–3 minutes; (4) Add 800 μL of LB liquid medium without antibiotics and culture at 37°C and 180 rpm for 1 h; (5) Centrifuge at 12000 rpm for 30 seconds to collect the bacterial solution, leaving 100-200 μL of liquid in the tube. Use a sterile pipette tip to slowly suspend the precipitate. Use sterilized glass beads to evenly spread the bacterial solution on the corresponding resistance solid LB medium and seal it. The preparation method of LB medium is shown in the table below. (6) Incubate at 37°C for 12–16 h, pick a single white colony, amplify, and perform gel electrophoresis after PCR. If the correct band is found, send it to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. (7) Sequencing results were compared and analyzed using ClustalX 1.81win software. Successfully aligned bacterial suspensions were amplified and shaken, with one portion used to extract the recombinant plasmid and another portion added with 50% glycerol at a 1:1 volume ratio for bacterial preservation and placed in a -80°C refrigerator. A small amount of recombinant plasmid was extracted: Use the TIANprep Mini Plasmid Kit to extract small amounts of plasmid. The specific steps are as follows: (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CP3, place the adsorption column in a collection tube, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube; (2) Take 1-5 mL of overnight culture solution, add it to a centrifuge tube, centrifuge at 12000 rpm for 1 min, and remove the supernatant; (3) Add 250 μL of solution P1 to the centrifuge tube containing the bacterial pellet. Solution P1 has been added with RNase A. Use a pipette or vortex oscillator to thoroughly resuspend the bacterial pellet. (4) Add 250 μL of solution P2 to the centrifuge tube and gently invert the tube 6–8 times to fully lyse the cells. The cell suspension should become clear and viscous. The lysis time should not exceed 5 min to avoid plasmid damage. If the suspension does not become clear, it may be due to an excessive number of cells and incomplete lysis. Reduce the amount of cells. (5) Add 350 μL of solution P3 to the centrifuge tube and immediately and gently invert it up and down 6-8 times to mix until a white flocculent precipitate appears. Centrifuge at 12000 rpm for 10 min. Mix immediately after adding P3 to avoid local precipitation. If there is still a small white precipitate in the supernatant, centrifuge again and collect the supernatant. (6) Use a pipette to transfer the supernatant collected in the previous step to the adsorption column CP3. Place the adsorption column in the collection tube. Be careful not to suck out the precipitate. Centrifuge at 12,000 rpm for 30–60 s. Discard the waste liquid in the collection tube and place the adsorption column CP3 in the collection tube. (7) Optional step: Add 500 μL of deproteinized solution PD to the adsorption column CP3, centrifuge at 12,000 rpm for 30–60 s, discard the waste liquid in the collection tube, and return the adsorption column CP3 to the collection tube. This step is recommended for the host strain BL21. If the host strain is DH5α, this step can be omitted. (8) Add 600 μL of rinse solution PW to the adsorption column CP3. First, make sure that anhydrous ethanol has been added to PW. Centrifuge at 12,000 rpm for 30–60 s. Discard the waste liquid in the collection tube and place the adsorption column CP3 in the collection tube. (9) Repeat step 8 once; (10) Place the adsorption column CP3 in a collection tube and centrifuge at 12,000 rpm for 2 min to remove the remaining rinse solution in the adsorption column. Uncap the adsorption column CP3 and place it at room temperature for several minutes to dry the remaining rinse solution in the adsorption material. (11) Place the adsorption column CP3 in a clean centrifuge tube, add 50-100 μL of elution buffer EB to the middle part of the adsorption membrane, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the plasmid solution into a centrifuge tube. To increase the recovery rate of the plasmid, add the resulting solution back to the adsorption column, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the plasmid solution into a centrifuge tube; (12) Check the purity of the product by gel electrophoresis, and use Nanodrop 2000 ultra-micro spectrophotometer to detect the concentration and purity. Store at -20℃ after packaging. Transformation of Bacillus pyogenes: Transformation of Bacillus pyogenes GV3101 with overexpression vector and subcellular localization vector, and transformation of Bacillus pyogenes GV3101 with dual luciferase vector (pSoup-19): (1) Take the competent Agrobacterium stored at -80℃ and place it in the room temperature or in the palm of your hand for a while until it partially thaws. When it is in an ice-water mixture, insert it into ice; (2) Add 0.01-1 μg of plasmid DNA per 100 μL competent medium, gently stir the bottom of the tube to mix, and then place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes. (3) Add 700 μL of antibiotic-free LB liquid medium and culture at 28°C with shaking for 2–3 h; (4) Centrifuge at 8000 rpm for 1 min to collect the bacteria. Take about 100 μL of the supernatant and gently pipette to resuspend the bacteria. Spread the plate on an LB plate containing three antibodies: Kan, Gen, and Rif. Place the plate upside down in a 28°C incubator and culture for 2–3 days. (5) Pick a single clone, place it in LB liquid medium containing three antibodies, and shake at 28°C and 200 rpm for 16-20 h; (6) After PCR, the bacterial solution was verified by gel electrophoresis, and the correct bands were used for bacterial preservation and the next step of the experiment.

7. The method for GhBBX21 gene cloning and vector construction according to claim 2, wherein: The GhBBX21 gene function verification method includes: (1) Arabidopsis genetic transformation experiment; (2) subcellular localization experiment; (3) yeast one-hybrid experiment in which the transcription factor GhBBX21 binds to the GhPAP1D promoter; (4) dual-luciferase experiment in which the transcription factor GhBBX21 activates GhPAP1D expression.

8. The method for GhBBX21 gene cloning and vector construction according to claim 7, characterized in that: Arabidopsis genetic transformation experiment: (1) Arabidopsis genetic transformation method 1) Inoculate Agrobacterium GV3101 containing the 35S:GhBBX21 recombinant plasmid into 3 mL of LB liquid medium containing three antibodies and culture overnight at 28°C and 200 rpm; 2) Inoculate 0.1 mL of Agrobacterium tumefaciens into 100 mL of liquid culture medium containing three antibodies (at a ratio of 1:1000, and culture overnight at 28°C until OD 600 =1.0; 3) Transfer the Agrobacterium to a centrifuge tube, centrifuge at 8000 rpm / min for 10 min, discard the supernatant, and collect the bacteria; 4) Add an equal volume of impregnation solution (100 mL of 1 / 2 MS, 5 g of sucrose, 20 μL of Silwet L-77, 10 μL of 1 MAS, pH 5.8) to resuspend the cells and incubate at room temperature in the dark for 2 h. 5) Select healthy Arabidopsis plants and place them upside down in a container containing the Agrobacterium suspension, immersing the inflorescence completely in the suspension for 45 seconds. 6) The infected Arabidopsis thaliana was cultured in the dark for 24 hours and then continued to be cultured under a 12-hour light / 12-hour dark cycle; (2) Obtaining and identifying transgenic Arabidopsis positive seedlings 1) The harvested transgenic Arabidopsis T0 seeds were air-dried at room temperature for 15 days, spotted on MS culture plates containing 50 μg / mL Kan, and cultured in the dark at 4°C for 2 days; 2) Grow in a light incubator for 10 days, at which time yellow and green seedlings are identified, with green seedlings being positive. 3) Move the green seedlings that are growing well into nutrient soil and continue to cultivate; 4) Rosette leaves of 4-week-old wild-type and transgenic Arabidopsis seedlings were cut and DNA was extracted for PCR detection. Positive seedlings with correct bands were continued to be cultured; 5) Harvesting positive seedlings is the T1 generation. The harvested seeds continue to be screened and identified until the T3 generation for subsequent phenotypic observation and related experiments.

9. The method for GhBBX21 gene cloning and vector construction according to claim 7, characterized in that: Subcellular localization experiments: Agrobacterium GV3101 containing the 35S:GhBBX21-GFP recombinant vector was shaken at 28°C and 200 rpm until the OD 600 = 0.6-1.0, centrifuged at 6000 rpm for 10 min, resuspended in resuspension solution, adjusted to OD 0.8, rested for 2 h, injected into tobacco leaves, cultured at 28°C under normal light for two days, and observed under a confocal microscope. The GFP fluorescence excitation wavelength was set at 488 nm and the emission wavelength was 500-530 nm. The resuspension solution consisted of: 10 mM MgCl2, 100 μM AS, and 10 mM MES added to 100 mL MS, and the pH was adjusted to 5.8; Dual luciferase assay: (1) Transient transformation of tobacco: Agrobacterium GV3101 (pSoup-p19) containing 35S:GhBBX21 and 35S:REN / proGhPAP1DR1:LUC was shaken at 28°C and 200 rpm to OD600 = 1.0, centrifuged at 6000 rpm for 10 min, and resuspended in a resuspension solution to adjust the OD value to 1.

0. The volume ratio of 35S:GhBBX21 to 35S:REN / proGhPAP1DR1:LUC was 9:1 and mixed. The resuspension of the mixture of 35S:REN / proGhPAP1DR1:LUC and an empty vector was used as a control. The mixed resuspension was kept in the dark at 28°C for 2 h and then injected into tobacco. The injected tobacco was cultured at 28°C under normal light conditions for 3 days. The leaves were taken and stored at -80°C. The resuspension composition was as follows: 10 mM MgCl2, 100 μM AS and 10 mM MES, pH adjusted to 5.8; (2) Dual luciferase activity assay Dual luciferase activity assay ReporterAssay System kit, the specific steps are as follows: 1) Reagent preparation: 1×PLB lysis buffer: Dissolve 1 volume of 5× Passive Lysis Buffer in 4 volumes of sterile ddH2O. 1×PLB lysis buffer is prepared and used immediately. LARII reagent: Dissolve Luciferase Assay Substrate in 10 mL of Luciferase Assay Buffer II, aliquot, and store in a -80°C refrigerator. Stop& Reagent: Mix 1 volume of 50×Stop& The substrate was dissolved in 50 times the volume of Stop& In Buffer, Stop& Reagents are prepared and used immediately; 2) Extraction of tobacco total protein 100 mg of injected tobacco leaves were quickly ground into powder in liquid nitrogen, added to 300 μL of 1× PLB lysis buffer, vortexed and mixed, and placed on ice for 20 min, vortexing every 5 min. Centrifuged at 8000 rpm at 4°C for 20 min. 2 μL of the supernatant was diluted with 198 μL of 1× PLB lysis buffer and placed on ice. 3) Luciferase activity assay Before measuring enzyme activity with a microplate reader, the lysate, LARII reagent and Stop& The reagent was placed at room temperature for 30 minutes. The microplate reader was programmed to set a 2-second delay for measurement and a 10-second reading. 20 μL of diluted lysate and 50 μL of LARII were added to the microplate. The mixture was pipetted 2 to 3 times and the LUC value was measured. 50 μL of Stop & Reagent was mixed and the value of Renilla Luciferase (REN) was detected. Three biological replicates and six mechanical replicates were set for each experiment, and the LUC / REN value was calculated.

10. The method for GhBBX21 gene cloning and vector construction according to claim 7, characterized in that: Yeast one-hybrid experiment: (1) The preparation of YPDA medium used for yeast single hybrid is shown in the following table: The preparation of SD / Ura solid medium is shown in the following table: (2)pAbAi-proGhPAP1D R1 Convert Y1HGold: 1) Single enzyme digestion of pAbAi-proGhPAP1D R1 The plasmid system is shown in the table below. After enzyme digestion at 37°C overnight, it is purified and the concentration is measured before use. 2) Denature the carrier DNA at 95-100°C for 5 minutes and cool on ice until ready for use. 3) Remove Y1HGold competent cells from the -80°C freezer and add 2 μg of pre-chilled linearized pAbAi-proD5 plasmid, 10 μL of denatured carrier DNA, and 500 μL of PEG / LiAc in that order, and pipette to mix thoroughly. 4) Incubate in a 30°C water bath for 30 minutes, mixing thoroughly every 10 minutes with a pipette. 5) Add 20 μL of DMSO, mix thoroughly, and incubate in a 42°C water bath for 15 minutes. After 7.5 minutes, pipette to mix thoroughly. 6) After centrifugation at 9000 rpm for 5 min, discard the supernatant, add 1 mL of YPD plus, mix thoroughly by pipetting, and incubate on a shaking platform at 30°C for 90 min. 7) Centrifuge at 9000 rpm for 45 seconds to collect the cells and resuspend them in 100 μL of 0.9% (w / w) NaCl solution; 8) Spread 80 μL of the culture on an SD / Ura plate. Dilute and mix the remaining 20 μL with 80 μL of 0.9% (w / w) NaCl solution, and spread 80 μL on an SD / Ura plate. Dilute and mix the remaining 20 μL with 80 μL of 0.9% (w / w) NaCl solution, and spread 80 μL on an SD / Ura plate. 9) Incubate at 30°C for 48-96 hours; (3) Find the lowest AbA concentration that inhibits the growth of the bait strain: 1) Isolate a single yeast colony cultured on the SD / Ura plate and verify the correct insert by PCR. Use the Matchmaker Insert Check PCR Mix I kit with Y1HGold as a negative control. The PCR system consists of 50 μL of PCR product, 25 μL of Matchmaker Insert Check PCR Mix I, and 25 μL of ddH2O. Use a sterilized toothpick to pick a small amount of yeast and add it to the mixture. The reaction procedure uses a three-step protocol: Step 1: 98°C for 5 minutes, one cycle; Step 2: 98°C for 10 seconds, 55°C for 30 seconds, and 68°C for 2 minutes, for 30 cycles; Step 3: 68°C for 5 minutes. 2) The remaining scraped liquid was placed in a 1.5 mL centrifuge tube and resuspended in 0.9% NaCl solution. The OD value was measured. When the OD value was adjusted to 0.002, the concentration of AbA was 0, 100, 200, 300, and 500 μg·L. -1 Incubate on SD / Ura plates upside down at 30°C for 48-96h; (4) Co-transformation verification: 1) Pick a single colony with a diameter of 2-3 mm and place it in 3 mL of YPDA medium. Cultivate at 250 rpm at 30°C for 8 h. 2) Pipette 2-5 μL into 50 mL YPDA (250 mL Erlenmeyer flask) and incubate at 250 rpm at 30°C for 16-20 h until the OD reaches 0.15-0.

3. 3) Divide the bacterial suspension into two 50 mL centrifuge tubes and centrifuge at 700 × g for 5 min at room temperature. Remove the supernatant and resuspend the cells in 100 mL of fresh PDA. Incubate at 250 rpm at 30°C for 3–5 h until the OD value reaches 0.4–0.

5. 4) Centrifuge at 700 × g for 5 min at room temperature, remove the supernatant, and resuspend the yeast in 60 mL of ddH2O. 5) Centrifuge at 700 × g for 5 min at room temperature, remove the supernatant, resuspend the yeast in 3 mL of 1.1× TE / LiAc solution, and pre-denature the CarryDNA twice; 6) Centrifuge the yeast suspension at 13,000 rpm for 15 seconds, remove the supernatant, add 600 μL of 1.1× TE / LiAc, and pipette evenly for later use; 7) Take 50 μL of the yeast resuspension obtained in the previous step, add 10 μL of pre-denatured Carry DNA and 200 ng of prey plasmid to the bacterial suspension, and gently mix with a pipette tip; 8) Add 300 μL of 1×TE / LiAc / PEG and mix well; 9) Incubate in a water bath at 30°C for 30 minutes, gently mixing every 10 minutes. 10) Add 20 μL of DMSO to each tube and mix gently; 11) Heat shock at 42°C in a water bath for 15 min, mixing by inverting every 5 min. 12) Centrifuge at high speed for 15 seconds, discard the supernatant, resuspend the cells in 1 mL of YPD plus, and recover at 250 rpm at 30°C for 1 hour. 13) Centrifuge at high speed for 15 seconds and discard the supernatant; 14) Resuspend the cells in 100 μL of 0.9% NaCl and spread on a SD / Leu / AbA plate; 15) Culture in a 30°C incubator for 3-5 days until positive clones emerge. (5) Dilution and seeding 1) Pick single colonies from the plates coated with the self-activation, co-transformation experimental group, and co-transformation positive / negative control groups, inoculate them into 10 mL of SD / -Leu liquid medium, and culture at 30°C, 250 rpm, for 16 h. 2) Add 300 μL of bacterial solution to 50 mL of Leu and incubate at 30°C, 250 rpm for 8-12 hours until the OD600 reaches 0.4-0.

6. 3) For each of the experimental and control groups, add 90 μL of 0.9% NaCl to four 0.2 ml PCR tubes, numbered A, B, C, and D. Add 10 μL of the shaken bacterial solution to tube A and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube B and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube B and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube C and mix thoroughly. Add 10 μL of the mixed bacterial solution to tube D and mix thoroughly. 4) Take 10 μL of bacterial solution from each of tubes A, B, C, and D and spot it onto plates SD / -Leu and SD / -Leu / Aba. Incubate at 30°C for 3 days and observe the growth of bacterial plaques.

Images