Pharmaceutical composition and use thereof
By combining a 4-epimerase inhibitor with a GLP-1 receptor agonist, the neurofibrosis of the arcuate nucleus of the hypothalamus is reduced, solving the problem that existing GLP-1 receptor agonists are not effective in patients with high BMI, and achieving effective weight loss and blood sugar control.
Patent Information
- Application Number
- CN202380079531.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-11-28
- Filing Date
- 2023-11-28
- Publication Date
- 2025-09-26
AI Technical Summary
Existing GLP-1 receptor agonists have limited effectiveness in treating obesity and type 2 diabetes, especially in patients with high BMI, where weight loss and blood sugar control are poor, and long-term use may lead to weight gain. Existing methods are difficult to effectively treat or prevent insulin resistance and related metabolic diseases.
The combination of a 4-epimerase inhibitor and a GLP-1 receptor agonist improves insulin resistance and related symptoms by reducing neurofibrosis in the arcuate nucleus of the hypothalamus (ARC) and enhancing the activity of the GLP-1R agonist.
The composition can effectively reduce weight, improve blood sugar control, enhance signal conduction of GLP-1R agonist, prolong the effect of weight loss, and reduce obesity tendency and insulin resistance.
Smart Images

Figure BDA0005404389270000131 
Figure BDA0005404389270000141 
Figure BDA0005404389270000142
Abstract
Description
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to Australian Provisional Patent Application No. 2022903599 filed on November 28, 2022, the entire contents of which are incorporated herein by cross-reference. Technical Field
[0003] The present invention generally relates to pharmaceutical combinations for treating or preventing insulin resistance and conditions associated with insulin resistance. In particular, the present invention relates to pharmaceutical combinations comprising a 4-epimerase inhibitor and a GLP-1 receptor agonist for treating or preventing insulin resistance and related conditions such as obesity and type 2 diabetes, suppressing appetite, and / or promoting weight loss. Background Art
[0004] Metabolic diseases such as obesity and type 2 diabetes affect approximately 650 million people worldwide. The global prevalence of metabolic diseases has tripled since 1975, and if current trends continue without effective treatments, >51% of the world's population will be obese or have type 2 diabetes by 2030. A key hallmark of many metabolic diseases, including obesity and type 2 diabetes, is insulin resistance.
[0005] Insulin is a peptide hormone synthesized and secreted by the beta cells of the pancreas. Once secreted into the blood, insulin affects various cells expressing it throughout the body, playing a crucial role in maintaining blood glucose levels within the optimal range. In this context, insulin targets peripheral tissues, including skeletal muscle and adipose tissue, to promote glucose uptake from the circulation, and targets the liver to inhibit gluconeogenesis and glycogenolysis. Insulin also signals the brain, where it plays a crucial role in how the brain controls systemic glucose and energy homeostasis. Insulin resistance occurs when peripheral insulin target tissues become insensitive to the effects of insulin.
[0006] Obesity is characterized by an excessive accumulation of adipose tissue, which is highly responsive to insulin and contributes significantly to both glucose and lipid metabolism. In obese individuals, adipose tissue releases higher amounts of non-esterified fatty acids, glycerol, hormones, and pro-inflammatory cytokines, substances that have been implicated in the development of insulin resistance. Initially, β (beta) cells compensate for insulin resistance by secreting more insulin, but over time, the β cells are unable to meet the body's demand for insulin, and blood glucose levels rise. Therefore, in addition to its own health complications, obesity-related insulin resistance is also a major risk factor for type 2 diabetes.
[0007] Type 2 diabetes can be a difficult disease to manage because it requires long-term maintenance of blood sugar levels. Current antidiabetic drugs do not control blood sugar levels well enough to completely prevent both high and low blood sugar levels, which can lead to long-term complications such as retinopathy, nephropathy, neuropathy, and peripheral vascular disease. People with type 2 diabetes are also at increased risk for other conditions such as obesity, high blood pressure, stroke, heart disease, and hyperlipidemia.
[0008] In addition to metabolic diseases such as obesity and type 2 diabetes, insulin resistance is associated with many other serious health problems, including metabolic syndrome, hypertension, dyslipidemia, hyperglycemia, atherosclerosis, non-alcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), and coagulopathy.
[0009] Glucagon-like peptide 1 receptor (GLP-1R) agonists and their analogs, such as liraglutide, stimulate insulin secretion by activating the GLP-1 receptor in the arcuate nucleus (ARC) of the hypothalamus, improving glucose homeostasis in patients with obesity and diabetes. However, functional GLP-1 receptor signaling is impaired in obese patients, and GLP-1 receptor agonists such as liraglutide are less effective in reducing body weight and HbA1c levels (a marker of long-term glycemic control) in patients with higher body mass index (BMI). Reduced GLP-1-induced insulin release from pancreatic β cells has also been observed in obese patients with impaired glucose tolerance.
[0010] Although many GLP-1R agonists are available on the market, they are often less effective in patients with higher BMI. For example, after long-term administration of liraglutide, 45.9% of overweight patients (BMI < 30 kg / m 2 ) lost more than 10% of their body weight, compared to patients with morbid obesity (BMI > 40 kg / m 2 ) lost 29.9% of their body weight (Pi-Sunyer et al., 2015). The clinical efficacy of GLP-1 receptor agonists in improving glycemic control also appears to diminish over time (Davies et al., 2015). Furthermore, ICV-administered GLP-1 impairs lipid uptake into white adipose tissue via the sympathetic nervous system in lean, but not obese, mice. Previous attempts to address the limitations of single GLP-1R agonists have had limited success. For example, single-dose liraglutide treatment involves the simultaneous administration of insulin degludec and liraglutide, which can result in weight gain.
[0011] Therefore, there is a need for improved or alternative methods for treating or preventing insulin resistance and related disorders, including metabolic diseases such as obesity and type 2 diabetes. Summary of the Invention
[0012] In one aspect, the present invention provides a pharmaceutical combination comprising (i) a 4-epimerase inhibitor and (ii) a GLP-1 receptor (GLP-1R) agonist.
[0013] In another aspect, the present invention provides a pharmaceutical composition comprising a 4-epimerase inhibitor and a GLP-1 agonist.
[0014] In another aspect, the present invention provides a method for treating or preventing insulin resistance or a related disorder, suppressing appetite and / or promoting weight loss in a subject, the method comprising administering to the subject an effective amount of a combination of a 4-epimerase inhibitor and a GLP-1 receptor (GLP-1R) agonist.
[0015] In another aspect, the present invention provides a use of a 4-epimerase inhibitor and a GLP-1R agonist for preparing one or more medicaments for treating or preventing insulin resistance or related disorders, suppressing appetite and / or promoting weight loss in a subject.
[0016] In another aspect, the present invention provides a use of a 4-epimerase inhibitor for preparing a medicament for treating or preventing insulin resistance or related disorders, suppressing appetite and / or promoting weight loss in a subject in combination with a GLP-1R agonist.
[0017] In another aspect, the present invention provides a use of a GLP-1R agonist for preparing a medicament for treating or preventing insulin resistance or related disorders, suppressing appetite and / or promoting weight loss in a subject in combination with a 4-epimerase inhibitor.
[0018] In another aspect, the present invention provides a combination comprising (i) a 4-epimerase inhibitor and (ii) a GLP-1R agonist for use in treating or preventing insulin resistance or a related disorder, suppressing appetite and / or promoting weight loss in a subject. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Embodiments of the present invention will now be described with reference to the following drawings, which are intended to be exemplary only, and in which:
[0020] Figure 1Obesity drives neurofibrosis within the ARC. Age-matched C57BL / 6J mice were fed a chow diet or a HFHS diet for 12 weeks, and brains were processed for a) WFA or g) aggrecan immunostaining; b, h) area and c, i) intensity within the ARC were quantified. d) ARC homogenates from 12 weeks of obese or age-matched chow-fed C57BL / 6J were subjected to ZIC-HILIC chromatography, and CS-GAG and HA abundance were quantified using 2-aminobenzamide fluorescently labeled disaccharides from enzymatically depolymerized GAG chains. C57BL / 6J mice were fed a HFHS diet for 0 days, 3 days, 1 week, 4 weeks, 8 weeks, or 12 weeks, and brains were processed for immunohistochemistry monitoring of: e, f) WFA or m, n) aggrecan expression within the ARC; f, n) quantification of stained area. Age-matched C57BL / 6J mice were fed a chow diet or HFHS diet for 12 weeks, and brains were processed for i) WFA and aggrecan immunostaining, and j, k) quantification of co-expression within ARC. Results are mean ± SEM; significance is representative of at least three independent experiments. Significance was determined using b, c, d, h, i) t-test and f, n) two-way ANOVA with Tukey multiple comparisons. Scale bar, 100 μm.
[0021] Figure 2 : During the development of metabolic diseases, reduced CSPG-ECM turnover in the ARC drives neurofibrosis. a) Schematic overview of the CSPG-ECM tracker technology. b, c) 8-week-old C57BL6J mice received unilateral administration of WFA-biotin or saline into the ARC. One day after injection, brains were extracted and processed for immunohistochemistry monitoring for WFA-biotin and WFA-FITC, and d) the staining area within the ARC was quantified. e) 12-week obese or age-matched chow-fed C57BL6J male mice received bilateral administration of WFA-biotin into the ARC. Brains were extracted at 0 days, 1 week, 3 weeks, 5 weeks, or 10 weeks after injection and subjected to immunohistochemistry monitoring for the presence of WFA-biotin and WFA-FITC, and f, g) Quantification of CSPG-ECM turnover within the ARC over time. h) Gene expression of extracellular matrix-regulating enzymes or profibrotic factors was determined in the medial basal hypothalamus of 12-week obese or age-matched chow-fed C57BL6J male mice. Results are mean ± SEM; significance was determined using simple linear regression in g). Scale bar, 100 μm.
[0022] Figure 3Neurofibrosis occurs around AgRP neurons in the ARC. ac, gi) Npy-GFP and df) Pomc-EGP male mice were fed a HFHS diet for 0, 4, and 12 weeks, and brains were processed for af) WFA or gi) aggrecan immunostaining, and b, e, h) the number of cells encapsulated by staining and c, f, i) the intensity of surrounding staining were quantified. Whole-cell patch clamp electrophysiology was performed in NPY neurons of 12-week HFHS diet Npy-GFP mice after vehicle or chABC administration into the ARC. Four days after injection, j) the proportion of spontaneously firing neurons, k, l) firing frequency, and m) resting membrane potential were determined. Results are mean ± SEM; significance was determined using: b, c, h, i) one-way ANOVA with Tukey's multiple comparisons, g) ANCOVA, or k, m) unpaired t-test (two-tailed) or unpaired t-test (one-tailed), respectively. Electrophysiological recordings were performed on 17 (vehicle) and 18 (chABC) neurons, with 4 mice per treatment group. Scale bar, 100 μm.
[0023] Figure 4: Disassembly of neurofibrosis within the ARC promotes the alleviation of metabolic diseases. a) C57BL / 6J mice were fed a HFHS diet for 12 weeks and injected bilaterally with vehicle or chABC into the ARC to disassemble CSPG-ECM. ARC targeting was confirmed by analysis of ARC WFA immunofluorescence (inset in a). b) Body weight, c) obesity tendency, d) food intake, g) energy expenditure, h) gross morphology of ing WAT, i) histology and UCP-1 immunohistochemistry of ing WAT, j, k) inguinal skin thermography, l) glucose tolerance, and m) HOMA-IR were assessed. C57BL / 6J mice were fed a HFHS diet for 12 weeks and injected bilaterally with vehicle or chABC into the ARC. One day after the intra-ARC injection, mice administered vehicle were pair-fed, with their daily food supply restricted to that consumed by chABC-treated mice, and e) body weight and f) obesity tendency were assessed. A hyperinsulinemic euglycemic clamp was performed in awake, unrestrained C57BL / 6J mice fed a HFHS diet for 12 weeks and injected bilaterally with vehicle or chABC into the ARC. Results are shown for n) GIR, o) basal and clamped EGP. p) Hyperinsulinemic euglycemic clamped mice were administered a bolus injection of 2-DG, and tissue-specific insulin-stimulated uptake was measured in BAT, brain (hypothalamic) epiWAT, BAT and ingWAT, heart, and gastrocnemius muscle. 15-week-old db / db mice were injected bilaterally with vehicle or chABC into the ARC. q) Body weight, r) Obesity tendency, s) Glucose tolerance, and t) HOMA-IR were assessed. Results are mean ± SEM; significance was determined using: b, c, e, f, o, q, r) Two-way ANOVA with repeated measures, d, g, k, l, m, p, s, t) t-test. Scale bar, 100 μm.
[0024] Figure 5Neurofibrosis in obesity promotes ARC insulin resistance. a) C57BL / 6J mice were fed a chow diet or a HFHS diet for 12 weeks and received bilateral injections of vehicle or chABC into the ARC. Two or eight days after ARC injection, mice were administered vehicle or insulin, and brains were processed for immunohistochemistry monitoring of: b, c) insulin-induced p-AKT expression. dh) C57BL / 6J mice were fed a HFHS diet for 12 weeks and received bilateral injections of vehicle or chABC into the ARC. Four days after intra-ARC injection, mice were administered insulin-FITC, and the expression of FITC (f) area, g) intensity, and h) insulin-FITC-induced AKT phosphorylation in the ARC were quantified. i, j) Insulin-FITC was incubated with CSPG-ECM components, and insulin binding was assessed in vitro. Results are mean ± SEM; significance was determined using c) two-way ANOVA with Tukey's multiple comparison test and fj) one-way ANOVA with Tukey's multiple comparison test. Scale bar, 100 μm.
[0025] Figure 6 : The impact of ARC neurofibrosis on systemic metabolic dysfunction is driven by impaired AgRP-IR signaling. a) Schematic diagram of the AAV-gIR construct conditionally targeting the mouse IR. b) AgRP-Cas9 mice fed a 12-week HFHS diet received bilateral intra-ARC injections of AAV-g scrambled or AAV-gIR. ARC targeting was confirmed by analysis of GFP and mCherry immunofluorescence (inset in b). One week later, mice received bilateral injections of vehicle or chABC to disassemble neurofibrosis in the ARC, and c) body weight, d) obesity tendency, e) food intake, f) energy expenditure, g) glucose tolerance, and h) HOMA-IR were determined. Results are mean ± SEM; significance was determined using two-way ANOVA with repeated measures in c, d) and one-way ANOVA with Tukey's multiple comparison test in e, f, g, h). Scale bar, 100 μm.
[0026] Figure 7Pharmacologically targeted neurofibrosis promotes weight loss and improves glycemic control in obesity. a) Male mice fed a 12-week HFHS diet were administered vehicle or fluoxetine daily ICV for 10 days. b, c) CSPG-ECM expression in the ARC, d) body weight, e) obesity tendency, f) energy expenditure, g) food intake, and h) glucose tolerance were assessed. After 10 days of vehicle or fluoxetine treatment, mice were administered insulin, and brains were processed for immunohistochemistry monitoring of i, j) insulin-induced p-AKT expression. Hyperinsulinemic euglycemic clamp was performed in awake, unrestrained C57BL / 6J mice fed a HFHS diet for 12 weeks and administered fluoxetine daily ICV for 3 days, and k) GIR was assessed. C57BL / 6J mice fed a HFHS diet and treated with low-dose STZ to phenotypes of late-stage T2D received vehicle or fluoxetine administered ICV daily for 14 days. l) Daily blood glucose and m) glucose tolerance were assessed. n) AgRP-Cas9 mice fed a 12-week HFHS diet received bilateral injections of AAV-g scrambled or AAV-gIR. One week later, mice received vehicle or fluoxetine administered daily ICV for 10 days and were assessed for o) body weight, p) food intake, q) energy expenditure, r) body weight, and n) glucose tolerance. Results are mean ± SEM. Significance was determined using two-way ANOVA with repeated measures in d, e, k, l, o) and one-way ANOVA with multiple comparisons in c, f, g, h, j, m, p, q, r). Scale bar, 100 μm.
[0027] Figure 8 : Intranasal drug administration delivers biotinylated fluramine (PZ6005) to the ARC. a) Schematic overview of intranasal administration of biotinylated PZ6005. 7- to 8-week-old chow-fed C57BL / 6J mice received vehicle or biotinylated PZ6005 (5 mg / animal / day) IN for 3 consecutive days. Mouse brains and lungs were then extracted for immunohistochemistry to detect the presence of drug, and the intensity of the d) was quantified. Scale bars: b) 500 μm or 100 μm, and f) 200 μm. Results are mean ± SEM. Statistical significance was determined using an unpaired t-test.
[0028] Figure 9: Intranasal administration of fluoxetine (PZ6005) attenuates ARC neurofibrosis in diet-induced obesity. a) Schematic overview of intranasal administration of PZ6005. a) C57BL / 6J mice fed a 12-week HFHS diet received IN administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day) for 14 consecutive days. b) Mouse brains were then extracted and processed for WFA immunohistochemistry to determine CSPG-ECM expression within the ARC, and c, d) area and e, f) intensity were quantified. Scale bar: 100 μm. Results are mean ± SEM. Statistical significance was determined using a one-way ANOVA with Tukey's multiple comparison test.
[0029] Figure 10 Pharmacological inhibition of ARC neurofibrosis using fluoxetine (PZ6005) induces weight loss in diet-induced obesity. C57BL / 6J mice fed a 12-week HFHS diet were administered either vehicle or PZ6005 (1 mg or 5 mg / animal / day) IN for 14 consecutive days. a, b) The effect of treatment on mouse body weight was measured daily for 14 days. Results are mean ± SEM. Statistical significance was determined using a two-way ANOVA with repeated measures and Tukey's multiple comparison test.
[0030] Figure 11 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using fluoroquinolone (PZ6005) reduces obesity tendency. Vehicle, PZ6005 (1 mg or 5 mg / animal / day) were delivered IN to C57BL / 6J mice fed a 12-week HFHS diet for 14 consecutive days. a, b) Adipose tissue and liver were extracted and weighed to determine tissue-specific obesity tendency, and c, d) fat body weight was assessed after 14 days of treatment. Results are mean ± SEM. ANOVA with Tukey's multiple comparison test was used for a, b, d) and repeated measures and Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0031] Figure 12 : Pharmacological inhibition of ARC neurofibrosis using fluoxetine (PZ6005) reduces food intake and increases energy expenditure in diet-induced obesity. C57BL / 6J mice fed a 12-week HFHS diet were administered vehicle or PZ6005 (1 mg or 5 mg / animal / day) daily IN for 14 days. On days 8-11 of treatment, a) 24-hour food intake, b) cumulative food intake, c, d) oxygen consumption, and e.g.) energy expenditure were determined. Results are mean ± SEM. Statistical analysis was performed using a, e) one-way ANOVA with Tukey's multiple comparison test and c, f) one-way ANOVA with repeated measures and Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0032] Figure 13 : In diet-induced obesity, pharmacological attenuation of ARC neurofibrosis using fluoroquinolone (PZ6005) can attenuate ARC insulin resistance. C57BL / 6J mice fed a 12-week HFHS diet were delivered vehicle or PZ6005 (1 mg or 5 mg / animal / day) daily IN for 14 days. After 14 days of treatment, insulin (5 mg / g) was then delivered to the mice IP. The brain was extracted 15 minutes after injection and then processed for immunohistochemistry a) to detect p-AKT signaling induced by insulin. B) ARC pAKT+ve. cells were quantified. Scale bar: 100 μm. Results are mean ± SEM. Statistical significance was determined using b) one-way ANOVA with Tukey's multiple comparison test.
[0033] Figure 14 :Central administration of PZ6005 inhibits ARC neurofibrosis in diet-induced obesity. a) Schematic overview of ICV administration of PZ6005 and SC injection of liraglutide. During the first 14 days of the experiment, C57BL / 6J mice fed a 12-week HFHS diet received vehicle or PZ6005 (100 μg / animal) ICV every other day, while mice were administered vehicle or liraglutide (200 μg / kg / day) SC for 28 consecutive days. b) The extracted mouse brains were then processed to determine ARC CSPG-ECM expression by WFA immunostaining, and c, d) area and e, f) intensity were quantified. Results are mean ± SEM. Statistical significance was determined using c, d, e, f) one-way ANOVA with Tukey's multiple comparison test.
[0034] Figure 15 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using PZ6005 combined with a systemic GLP-1R agonist can promote ARC insulin receptor signaling. For the first 14 days of the experiment, C57BL / 6J mice fed a 12-week HFHS diet were delivered ICV to vehicles or PZ6005 (100 μg / animal) every other day, while mice were injected SC with vehicles or liraglutide (200 μg / kg / day) for 28 consecutive days. After the 28-day experiment, insulin (5 mg / g body weight) was then delivered to the mice IP. The brain was extracted 15 minutes after injection and processed for immunohistochemistry to determine a) p-AKT signaling induced by insulin. B) ARC pAKT+ve. cells were quantified. Results are mean ± SEM. Statistical significance was determined using b) one-way ANOVA with Tukey's multiple comparison test.
[0035] Figure 16 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using PZ6005 combined with a systemic GLP-1R agonist can improve GLP-1R agonist-induced pERK signaling. For the first 14 days of the experiment, C57BL / 6J mice fed a 12-week HFHS diet received vehicle or PZ6005 (100 μg / animal) every other day ICV, and vehicle or liraglutide (200 μg / kg / day) were delivered SC for 28 days. After the 28-day experiment, mice were then injected with liraglutide (200 μg / kg) IP. Brains were extracted 15 minutes after injection and processed for immunohistochemistry to detect a) p-ERK signaling induced by GLP-1R agonists. Quantification was performed on b) total ARC pERK+ve. cells, c) pERK+ve. cells within the ARC, and b pERK+ve. cells around the ARC. Results are mean ± SEM. Statistical significance was determined using b) one-way ANOVA with Tukey's multiple comparison test.
[0036] Figure 17 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using PZ6005 in combination with a systemic GLP-1R agonist induces weight loss. For the first 14 days of the experiment, C57BL / 6J mice fed a 12-week HFHS diet were administered ICV with vehicle or PZ6005 (100 μg / animal) every other day. Mice were also injected subcutaneously with vehicle or liraglutide (200 μg / kg / day) for 28 consecutive days. a, b) Body weights were measured daily during the 28-day treatment period. Results are mean ± SEM. Statistical significance was determined using a two-way ANOVA with repeated measures and Tukey's multiple comparison test in a, b). @Significance indicates the difference between the liraglutide (200 mg / kg / day, subcutaneous) + vehicle (ICV) treatment group and the liraglutide (200 μg / kg / day, subcutaneous) + PZ6005 (100 μg / animal, ICV) treatment group. #Significance indicates vehicle (SC) + PZ6005 (100 μg / animal, ICV)-treated group versus liraglutide (200 μg / kg / day, SC) + PZ6005 (100 μg / animal, ICV)-treated group.
[0037] Figure 18: In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using PZ6005 in combination with a systemic GLP-1R agonist reduces obesity tendency. During the first 14 days of the experiment, C57BL / 6J mice fed a 12-week HFHS diet received vehicle or PZ6005 (100 μg / animal) administered ICV every other day, while mice were injected SC with vehicle or liraglutide (200 μg / kg / day) for 28 days. a) Adipose tissue and liver were extracted and weighed to determine tissue-specific obesity tendency. b, c) Mice fat body weight was assessed after 28 days of treatment. Results are mean ± SEM. A, b, d) One-way ANOVA with Tukey's multiple comparison test and b with repeated measures and Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0038] Figure 19 : In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using PZ6005 in combination with a systemic GLP-1R agonist reduces food intake and increases energy expenditure. During the first 14 days of the experiment, C57BL / 6J mice fed a 12-week HFHS diet were delivered ICV with vehicle or PZ6005 (100 μg / animal) every other day, while mice were injected SC with vehicle or liraglutide (200 μg / kg / day) for 28 consecutive days. On days 8-11 of treatment, a) 24-hour food intake b, c) oxygen consumption, d, e) energy expenditure, and g) ambulatory activity were determined. Results are mean ± SEM. Statistical analysis was performed using a) one-way ANOVA with Tukey's multiple comparison test and b, d) one-way ANOVA with repeated measures and Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0039] Figure 20: In diet-induced obesity, pharmacological inhibition of ARC neurofibrosis using PZ6005 in combination with a systemic GLP-1R agonist enhances the improved glycemic control achieved with GLP-1R agonists. For the first 14 days of the experiment, C57BL / 6J mice fed a 12-week HFHS diet were administered ICV with vehicle or PZ6005 (100 μg / animal) every other day. Simultaneously, mice were administered SC with vehicle or liraglutide (200 μg / kg / day) for 28 consecutive days. a, b) Effects on glucose tolerance were assessed on day 14 after a bolus glucose injection (2 mg / g lean body weight, IP). Results are mean ± SEM. Statistical significance was determined by b) one-way ANOVA with Tukey's multiple comparison test. As shown in Figure b). @Significance indicates liraglutide (200 μg / kg / day, SC) + vehicle (ICV) treated group versus liraglutide (200 μg / kg / day, SC) + PZ6005 (100 μg / animal, ICV) treated group, and #Significance indicates vehicle (SC) + PZ6005 (100 μg / animal, ICV) treated group versus liraglutide (200 μg / kg / day, SC) + PZ6005 (100 μg / animal, ICV) treated group.
[0040] Figure 21 .Therapeutic inhibition of brain neurofibrosis prolongs the rebound effect of GLP-1R agonist-induced weight loss in diet-induced obesity and T2D. C57BL / 6J mice fed a HFHS diet for 12 weeks and an age-matched chow diet were administered ICV with vehicle or PZ6005 (100 μg / animal) every other day, while during the treatment period, mice were injected SC with vehicle or liraglutide (200 μg / kg / day) for 14 consecutive days. The mice were then monitored for 48 days during the off-treatment period. a, b, c) Body weight was measured daily during the 65-day experiment, and d, e, f) mice were assessed for fat body mass and lean body mass after the 65-day experiment. H) Adipose tissue and liver were then extracted and weighed to determine tissue-specific obesity propensity. Results are mean ± SEM. Two-way ANOVA with repeated measures and Tukey's multiple comparison test was used for a, b, c) and two-way ANOVA with repeated measures and Tukey's multiple comparison test was used for d, e, f, g) Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0041] Figure 22.In diet-induced obesity and T2D, therapeutic inhibition of brain neurofibrosis enhances energy expenditure compared to monotherapy with GLP-1R agonists. 12-week HFHS diet-fed and age-matched chow diet-fed C57BL / 6J mice were administered ICV with vehicle or PZ6005 (100 μg / animal) every other day, while during the treatment period, mice were injected SC with vehicle or liraglutide (200 μg / kg / day) for 14 consecutive days. Mice were then monitored for 48 days during the off-treatment period. Effects on a) oxygen consumption, b) energy expenditure, c) fat and carbohydrate utilization, and d) ambulatory activity were assessed during the treatment period. Results are mean ± SEM. A one-way ANOVA with Tukey's multiple comparison test and a repeated measures and Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0042] Figure 23 .In diet-induced obesity, therapeutic inhibition of brain neurofibrosis maintains increased energy expenditure compared to monotherapy with GLP-1R agonists. 12-week HFHS diet-fed and age-matched chow diet-fed C57BL / 6J mice were administered ICV with vehicle or PZ6005 (100 μg / animal) every other day, while during the treatment period, mice were injected SC with vehicle or liraglutide (200 μg / kg / day) for 14 consecutive days. The mice were then monitored for 48 days during the off-treatment period. The effects on a) oxygen consumption, b) energy expenditure, c) fat and carbohydrate utilization, and d) ambulatory activity were assessed during the off-treatment period. Results are mean ± SEM. One-way ANOVA with Tukey's multiple comparison test and repeated measures and Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0043] Figure 24In diet-induced obesity and T2D, therapeutic inhibition of brain neurofibrosis enhances the effects of GLP-1R agonists on hypophagia. C57BL / 6J mice fed a HFHS diet and age-matched chow diet were administered ICV with vehicle or PZ6005 (100 μg / animal) every other day for 12 weeks. During the treatment period, mice were injected subcutaneously with vehicle or liraglutide (200 μg / kg / day) for 14 consecutive days. Mice were then monitored for 48 days during the off-treatment period. a) Effects on 24-hour food intake were assessed during the treatment and off-treatment periods. Seven days after the treatment period, mice fasted overnight were allowed ad libitum access to food. b, c) Mouse behavior (eating, drinking, grooming, active, inactive, and resting) was assessed every 30 seconds for 90 minutes, and data were collected into 5-minute statistical stacks and displayed as a percentage of total behavior. d, e) Transition times from eating to rest / satiety were assessed over the 90-minute period. In panel d), the time point at which feeding behavior shifted primarily to resting behavior is depicted by the dashed line. Results are mean ± SEM. Statistical analysis was performed using one-way ANOVA with Tukey's multiple comparison test in a and e) and repeated measures and Statistical significance was determined by two-way ANOVA with multiple comparison test.
[0044] Figure 25 In diet-induced obesity and T2D, therapeutic inhibition of brain neurofibrosis prolongs the rebound effect of GLP-1R agonists on improved glycemic control. C57BL / 6J mice fed a HFHS diet for 12 weeks and age-matched chow diets were administered intravenously (ICV) with vehicle or PZ6005 (100 μg / animal) every other day. During the treatment period, mice were also injected subcutaneously with vehicle or liraglutide (200 μg / kg / day) for 14 consecutive days. Mice were then monitored for 48 days during the off-treatment period. a, b, c) Effects on glucose tolerance were assessed during the treatment and off-treatment periods following a glucose bolus (2 mg / g lean body weight, IP). d) Insulin tolerance was assessed after weight rebound to 100% of previous body weight following an insulin bolus (0.8 mU / g body weight for HFF mice and 0.6 mU / g body weight for chow-fed mice). e) Effects on 24-hour fasting blood glucose levels were determined after 65 days of the experiment. Results are mean ± SEM. Statistical significance was determined using one-way ANOVA with Tukey's multiple comparison test in a, b, c, d, e).
[0045] definition
[0046] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0047] As used herein, the terms "composition" and "formulation" are used interchangeably and have the same meaning.
[0048] As used herein, the indefinite articles "a," "an," and "the" include plural aspects unless otherwise indicated. Thus, for example, reference to "an agent" includes a single agent as well as two or more agents; reference to "the composition" or "the formulation" includes a single composition or formulation as well as two or more compositions or formulations; and so forth.
[0049] As used herein, the term "about" means ± 10% of the recited value.
[0050] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0051] The term "consisting of means "consisting only of," that is, including and limited to an integer or step or group of integers or steps, and excluding any integer or step or group of integers or steps.
[0052] The term "consisting essentially of" means including the recited integers or steps or groups of integers or steps, but may also include other integers or steps or groups of integers or steps that do not materially change or contribute to the working of the invention.
[0053] The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge.
[0054] Additional definitions are provided throughout this specification. DETAILED DESCRIPTION
[0055] The present invention relates to a pharmaceutical composition comprising a 4-epimerase inhibitor and a GLP-1R agonist. Such a composition may be suitable for treating or preventing insulin resistance and related conditions, such as type 2 diabetes and obesity. The inventors have identified neurofibrosis in the arcuate nucleus (ARC) of the hypothalamus as a novel disease mechanism behind the development of central insulin resistance and metabolic diseases, and administration of a 4-epimerase inhibitor can reduce or prevent neurofibrosis in the ARC. The inventors have now shown that therapeutic reduction of ARC neurofibrosis can enhance GLP-1R agonist activity. For example, the use of a 4-epimerase inhibitor in combination with a GLP-1R agonist can enhance energy and glucose metabolism mediated by the GLP-1R agonist. Therefore, a 4-epimerase inhibitor and a GLP-1R agonist may be suitable for combination to treat or prevent insulin resistance and related conditions, particularly type 2 diabetes and obesity, suppress appetite and / or promote weight loss. The terms "type-2 diabetes mellitus," "type-2 diabetes," and "T2D" are used interchangeably herein and have the same meaning.
[0056] Excessive deposition and remodeling of the extracellular matrix (ECM) promote fibrosis and are established disease mechanisms of insulin resistance in muscle, fat, and liver tissue. However, both insulin resistance and fibrosis are traditionally viewed as phenomena centered on peripheral tissues, and the incidence and relevance of the ECM in the brain to the development of metabolic diseases have not been explored previously. A different type of ECM has recently been described in the ARC of humans and mice (Alonge et al., 2020; Mirzadeh et al., 2019), which is composed of specialized perisynaptic aggregates of hyaluronic acid, chondroitin sulfate proteoglycans (CSPGs), and chondroitin sulfate glycosaminoglycan side chains. The present inventors have identified that the CSPG-ECM in ARC is a unique multicellular aggregate that is concentrated at the proximal end of the median eminence (ME), providing extracellular connections between nerves and the peripheral endocrine system. Thus, the CSPG-ECM provides an interface connecting circulating metabolic hormones entering the ARC with metabolism-related ARC neurons, such as agouti-related peptide neurons (AgRP) and pro-opiomelanocortin (POMC) neurons.
[0057] The present inventors have identified that the development of insulin resistance and related conditions (such as obesity and type 2 diabetes) is emphasized by the remodeling of CSPG-ECM at both the component and glycosaminoglycan levels, which represents a previously unidentified characteristic of insulin resistance and related conditions, a phenomenon known as "neurofibrosis". Neurofibrosis in the ARC hinders the permeability of circulating insulin, which can cause neuronal insulin resistance. The remodeling of CSPG components, including changes in the sulfation pattern of chondroitin sulfate glycosaminoglycans (CS-GAGs), may be mediated by elevated CS-0S, CS-4S, and CS-2S6S sulfation, which promotes a rigid CSPG-ECM structure that isolates extracellular diffusion. CS-4S sulfation drives the activity of chondroitin sulfate N-acetylgalactosaminyltransferase-1 (CS-GalNAcT-1), which in turn promotes the expression of aggrecan, a key CSPG species behind the neurofibrosis in the ARC. CSPG-ECM remodeling, which underlies neurofibrosis, occurs specifically around AgRP neurons, which are key regulators of metabolism and essential for survival. Impairments in ARC insulin signaling may contribute to the development of obesity and diabetes through enhanced feeding behavior, impaired energy expenditure, and defective glucose metabolism.
[0058] 4-epimerase (also known as UDP-galactose 4-epimerase) is an essential enzyme for producing the nucleotide sugar substrate UDP-N-acetylgalactosamine, which is required for the assembly and elongation of CS-GAG chains on CSPG and is a core feature of neurofibrosis in the ARC. Therefore, the present inventors hypothesized that 4-epimerase inhibitors could reduce or prevent neurofibrosis in the ARC, representing a novel treatment for insulin resistance and related conditions. As a non-limiting example, the present inventors have demonstrated that fluramide (1; Ac-4-F-GlcNAc) is a fluorinated N-acetyl-D-glucosamine analog previously identified as inhibiting chondroitin sulfate proteoglycan (CSPG) synthesis (Keough et al., 2016; Stephenson et al., 2019), preferentially attenuating CSPG-ECM in the ARC. This effect may be mediated by the relatively rapid CSPG-ECM turnover rate within the ARC, which enhances the functional efficacy of fluramide in the ARC, while the degradation rate in other brain regions is slower. Because CSPG-ECM expression is virtually absent in the amygdala, orbitofrontal cortex, and ventral striatum, targeting the brain ECM may limit off-target effects in depression and anxiety, undermining previous attempts to pharmacologically target the brain for the treatment of metabolic diseases.
[0059] The present inventors have also found that attenuation of ARC neurofibrosis (e.g., using 4-epimerase inhibitors) can enhance GLP-1 receptor (GLP-1R) agonist activity. GLP-1, as an incretin hormone, is primarily secreted and released by enteroendocrine L cells in the distal small intestine and colon. GLP-1 acts as a metabolic support for insulin because it promotes the insulin secretion response and inhibits glucagon secretion to maintain glucose homeostasis. GLP-1 is also responsible for enhancing cell survival and triggering the proliferation and differentiation of beta cells. The effect of GLP-1R agonists (including co-agonists such as GIP / GLP-1 and glucagon / GIP / GLP-1 agonists) in promoting the alleviation of metabolic diseases such as obesity and type 2 diabetes depends on the effects of these compounds within the ARC. The present inventors have found that the development of neurofibrosis in the ARC hinders the penetration, bioavailability and / or signaling of various GLP-1R agonists and insulin into the brain, and that the combination of a 4-epimerase inhibitor and a GLP-1R agonist can improve the penetration, bioavailability and / or signaling of GLP-1 receptor agonists and insulin. Since GLP-1R agonists cross the blood-brain barrier through the same mechanism as GLP-1 co-agonists (such as GIP / GLP-1 receptor agonists and triple glucagon / GIP / GLP-1 receptor agonists), 4-epimerase treatment is also likely to enhance or improve the activity (e.g., penetration, bioavailability and / or signaling) of GLP-1 co-agonists. In some embodiments, the activity of a GLP-1R agonist (or co-agonist) is synergistically enhanced when combined with a 4-epimerase inhibitor.
[0060] The 4-epimerase inhibitor used in the combinations disclosed herein can be any known 4-epimerase inhibitor, including but not limited to fluorinated N-acetyl-glucosamine derivatives, such as fluoroamine (1). Stephenson et al., 2019 previously identified that the most effective fluorinated N-acetyl-glucosamine derivatives in reducing the chondroitin sulfate GAG stub attached to the core protein had substitutions only on the anomeric carbon (C-1), such as hydroxyl, O-acetyl or O-propionyl, and at least one fluorine at C-4. Therefore, as used herein, the term fluorinated N-acetyl-glucosamine "derivative" can specifically refer to a fluorinated N-acetyl-glucosamine derivative having substitutions at C-1, such as hydroxyl, O-acetyl or O-propionyl. 1-4 Alkyl (preferably hydroxy, O-acetyl or O-propionyl) substitution, and N-acetyl-glucosamine (preferably N-acetyl-D-glucosamine) core structure substituted with one or two fluoro groups at C-4. Stephenson et al., 2019 also identified that it may be advantageous to include removable acyl protecting groups at O4 and O6.
[0061] Therefore, in one or more embodiments, the 4-epimerase inhibitor suitable for use in the present invention is a compound of formula (I):
[0062]
[0063] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof,
[0064] in:
[0065] R 1 、R 3 and R 5 independently selected from H or C(O)C 1-4 alkyl; and
[0066] R 4 and R 4' are independently selected from H and fluorine, wherein R 4 and R 4' At least one of them is fluorine.
[0067] As used herein, the term "alkyl" refers to monovalent ("alkyl") and divalent ("alkylene") straight or branched chain saturated aliphatic groups. Alkyl groups can have 1 to 4 carbon atoms, represented by C 1-4 Alkyl, or it may have 1 to 3 carbon atoms, represented by C 1-3 Alkyl, or it may have 1 to 2 carbon atoms, represented by C 1-2 Examples of suitable alkyl groups may include, but are not limited to, methyl, ethyl, 1-propyl, isopropyl, 1-butyl, 2-butyl, isobutyl, sec-butyl, and tert-butyl.
[0068] It should be recognized that the fluorinated N-acetyl-glucosamine derivatives disclosed herein (or other 4-epimerase inhibitors) may have asymmetric centers and are therefore capable of existing in more than one stereoisomeric form. Therefore, 4-epimerase inhibitors (such as the fluorinated N-acetyl-glucosamine derivatives disclosed herein) may exist as a single stereoisomer, a racemate and / or a mixture of enantiomers and / or diastereomers. Therefore, unless otherwise indicated, the fluorinated N-acetyl-glucosamine derivatives mentioned herein include their stereoisomers. As used herein, the term "stereoisomer" refers to any two or more isomers having the same molecular constitution and differing only in the three-dimensional arrangement of their atomic groups in space. Stereoisomers can be diastereomers or enantiomers. In some embodiments, the fluorinated N-acetyl-glucosamine derivatives disclosed herein can be in the form of a substantially pure isomer at one or more asymmetric centers (e.g., greater than about 90% ee, 95% ee, 97% ee, or 99% ee) or mixtures thereof, including racemic mixtures.
[0069] Preferably, the fluorinated N-acetyl-glucosamine derivative is an N-acetyl-D-glucosamine derivative compound of formula (IA):
[0070]
[0071] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof,
[0072] in:
[0073] R 1 、R 3 and R 5 independently selected from H or C(O)C 1-4 alkyl; and
[0074] R 4 and R 4' are independently selected from H and fluorine, wherein R 4 and R 4' At least one of them is fluorine.
[0075] In preferred embodiments of the compounds of formula (I) and formula (IA), R 1 、R 3 and R 5 independently selected from H or C(O)C 1-3 Alkyl, more preferably, R 1 、R 3 and R 5 are independently selected from H or H or C(O)C 1-2 alkyl.
[0076] In preferred embodiments of the compounds of formula (I) and formula (IA), R 1 is H or C(O)C 1-2 Alkyl, and R 3 and R 5 Both are acyl groups.
[0077] In preferred embodiments of the compounds of formula (I) and formula (IA), R 1 、R 3 and R 5 Each is an acyl group.
[0078] In preferred embodiments of the compounds of formula (I) and formula (IA), R 4 is fluorine and R 4' Is H, or R 4 is H and R 4' is fluorine, or R 4 and R 4' Both.
[0079] In one or more preferred embodiments, the compound of formula (IA) is selected from:
[0080]
[0081] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.
[0082] In a preferred embodiment, the compound of formula (IA) is:
[0083]
[0084] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.
[0085] Suitable methods for preparing fluorinated N-acetyl-glucosamine derivatives are described in Keough et al., 2016 and Stephenson et al., 2019. Other methods for preparing N-acetyl-glucosamine derivatives will be apparent to those skilled in the art.
[0086] Other 4-epimerase inhibitors that may be suitable for use in the present invention have been previously described, for example, the xyloside Ac-bXyl-TEG (2) described by Stephenson et al., 2019, and aminooxy and hydrazide functionalized uridine derivatives described by Winans and Bertozzi, 2002.
[0087] Thus, in one embodiment, the 4-epimerase inhibitor is:
[0088]
[0089] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.
[0090] In another embodiment, the 4-epimerase inhibitor is a compound of formula (II), formula (III), or formula (IV):
[0091]
[0092] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof, wherein:
[0093] R 6 Selected from:
[0094]
[0095] R 7 Selected from:
[0096] And R 8 Selected from:
[0097]
[0098]
[0099]
[0100] The combination of the present invention further comprises a GLP-1 receptor (GLP-1R) agonist (also referred to as a "GLP-1 agonist"). The GLP-1R agonist used in the combination of the present invention can be any GLP-1R agonist, including GLP-1 or an analog thereof. It should be understood that such analogs are limited to those that maintain (at least partially) the ability to agonize the GLP-1R. There are many suitable GLP-1 analogs currently available on the market, including liraglutide (Saxenda TM 、Voctoza TM ), dulaglutide, Trulicity TM ), exenatide (Bydureon TM Byetta TM ), semaglutide (Ozempic TM ) and lixisenatide (Lixumia TM 、Adlyxin TM ) and the like. In a specific embodiment, the GLP-1R agonist is liraglutide. However, it should be understood that GLP-1R agonists may include chemical compounds (e.g., small molecules) and biological compounds (e.g., peptides, including recombinant fusion proteins and synthetic peptides), which may or may not be commercially available. Other non-limiting examples of GLP-1R agonists can be found in WO 98 / 08873, WO 2016 / 097108, WO 2021 / 187886, WO 2021 / 160127, the entire contents of each of which are incorporated herein by cross-reference. Those skilled in the art will know other suitable GLP-1R agonists (including GLP-1 and its analogs) and processes for their preparation.
[0101] The term GLP-1R agonist is intended to encompass GLP-1R co-agonists (also referred to as "GLP-1 co-agonists"), including dual agonists, tri-agonists, and the like. Examples of suitable co-agonists may include, but are not limited to, GIP / GLP-1 co-agonist / glucagon / GLP-1 co-agonist and glucagon / GIP / GLP-1 co-agonist. In one embodiment, the GLP-1 agonist is a GIP / GLP-1 co-agonist. Examples of commercially available GIP / GLP-1 co-agonists that may be suitable for use in the present invention are tirzepatide (Mounjaro TM ). Other non-limiting examples of GIP / GLP-1 co-agonists are described in WO 2011 / 119657, WO 2016 / 111971, WO 2013 / 164483, WO 2014 / 192284 and WO 2015 / 086729, the entire contents of each of which are incorporated herein by cross-reference. In another embodiment, the GLP-1 agonist is a glucagon / GLP-1 co-agonist. Non-limiting examples of GLP-1 / glucagon co-agonists are described in WO 2008 / 101017 and WO 2017 / 100107, the entire contents of each of which are incorporated herein by cross-reference. In another embodiment, the GLP-1 agonist is a glucagon / GIP / GLP-1 co-agonist. An example of a glucagon / GIP / GLP-1 co-agonist currently in Phase I clinical trials is LY3437943 (Coskun et al., 2022). Other GLP-1 co-agonists are also contemplated by the present invention.
[0102] It should be understood that the present invention is not intended to be limited to the specific 4-epimerase inhibitors and / or GLP-1R agonists described herein. Given the mechanism underlying the present invention as discovered by the present inventors, it is contemplated that any compound that inhibits 4-epimerase may be suitable for use in the combinations of the present invention. Similarly, it is contemplated that any agonist of the GLP-1 receptor may also be suitable for use in the combinations of the present invention. Preferably, the 4-epimerase inhibitor and GLP-1R agonist are pharmaceutically acceptable compounds. One skilled in the art can readily determine the ability of a compound to inhibit 4-epimerase, for example, using Western blots of chondroitin-4-sulfate stubs attached to core protein as described by Keough et al., 2016 and Stephenson et al., 2019, or a coupled enzyme system with spectrophotometric readout as described by Winans and Bertozzi, 2002. One skilled in the art can readily determine the ability of a compound to agonize GLP-1R, for example, using GLP-1 and GIP receptor binding assays or receptor internalization assays.
[0103] It will be understood that according to the present invention, the 4-epimerase inhibitors (including fluoroamine and other fluorinated N-acetyl-glucosamine derivatives as disclosed herein) and / or GLP-1R agonists may be provided as pharmaceutical salts, hydrates or solvates. The term "pharmaceutically acceptable salts" includes pharmaceutically acceptable solvates and hydrates, as well as pharmaceutically acceptable addition salts of the 4-epimerase inhibitors and / or GLP-1R agonists (as the case may be). The term "solvate" includes a molecular complex comprising a 4-epimerase inhibitor, a GLP-1R agonist and one or more pharmaceutically acceptable solvent molecules, for example, ethanol. When the solvent is water, the term "hydrate" is used. It is also contemplated that the combinations of the present invention may be suitable for treating or preventing insulin resistance and related conditions in animals. Thus, the term "pharmaceutically acceptable salts" is also intended to include veterinarily acceptable solvates and hydrates, and veterinarily acceptable addition salts of 4-epimerase inhibitors, including fluorinated N-acetyl-glucosamine derivatives as disclosed herein, and / or GLP-1R agonists.
[0104] In some embodiments, pharmaceutically acceptable salts may include acid addition salts and quaternary ammonium salts. Pharmaceutically acceptable salts involve including another molecule in the parent compound (i.e., 4-epimerase inhibitor or GLP-1R agonist), such as chloride ion, acetate ion, sulfate ion or other counterion. The counterion can be any organic or inorganic part that stabilizes the charge on the parent compound. In addition, a pharmaceutically acceptable salt may have more than one charged atom in its structure. When there are multiple charged atoms in the parent compound, its pharmaceutically acceptable salt will have multiple counterions, and these counterions may be several cases of the same counterion or different counterions. Therefore, a pharmaceutically acceptable salt may have one or more charged atoms and / or one or more counterions in the parent compound.
[0105] Acid addition salts suitable for use in the present invention can be formed from 4-epimerase inhibitors and / or GLP-1R agonists and pharmaceutically acceptable inorganic or organic acids, including but not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, acetic acid, propionic acid, ascorbic acid, citric acid, malonic acid, fumaric acid, maleic acid, lactic acid, salicylic acid, sulfamic acid, or tartaric acid. Counterions for quaternary amines include chloride, bromide, iodide, sulfate, phosphate, methanesulfonate, citrate, acetate, malonate, fumarate, sulfamate, and tartrate. In addition, basic nitrogen-containing groups can be quaternized with agents such as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dialkyl sulfates, such as dimethyl sulfate and diethyl sulfate; and others. The preparation of the pharmaceutically acceptable salts described above and other typical pharmaceutically acceptable salts is more fully described in Berge et al., "Pharmaceutical Salts," J. Pharm. Sci., 1977: 66: 1-19.
[0106] In some embodiments, according to the present invention, a salt of a 4-epimerase inhibitor and / or a GLP-1R agonist can be prepared from the free form of the compound in a separate synthetic step prior to incorporation into a formulation for administration to a subject. In still other embodiments, a salt of a 4-epimerase inhibitor and / or a GLP-1R agonist can be prepared in situ during the preparation of the formulation for administration. For example, the formulation for administration can further comprise a suitable acid that, upon contact with the free form of the 4-epimerase inhibitor and / or GLP-1R agonist, forms the desired pharmaceutical salt for administration in situ.
[0107] In addition, those skilled in the art will recognize that the 4-epimerase inhibitor and / or GLP-1R agonist can be provided in crystalline form, as a free compound or as a solvate (e.g., a hydrate), and both forms are intended to be within the scope of the present invention. Solvation methods are generally known in the art.
[0108] The present invention also contemplates the use of pharmaceutically acceptable prodrugs of 4-epimerase inhibitors and / or GLP-1R agonists for the treatment or prevention of insulin resistance and related conditions. For example, 4-epimerase and / or GLP-1R agonist inhibitors can be provided in the form of prodrugs that, upon administration to a subject, can (directly or indirectly) provide the desired 4-epimerase inhibitor, or its active metabolite or residue. The term "prodrug" is used in its broadest sense and encompasses those derivatives that are converted into active agents in vivo. Such prodrugs will readily occur to those skilled in the art.
[0109] As previously described, the present invention encompasses the use of 4-epimerase inhibitors (e.g., fluorinated N-acetyl-glucosamine derivatives) and / or GLP-1R agonists as free base forms or as pharmaceutically salts or solvates thereof for the treatment of insulin resistance or related conditions (e.g., metabolic diseases). When reference is made herein to a specific dose or concentration of a 4-epimerase inhibitor and / or GLP-1R agonist, it is understood that the specific dose or dosage refers to the concentration or equivalent of the free base of the 4-epimerase inhibitor and / or GLP-1R agonist. Thus, when a pharmaceutically acceptable salt of a 4-epimerase inhibitor and / or GLP-1R agonist is used, one skilled in the art will readily understand that the concentration or dosage of the salt refers to the equivalent concentration or dosage of the free base form of the 4-epimerase inhibitor.
[0110] According to the present invention, the 4-epimerase inhibitor and / or GLP-1R agonist or a pharmaceutically acceptable salt thereof may be administered together with one or more pharmaceutically acceptable carriers, diluents, adjuvants and / or excipients. When carriers, diluents, adjuvants and / or excipients are used, they must be "pharmaceutically acceptable", i.e., compatible with the other ingredients of the composition and not harmful to the subject. Such pharmaceutically acceptable carriers, diluents, adjuvants or excipients will be apparent to those skilled in the art and may depend on the intended mode of administration. For example, the carrier, diluent, adjuvant or excipient may vary depending on the formulation and / or mode of administration. In some embodiments, the 4-epimerase inhibitor and / or GLP-1R agonist may be provided in the form of a sustained release formulation.
[0111] In particular, suitable formulations of GLP-1R agonists, in particular commercially available GLP-1 analogs such as liraglutide, dulaglutide, exenatide, semaglutide and lixisenatide, will be known to those skilled in the art. Thus, in some embodiments, the combination of the present invention may comprise a GLP-1 agonist in its commercial formulation.
[0112] The combinations disclosed herein may comprise a 4-epimerase inhibitor and a GLP-1R agonist in one or more pharmaceutical compositions. For example, the 4-epimerase inhibitor and the GLP-1R agonist may be co-formulated in the same pharmaceutical composition, or they may each be formulated in a separate pharmaceutical composition. The pharmaceutical compositions comprising a 4-epimerase inhibitor and / or a GLP-1R agonist for use in the present invention may be prepared by any method known in the art of pharmacology. Typically, such preparation methods comprise the steps of associating the 4-epimerase inhibitor and / or the GLP-1R agonist with one or more carriers, diluents, adjuvants, excipients or other auxiliary ingredients, and then, if necessary and / or desired, forming and / or packaging the product into desired single or multiple dose units. In certain embodiments, the unit dose compositions are those containing a daily dose or unit, daily subdose (as described herein) or an appropriate fraction thereof of a 4-epimerase inhibitor and / or a GLP-1R agonist. In some embodiments, the 4-epimerase inhibitor and the GLP-1R agonist can be provided in a single unit dose (i.e., as a pharmaceutical composition), or they can be provided in two or more separate unit doses, which can be used for simultaneous, separate, or sequential administration. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient. The amount of the active ingredient (i.e., the 4-epimerase inhibitor or the GLP-1R agonist) is generally equal to the dose of the active ingredient to be administered to a subject and / or a convenient fraction of such a dose, for example, one-half or one-third of such a dose.
[0113] In preferred embodiments, the 4-epimerase inhibitor can be formulated for intranasal administration. In some embodiments, the intranasal formulation can be prepared as a pharmaceutically acceptable emulsion, microemulsion, solution, or suspension. Specifically, the 4-epimerase inhibitor can be prepared as an aqueous solution or suspension. When the 4-epimerase inhibitor formulation is an aqueous solution or suspension, the formulation can contain water in an amount greater than 50% by weight of the total composition, preferably greater than about 60% by weight of the total composition, more preferably greater than about 70% by weight of the total composition, and even more preferably greater than about 80% by weight of the total composition. In still other embodiments, when the formulation disclosed herein is an aqueous solution or suspension, water can comprise from about 80% to about 99% by weight of the total composition, more preferably from about 85% to about 98% by weight of the total composition.
[0114] The intranasal compositions disclosed herein may further comprise a pharmaceutically acceptable cosolvent. Suitable cosolvents may include, but are not limited to, alcohols, polyvinyl alcohol, propylene glycol, polyethylene glycol and derivatives thereof, glycerol, sorbitol, polysorbate, ethanol and mixtures thereof. Specifically, the cosolvent may be selected from glycerol, propylene glycol and mixtures thereof. In still other embodiments, the cosolvent may comprise from about 1% to about 60% by volume of the total composition, preferably from about 2% to about 50% by volume of the total composition, more preferably from about 3% to about 40% by volume of the total composition, and even more preferably from about 5% to about 35% by volume of the total composition.
[0115] Intranasal formulations described herein may include a thickener. The use of a thickener can provide improved adhesion of the formulation to the nasal mucosa without adversely affecting the convenience of application, particularly when used as an intranasal spray. In addition, a thickener can advantageously improve the nasal absorption of the active agent, increase the residence time of the formulation on the nasal mucosa and / or reduce the loss of the formulation through the mucociliary clearance of the nasal passages. Therefore, using a thickener can advantageously provide enhanced bioavailability and / or sustained release of the desired active agent. Thickeners suitable for use in the present invention can be any pharmaceutically acceptable nasal mucosa tolerance thickener known to those skilled in the art. A thickener can advantageously contribute to the controlled release of the active ingredient on the mucosa. Suitable thickeners for the present invention include methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, polyacrylic acid polymers, polyhydroxyethyl methacrylate, polyethylene oxide, polyvinyl pyrrolidone, polyvinyl alcohol, tragacanth gum, sodium alginate, karaya gum, guar gum, xanthan gum, lectin, soluble starch, gelatin, pectin and chitosan. The amount of the thickener required for proper balance between the adhesion of the composite to the nasal mucosa and the sprayability of the composite may be different because of the thickener properties. The amount of the specific thickener required for realizing this balance can be determined by those skilled in the art. For example, thickener can account for approximately 0.1 % by weight to approximately 2 % by weight, approximately 0.25 % by weight to approximately 1.5 % by weight or approximately 0.5 % by weight to approximately 1 % by weight of the total composition.
[0116] In some embodiments, the intranasal formulations suitable for use in the present invention may include one or more of the following: pH adjusters, sensory agents, antioxidants, surfactants, binders, stabilizers, osmotic pressure regulators, preservatives, penetration enhancers, chelating agents, sweeteners, flavorings, taste masking agents, colorants. Some agents or components of the intranasal formulations may have more than one function. For example, when ethanol is used as a sensory agent in the formulations disclosed herein, it may further serve as a penetration enhancer and / or cosolvent.
[0117] Suitable additives for intranasal formulations and their amounts will be apparent to those skilled in the art. For example, suitable sensory agents may include C2 to C4 alcohols (such as ethanol or isopropyl alcohol), menthol, terpenes, thymol, camphor, capsicum, phenol, fennel, menthol glucuronide, eucalyptus oil, benzyl alcohol, salicylic alcohol, clove oil, mint, spearmint, peppermint, eucalyptus, lavender, citrus, lemon, lime, hexylresorcinol, ketals, glycols, and mixtures thereof. Examples of suitable preservatives may include benzalkonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzyl alcohol, sodium benzoate, phenylethyl alcohol, and benzethonium.
[0118] The GLP-1R agonist can be co-formulated with the 4-epimerase inhibitor (e.g., for intranasal administration), or can be formulated into a separate dosage form. Suitable formulations of the GLP-1R agonist will be known to those skilled in the art. Specifically, commercially available GLP-1R agonists can be formulated according to product information and / or manufacturer's specifications, typically in a dosage form different from that of the 4-epimerase inhibitor. In some embodiments, the GLP-1 agonist is formulated for parenteral administration, for example, by subcutaneous injection, intravenous injection, intraperitoneal injection, intramuscular injection, intrasternal injection, or infusion. Injectable formulations (i.e., sterile injectable aqueous suspensions or oily suspensions) can be formulated according to known techniques using, for example, suitable dispersants, wetting agents, and / or suspending agents.
[0119] General considerations in the formulation and / or preparation of pharmaceutical compositions can be found, for example, in Remington's Pharmaceutical Sciences, 16th ed., E.W. Martin (Mack Publishing Co., Easton, Pa., 1980) and Remington: The Science and Practice of Pharmacy, 21st ed. (Lippincott Williams & Wilkins, 2005).
[0120] Therapeutic uses
[0121] The present inventors have discovered that 4-epimerase inhibitors can reduce or prevent neurofibrosis in the ARC, thereby treating or preventing insulin resistance and related conditions. In addition, the present inventors have discovered that by reducing or preventing ARC neurofibrosis, 4-epimerase inhibitors can enhance (e.g., synergistically enhance) the effects of GLP-1R agonists (known to be suitable for treating or preventing insulin resistance and related conditions). Therefore, the combination of 4-epimerase inhibitors and GLP-1R agonists may be particularly suitable for treating or preventing insulin resistance and related conditions, as well as any other indications for which GLP-1R agonists are known to be suitable, such as suppressing appetite and / or promoting weight loss. In some embodiments, administering a 4-epimerase inhibitor in combination with a GLP-1R agonist can prolong the effects of the GLP-1R agonist. For example, the present inventors have demonstrated that the beneficial effects of a GLP-1 analog (e.g., liraglutide) on both type 2 diabetes and weight loss may be prolonged when co-administered with a 4-epimerase inhibitor (e.g., fluoxetine).
[0122] In the context of the present invention, conditions associated with insulin resistance can include conditions that are at least partially caused by insulin resistance (e.g., type 2 diabetes), as well as conditions that themselves at least partially cause or exacerbate insulin resistance (e.g., obesity). Such conditions can include, but are not limited to, prediabetes, type 2 diabetes, obesity, metabolic syndrome, hypertension, dyslipidemia, atherosclerosis, non-alcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), coagulopathy, and obstructive sleep apnea.
[0123] Appetite and / or weight gain may be associated with insulin resistance or a related condition, or it may be associated with insulin dysregulation (e.g., as a precursor or risk factor for insulin resistance or a related condition). Thus, the combinations disclosed herein may be particularly suitable for suppressing appetite and / or promoting weight loss associated with insulin dysregulation.
[0124] In one embodiment, the combinations disclosed herein may be particularly useful for treating or preventing obesity, suppressing appetite, and / or promoting weight loss.
[0125] According to the present invention, a 4-epimerase inhibitor and a GLP-1R agonist can be administered in combination to a subject in need of treatment (e.g., for insulin resistance or related conditions, to suppress appetite, or to promote weight loss), or it can be administered prophylactically. In particular, it will be apparent that the methods of the present invention can be used prophylactically, as well as for alleviating the symptoms of insulin resistance or related conditions. Therefore, references to "treatment" and the like herein can include such prophylactic treatments, as well as therapeutic treatments of acute conditions or symptoms. Therefore, in one or more embodiments, the present invention provides a 4-epimerase inhibitor in combination with a GLP-1R agonist for the therapeutic treatment of insulin resistance or related conditions to suppress appetite and / or promote weight loss. In other embodiments, the present invention provides a 4-epimerase inhibitor in combination with a GLP-1R agonist for the prophylactic treatment of insulin resistance or related conditions to suppress appetite and / or promote weight loss.
[0126] Thus, the present invention relates to a method of treating or preventing insulin resistance or a related disorder in a subject, comprising administering to the subject an effective amount of a 4-epimerase inhibitor in combination with a GLP-1R agonist.
[0127] The present invention also relates to a method of suppressing appetite and / or promoting weight loss in a subject, comprising administering to the subject an effective amount of a combination of a 4-epimerase inhibitor and a GLP-1R agonist.
[0128] The present invention also relates to the use of a 4-epimerase inhibitor and a GLP-1R agonist for preparing one or more medicaments for treating or preventing insulin resistance or related disorders, suppressing appetite and / or promoting weight loss in a subject.
[0129] The present invention also relates to the use of a 4-epimerase inhibitor for preparing a medicament for treating or preventing insulin resistance or related disorders, suppressing appetite and / or promoting weight loss in a subject in combination with a GLP-1R agonist.
[0130] The present invention further relates to a combination comprising a 4-epimerase inhibitor and a GLP-1R agonist for use in treating or preventing insulin resistance or a related disorder, suppressing appetite and / or promoting weight loss in a subject.
[0131] The terms "treat," "treating," or "treatment," with respect to a condition, including a disease or condition as described herein, refer to reducing or eliminating the cause and / or effects of a condition. As used herein, the terms "treat," "treatment," and "treating" refer to a decrease in the progression, severity, and / or duration of a condition, or an improvement in one or more symptoms (e.g., one or more discernible symptoms) of a condition (i.e., "managing" a condition without "curing" the condition) caused by the administration of one or more therapies (e.g., one or more therapeutic agents, such as the 4-epimerase inhibitors disclosed herein). In specific embodiments, the terms "treat," "treatment," and "treating" refer to improving at least one measurable physical parameter of a condition described herein, such as insulin resistance or a related disorder. In other embodiments, the terms "treat," "treatment," and "treating" refer to inhibiting the progression of a condition described herein physically, for example, by stabilizing a discernible symptom, or physiologically, for example, by stabilizing a physical parameter, or both.
[0132] As used herein, the terms "prevent" and "prevent" refer to the preemptive administration of a drug to avoid or prevent the appearance of one or more symptoms of a condition. One of ordinary skill in the medical field recognizes that the term "prevent" is not an absolute term. In the medical field, it is understood to refer to the preventive administration of a drug to substantially reduce the likelihood or severity of a condition or symptom of a condition, and this is the intended meaning of the present disclosure. In the standard text in this field, the Physician's Desk Reference, the terms "prevent," "preventing," and "prevention" in relation to a condition refer to avoiding the cause, effect, symptom, or progression of a condition before the condition fully manifests.
[0133] In some embodiments, the subject in need of treatment or prevention of insulin resistance or related conditions is a mammal. As used herein, the term "mammal" includes humans, primates, livestock animals (e.g., horses, cattle, sheep, pigs, donkeys), laboratory test animals (e.g., mice, rats, guinea pigs), companion animals (e.g., dogs, cats), and captive wild animals (e.g., kangaroos, deer, foxes). Preferably, the mammal is a human.
[0134] According to the present invention, the combination disclosed herein is administered to a subject in need thereof in a therapeutically effective amount. In some embodiments, a therapeutically effective amount is a therapeutically effective amount or a preventive and therapeutically effective amount. As used herein, the term "therapeutically effective amount" means an amount of a 4-epimerase inhibitor and a GLP-1R agonist sufficient to treat or alleviate the symptoms associated with insulin resistance or related conditions, to suppress appetite and / or promote weight loss. The therapeutically effective amount of the compound to be administered will be determined by such considerations and is the incremental maximum tolerated dose or minimum amount required to improve, cure or treat one or more symptoms of the condition or its symptoms. The term "preventive and therapeutically effective amount" refers to an amount that effectively prevents or significantly reduces the chance of developing a disease or condition, or reduces its severity before developing a disease or condition, or reduces the severity of one or more symptoms of its symptoms before the symptoms develop. Typically, preventive and therapeutic measures can be divided into primary prevention and treatment (preventing the development of a disease or symptom) and secondary prevention and treatment (whereby the disease or symptom has developed and the patient is protected from the effects of this process worsening).
[0135] As used herein, the term "effective amount" refers to an amount of a 4-epimerase inhibitor and a GLP-1R agonist that, when administered in combination according to a desired dosing regimen, provides the desired therapeutic activity. For example, an effective amount of a 4-epimerase inhibitor and a GLP-1R agonist can be an amount or amounts that, when administered in combination, is sufficient to inhibit, slow, interrupt, stop, prevent, or stop insulin resistance. A suitable effective amount may depend on the patient's age, sex, weight, and general health, and can be determined by the attending physician. A suitable dose of each active agent (i.e., a 4-epimerase inhibitor and a GLP-1R agonist) or a combination thereof can be in the range of about 0.1 ng / kg body weight to 100 g / kg body weight per dose. The dose can be in the range of 1 μg / kg body weight to 10 g / kg body weight per dose, such as in the range of 1 mg / kg body weight to 1000 mg / kg body weight per dose. In one embodiment, the dose can be in the range of 1 mg / kg body weight to 500 mg / kg body weight per dose. In another embodiment, the dosage may be in the range of 1 mg / kg to 250 mg / kg body weight per dose. In yet another embodiment, the dosage may be in the range of 1 mg / kg to 200 mg / kg body weight per dose, such as up to 50 mg / kg body weight per dose.
[0136] The terms "administer," "administering," or "administration" with reference to the combinations disclosed herein or components thereof, means introducing the active agents (i.e., the 4-epimerase inhibitor and the GLP-1R agonist) into the system of a subject in need of treatment. Administration of the combinations provided herein is understood to include simultaneous, separate, or sequential administration of the active agents.
[0137] As used herein, the terms "combination" or "co-administration" are used interchangeably to refer to the use of more than one therapy (e.g., one or more prophylactic and / or therapeutic agents). The use of the terms does not limit the order in which the therapies (e.g., prophylactic and / or therapeutic agents) are administered to a person in need thereof. In the context of the present invention, co-administration encompasses the administration of a 4-epimerase inhibitor and a GLP-1R agonist in a substantially simultaneous manner, such as in a single pharmaceutical composition, for example, with a first amount and a second amount in a fixed ratio, or as discrete dosage forms. In addition, such co-administration also encompasses the use of each compound in a sequential manner in any order. When co-administration involves the separate or sequential administration of a first amount of a 4-epimerase inhibitor and a second amount of a GLP-1R agonist, they are administered in close enough time to achieve the desired therapeutic effect. For example, the period between each administration that can produce the desired therapeutic effect can range from a few minutes to a few hours and can be determined taking into account the properties of each compound, such as potency, solubility, bioavailability, plasma half-life, and kinetic profile.
[0138] In certain embodiments, an effective amount of a 4-epimerase inhibitor, a GLP-1R agonist, or a combination thereof for administration one or more times a day to a 70 kg adult can comprise about 0.0001 mg to about 4000 mg, about 0.0001 mg to about 3000 mg, about 0.0001 mg to about 200 mg, about 0.001 mg to about 1500 mg, about 0.01 mg to about 1000 mg, about 0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 10 mg to about 1000 mg, or about 100 mg to about 1000 mg of the 4-epimerase inhibitor per unit dosage form. In certain embodiments, formulations of the 4-epimerase inhibitor may be at a dosage level sufficient to deliver about 0.001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, and about 1 mg / kg to about 25 mg / kg of the subject's body weight per day, one or more times a day, to achieve the desired therapeutic effect. In certain embodiments, an effective amount of a 4-epimerase inhibitor for intranasal administration to a 70 kg adult human may comprise from about 0.0001 mg to about 4000 mg, from about 0.0001 mg to about 3000 mg, from about 0.0001 mg to about 200 mg, from about 0.001 mg to about 1500 mg, from about 0.01 mg to about 1000 mg, from about 0.1 mg to about 1000 mg, from about 1 mg to about 1000 mg, from about 1 mg to about 100 mg, from about 10 mg to about 1000 mg, or from about 100 mg to about 1000 mg of the extract or compound per unit dosage form.
[0139] In some embodiments, a single dose may be sufficient to treat or prevent insulin resistance and related conditions, suppress appetite and / or promote weight loss, which can be delivered in one or more aliquots (e.g., one or more sprays of the intranasal formulation into each nostril) to achieve the desired dose. In other embodiments, multiple doses may be required to treat or prevent insulin resistance and related conditions. The frequency of administration may occur at intervals of minutes, hours, days, weeks, months, or years, or may occur continuously within any of these time periods. The dose administered may be an amount sufficient to treat or alleviate the symptoms associated with insulin resistance or related conditions, to suppress appetite and / or promote weight loss.
[0140] Specifically, the dose, frequency of administration, and / or duration of treatment of the 4-epimerase inhibitor can be any suitable amount and / or duration sufficient to inhibit ARC neurofibrosis to the extent required to enhance the activity of the GLP-1R agonist. For example, the 4-epimerase inhibitor can be administered twice daily, daily, every other day, weekly, monthly, or at greater intervals as needed to adequately inhibit ARC neurofibrosis. In one embodiment, the 4-epimerase inhibitor is administered every other day. The GLP-1 agonist can be administered at the same or different dose, frequency, and / or duration of treatment as the 4-epimerase inhibitor.
[0141] Suitable dosages are known for approved agents and can be adjusted by those skilled in the art based on the condition of the subject, the type of condition being treated, and the amount of the compound or composition being used. Specifically, the effective dosage and frequency of commercially available GLP-1R agonists can be based on the product information for the specific product. As non-limiting examples, an effective amount of liraglutide can be 0.6 mg, 1.2 mg, 1.8 mg, 2.4 mg, or 3 mg administered daily; an effective amount of dulaglutide can be 1.5 mg administered weekly; an effective amount of exenatide can be 5 μg or 10 μg administered twice daily, or 2 mg administered weekly; an effective amount of semaglutide can be 0.25 mg, 0.5 mg, or 1 mg, 3 mg, 7 mg, or 14 mg administered weekly; and an effective amount of lixisenatide can be 10 μg or 20 μg administered daily. Those skilled in the art will be able to determine other suitable dosages and frequencies based on the specific GLP-1R agonist. GLP-1R agonists are typically administered by injection, particularly subcutaneous injection (e.g., liraglutide, dulaglutide, exenatide, semaglutide, lixisenatide) or orally, particularly in tablet form (e.g., semaglutide). However, the present invention contemplates any suitable mode of administration.
[0142] The intranasal formulations disclosed herein can be administered to a person in need thereof by any suitable intranasal delivery method. Suitable methods for intranasal administration will be well known to those skilled in the art. The intranasal formulations disclosed herein can be administered as a spray or drops. Therefore, suitable commercial packaging containing the intranasal formulations can be in any spray container known in the art. In one or more embodiments, the formulations disclosed herein can be administered by a spray device or container. The spray device can be a single unit dose system or a multi-dose system, for example, comprising a bottle, a pump and / or an actuator. Such spray devices are commercially available, for example, from Nemera, Aptar, Bespak, and Becton-Dickinson. In still other embodiments, the formulations disclosed herein can be administered by an electrostatic spray device, as described in U.S. Patent No. 5,655,517. Other suitable means for intranasal administration of the formulation according to the present invention include via dropper, syringe, squeeze bottle, and any other means known in the art for applying a liquid to the nasal mucosa in an accurate and reproducible manner.
[0143] The spray device used to administer the intranasal formulation can be a disposable metered dose spray device, a multiple use metered dose nasal spray device, and is not limited to spraying the solution into each nostril, but can be administered as a gentle stream from a plunger, syringe, or the like, or drops from a unit dose or multi-dose squeeze bottle, or other means known in the art to apply a liquid to the nasal mucosa in an accurate manner.
[0144] In one or more embodiments, a spray device suitable for use with the present invention can typically deliver a liquid volume in the range of 0.01 mL to 0.15 mL in a single spray actuation. A typical dosing regimen for a nasal spray product can range from one spray into a single nostril (nostril or naris) to two sprays into each nostril (nostril or naris). Repeated dosing to the same nostril (nostril or naris) can also be performed. It should be recognized that the dosing schedule, including a repeated dosing schedule, can be modified to obtain a desired pharmacokinetic profile. In addition, the dosing schedule can be modified to achieve a rapid reduction in the severity of the symptoms of insulin resistance or related conditions, preferably cessation. In some cases, an incremental increase in repeated dosing may be required to achieve a reduction in the severity of a viral infection or cessation of symptoms. For example, each repeated dose may need to be increased by 25%, 50%, 75%, 100%, 150% or 200% to achieve a reduction in the severity of insulin resistance or related conditions or cessation of symptoms.
[0145] It should be understood that the active agents in the combination (i.e., the 4-epimerase inhibitor and the GLP-1R agonist) can be administered at a dose and / or frequency that is greater than or less than the effective amount of each active agent alone. Specifically, where the combination provides a synergistic effect, the lower dose and / or frequency may be the same or more effective than administering one of the component active agents alone. In certain embodiments, the 4-epimerase inhibitor and the GLP-1R agonist are each administered in an effective amount (i.e., each is administered in an amount that would be therapeutically effective if administered alone). In other embodiments, the 4-epimerase inhibitor and the GLP-1R agonist are each administered in an amount that does not provide a therapeutic effect alone (a subtherapeutic dose). In yet other embodiments, the 4-epimerase inhibitor may be administered in an effective amount, while the GLP-1R agonist is administered in a subtherapeutic dose. In still other embodiments, the 4-epimerase inhibitor may be administered in a subtherapeutic dose, while the GLP-1R agonist is administered in an effective amount.
[0146] The amount of 4-epimerase inhibitor and / or GLP-1R agonist administered per dose, or the total volume of the combination and its components administered, will depend on factors such as the nature and severity of the symptoms, the age, weight, and general health of the patient, and the mode of administration. It should be appreciated that the relative amounts of excipients, solvents, diluents, salts, thickeners, organoleptics, buffers, and / or any additional ingredients in the pharmaceutical compositions disclosed herein may also depend on the identity, size, and / or condition of the subject, as well as the mode of administration. For example, in some embodiments, a larger dose of one dosage form of the 4-epimerase inhibitor and / or GLP-1R agonist may be required to achieve a therapeutically equivalent effect compared to another dosage form. As used herein, the terms "therapeutic equivalence" or "therapeutic equivalence" refer to different compositions comprising the same active agent that produce the same clinical effect and safety profile and / or are pharmaceutically equivalent to each other.
[0147] The formulation comprising a 4-epimerase inhibitor, a GLP-1R agonist, or both can be administered in a single dose or over a series of doses. The appropriate dosage and dosing regimen can be determined by the attending physician and may depend on the specific condition being treated, the severity of the condition, and the general age, health, and weight of the subject. It should be understood that the dosage ranges described herein provide guidance for administering the provided pharmaceutical compositions to adults. The amount to be administered can be determined by a medical practitioner or one skilled in the art.
[0148] In certain embodiments, it is envisioned that the combinations as disclosed herein can be used as a treatment for insulin resistance or related conditions to suppress appetite and / or promote weight loss in place of or in place of other traditional drugs administered to subjects in need. In other embodiments, it is envisioned that the combinations as disclosed herein can be administered to subjects in need as a supplement or adjunct to traditional drugs. In still other embodiments, it is envisioned that in the absence of adjunctive therapy, the combinations as disclosed herein can be administered to subjects in need. It may be advantageous to substitute traditional drugs for the treatment of insulin resistance or related conditions with combinations as disclosed herein to suppress appetite and / or promote weight loss, particularly where traditional drugs are associated with one or more adverse effects.
[0149] In other embodiments, the combination as disclosed herein can be administered to a subject in need thereof together with one or more additional therapeutic agents in a discrete time period to address the specific symptoms of insulin resistance or related conditions, to suppress appetite and / or promote weight loss. In still other embodiments, over the duration of the treatment period, a subject in need thereof can be treated with a combination as disclosed herein and one or more additional therapeutic agents (administered sequentially or in combination). In one or more embodiments in which the combination as disclosed herein is administered together with additional therapeutic agents (e.g., a third or subsequent therapeutic agent), the additional therapeutic agent can be any therapeutic agent that provides the desired therapeutic outcome. Specifically, additional therapeutic agents can be selected from known therapeutic agents for treating or preventing insulin resistance or related conditions (including one or more symptoms thereof), appetite suppression and / or weight loss. Such therapeutic agents will be known to those skilled in the art. As non-limiting examples, known therapeutic agents for treating obesity or type 2 diabetes, the known therapeutic agents may be suitable for further use in combination with the combination of the present invention.
[0150] When the combination of the present invention is further administered in combination with another therapeutic agent, the other agent can be administered in any "effective amount" that provides the desired therapeutic activity, as described above. The appropriate dosage and administration regimen of the other therapeutic agent can be determined by the attending physician and may depend on the specific condition being treated, the severity of the condition, and the general age, health, and weight of the subject. It should be understood that, unless otherwise indicated, the dosage ranges as described herein provide guidance for administering the provided pharmaceutical compositions to adults. The amount to be administered can be determined by a medical practitioner or one skilled in the art.
[0151] 4-epimerase inhibitors, GLP-1R agonists, and formulations thereof can be included in a kit. The kit can include, for example, a 4-epimerase inhibitor and a GLP-1R agonist, each packaged or formulated separately, or packaged or formulated in combination. Thus, the 4-epimerase inhibitor can be present in a first container and the GLP-1R agonist can be present in a second container. The container or containers are placed within the package, and the package can optionally include instructions for administration or dosage. In one embodiment, the kit disclosed herein can include a 4-epimerase inhibitor in a form suitable for intranasal administration and a GLP-1R agonist in a form suitable for injection (e.g., subcutaneous injection), in a prefilled pen. The kit can optionally include instructions describing methods of using the drug combination in one or more of the methods described herein (e.g., for preventing or treating metabolic diseases). The kit can optionally include one or more pharmaceutically acceptable carriers, diluents, adjuvants, and / or excipients. The pharmaceutical combination comprising a 4-epimerase inhibitor and a GLP-1R agonist contained in the kit may optionally be combined in the same pharmaceutical composition.
[0152] Those skilled in the art will appreciate that the invention described herein is subject to variations and modifications other than those specifically described. It is to be understood that the invention described herein includes all such variations and modifications. The invention also includes all such steps, features, methods, compositions and compounds referenced or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features.
[0153] Certain embodiments of the invention will now be described with reference to the following examples, which are provided for illustrative purposes only and are not intended to limit the scope of the general description above.
[0154] Examples
[0155] Abbreviations
[0156] +ve: positive
[0157] 2-DG: [ 14 C]2-deoxyglucose
[0158] III: 3rd ventricle
[0159] ARC: arcuate nucleus of the hypothalamus
[0160] AUC: Area under the curve
[0161] BAT: brown adipose tissue
[0162] chABC: Chondroitinase ABC
[0163] CPSG-ECM: Chondroitin sulfate proteoglycan extracellular matrix
[0164] DAPI: 4',6-diamidino-2-phenylindole
[0165] ddH2O: double distilled water
[0166] EGP: endogenous glucose production
[0167] epiWAT: epididymal white adipose tissue
[0168] FITC: fluorescein isothiocyanate
[0169] GIR: Glucose infusion rate
[0170] GLP-1R: glucagon-like peptide 1 receptor
[0171] HABP: Hyaluronan Binding Protein
[0172] HFHS: High-fat, high-sugar diet
[0173] HOMA-IR: Homeostasis model assessment of insulin resistance
[0174] ICV: intracerebroventricular
[0175] IN: Intranasal
[0176] IP: intraperitoneal
[0177] epiWAT: epididymal white adipose tissue
[0178] ingWAT: Inguinal white adipose tissue
[0179] IR: insulin receptor
[0180] NPY: Neuropeptide-Y
[0181] NZO: New Zealand obese mouse
[0182] p-AKT: AKT Ser-473 phosphorylation
[0183] PBS: Phosphate-buffered saline
[0184] PF: Pair Feeding
[0185] POMC: pro-opiomelanocortin
[0186] PV: Parvalbumin
[0187] RER: ventilation ratio
[0188] RSG: retrosplenial cortex
[0189] SC: Subcutaneous
[0190] UCP1: Uncoupling protein 1
[0191] VMH: ventromedial hypothalamus
[0192] WFA: Wisteria floribunda agglutinin
[0193] General Procedures
[0194] General Procedures A. Animals
[0195] Mice were maintained in a temperature-controlled, high-barrier facility on a 12-h light-dark cycle with free access to food and water in accordance with the NHMRC Australian Code of Practice for the Care and Use of Animals. C57BL / 6J and Balb / C mice were obtained from the Animal Resources Centre, Australia, while Agrp-IRES-Cre (strain number 012899), db / db (strain number 000697), Npy-GFP (strain number 006417), Pomc-GFP (strain number 009593), LSL-Cas9 (strain number 028551), and NZO (strain number 002105) mice were obtained from Jackson Laboratories, USA. Agrp-IRES-Cre;LSL-Cas9-GFP (AgRP-Cas9) mice were generated, and hemizygous Agrp-IRES-Cre mice were bred together with homozygous LSL-Cas9-GFP mice. Male Sprague-Dawley rats (ARC, Canning Vale, Australia) were individually housed at a room temperature of 23±2°C, 40%-70% room humidity, with a 12-h light / dark cycle (lights off at 9:00 am), and nesting / enrichment materials were used. Animals were fed a standard diet (Barastoc, Ridley AgriProducts, Australia) or a high-fat, high-carbohydrate diet (mice: 43% fat and 20% carbohydrates, respectively, SF04-001; Specialty Feeds, Australia. Rats: 30% fat, SF17-204, Specialty Feeds, Australia). To induce late-stage type 2 diabetes in mice, male C57Bl / 6J mice were fed a HFHS diet for 4 weeks and then received a total of 6 streptozotocin injections (STZ, 40 mg / kg, ip Sigma, in 50 mM sodium citrate buffer, pH 4.5) over the next 2 weeks. Blood glucose levels were monitored, and mice showing stable blood glucose levels >15 mM were used for downstream experiments.The experiments were approved by The University of Melbourne Animal Ethics Committee (10323, 10324, 10352, 10385, 10427, 21712, 22282, 22404).
[0196] General Procedure B. Genotyping
[0197] DNA was extracted from tail biopsies using tissue extraction PCR buffer (MDX004, Meridian Bioscience, OH) and PCR was performed using MyTaq TM DNA was amplified by PCR using HS Red Mix (BIO-25048, Meridian Biosciences, Inc., OH) and the following primers to detect Cre (forward: 5'GCG GTCTGG CAG TAA AAA CTA TC'3 (SEQ ID NO: 1), reverse 5'GTG AAA CAG CAT TGC TGT CAC TT'3 (SEQ ID NO: 2)), LSL-Cas9 (wt forward: 5'AAG GGA GCT GCA GTG GAG TA'3 (SEQ ID NO: 3), wt reverse: 5'CAG GAC AAC GCC CAC ACA'3 (SEQ ID NO: 4), mt forward: 5'TCC CCA TCA AGC TGATCC'3 (SEQ ID NO: 5), mt reverse: 5'CTT CTT CTT TGG GGC CAT CT'3 (SEQ ID NO: 6)), Npy-GFP (common forward: 5'TAT GTG GAC GGG GCA GAA GAT CCA GG'3 (SEQ ID NO:7), wt reverse: 5'CCCAGC TCA CAT ATT TAT CTA GAG'3 (SEQ ID NO:8), mt reverse: 5'GGT GCG GTT GCC GTA CTGGA'3 (SEQ ID NO:9)), Pomc-GFP (forward 5'AAG TTC ATC TGC ACC ACC G'3 (SEQ ID NO:10), reverse 5'TGC TCA GGT AGT GGT TGT CG'3 (SEQ ID NO:11)) alleles. CRISPR-mediated deletion of mouse InsR (ΔInsr) was monitored using the following primers: CRISPR): forward 5'GAG ATG GTC CAC CTG AAG GA'3 (SEQ ID NO: 12), reverse 5'GTG AAG GTC TTG GCA GAA GC'3 (SEQ ID NO: 13).
[0198] General Procedures C. Immunohistochemistry
[0199] For immunohistochemistry of the brain, mice were anesthetized and perfused transcardially with heparinized saline [10,000 units / L porcine heparin], followed by perfusion with 10% neutral buffered formalin. The brain was post-fixed for 16 hours and kept in 30% sucrose in PBS for three days at 4°C to cryoprotect the tissue, then frozen on dry ice. 30 μm sections (120 mm apart) were cut on the coronal plane of the rostral-caudal range of the entire hypothalamus. The sections were stored for a long time in a cryoprotectant (30% ethylene glycol, 20% glycerol in PBS) at -20°C. In order to detect only HABP and versican, the sections were subjected to heat-induced epitope retrieval using citric acid buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0) for 20 minutes at 95°C.
[0200] For detection of aggrecan, GFP, HABP, parvalbumin, mCherry, versican, tenascin-C, HAPLN1, neurocan, phosphocan, brevican, WFA, and WFA-FITC sections were incubated for 1 hour at room temperature in blocking buffer (0.3% Triton X-100, 5% normal goat serum, Gibco, Thermo Fisher Scientific, MA, 0.02% sodium azide) and then overnight at 4°C in 1% blocking buffer containing rabbit anti-aggrecan (1:1000, AB1031, Millipore, MA), chicken anti-GFP (1:2000; ab13970, Abcam, Cambridge, UK). , biotinylated HABP (1:100, 385911, Burlington, MA), sheep anti-parvalbumin (1:1000, in-house), rabbit anti-dsRed (1:2000, 600-401-379, Rockland, PA), rabbit anti-versican (1:1000, AB1033, Millipore, MA), tenascin-C (1:500, M1-B4, Developmental Studies Hybridoma Bank, Iowa), Studies Hybridoma Bank, Iowa), HAPLN1 (1:500, 9 / 30 / 8-A-4, Developmental Studies Hybridoma Bank, Iowa), neurocan (1:300, 1F6-S, Developmental Studies Hybridoma Bank, Iowa), phospho-proteoglycan (1:300, 3F8, Developmental Studies Hybridoma Bank, Iowa), brevican (1:500, 610895, BD Transduction Laboratories), biotinylated WFA (1:2000, L1516; Sigma-Aldrich, MO), WFA-FITC (1:2000, FL-1351-2, Vector Laboratories, CA). Antibodies were used as the primers for the primers: primers 1 and 2 (1:1000, 14730-1-AP, Proteintech, Inc., CA), rabbit anti-PGP9.5 (1:1000, 14730-1-AP, Proteintech, IL), guinea pig anti-AgRP (1:500, AS506, Antibodies Australia, Melbourne, AUS).After washing with PBS-T (0.3% Triton X-100 in PBS, +0.02% sodium azide), sections were incubated with goat anti-chicken Alexa Fluor 488 (ab150169, Abcam, Cambridge, UK), goat anti-rabbit Alexa Fluor-488, 595, 647 (ab150077, ab150080, ab150083, Abcam, Cambridge, UK), donkey anti-sheep Alexa Fluor 594 (ab150180, Abcam, Cambridge, UK), Alexa Fluor 594, 647 streptavidin (405240, BioLegend, CA) conjugated secondary antibodies in 5% blocking buffer for 2 hours at room temperature. Sections were mounted with Mowiol 4-88 mounting medium and visualized with an Olympus BX61 microscope. Images were captured using an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (National Institutes of Health, Massachusetts, USA (NIH, MA)). Images of cellular internalization were captured using a Zeiss LSM880 Airyscan Fast confocal microscope, acquired using Zeiss ZEN software v2.1, and processed using ImageJ software (National Institutes of Health, Massachusetts, USA). Brightness and contrast were adjusted in the color-merged images to aid analysis of co-incidence.
[0201] For ingWAT immunohistochemistry, ingWAT was immediately dissected and fixed in a buffered formalin solution on a rocking platform for 48 hours. Tissues were embedded in paraffin at room temperature and 5 μm sections were prepared 100 μm apart. For hematoxylin and eosin (H&E), tissue sections were incubated in hematoxylin for 3 minutes, followed by incubation in eosin for 30 seconds. To detect UCP-1, sections were subjected to antigen retrieval in citric acid buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0) at 95°C for 20 minutes. Sections were incubated in 5% blocking buffer for 1 hour at room temperature and then in rabbit anti-UCP-1 (1:1000; ab10983, Abcam, Cambridge, UK) in 1% blocking buffer at 4°C overnight. After washing in PBS-T, the sections were incubated with goat anti-rabbit Alexa Fluor 488 (ab150077, Abcam, Cambridge, UK) secondary antibodies in 5% blocking buffer at room temperature for 2 hours. The sections were incubated in DAPI (20 ng / ml PBS solution) for 10 minutes, then mounted with Mowiol 4-88 mounting medium and visualized with an Olympus BX61 microscope. Images were captured with an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (National Institutes of Health, Massachusetts, USA). Brightness and contrast in the color-merged images were adjusted to help analyze co-incidence.
[0202] General Procedure D. Functional p-AKT Immunohistochemistry
[0203] Mice were injected intraperitoneally with vehicle (PBS) or insulin (3mU / g, ip, Actrapid, Novo Nordisk, Denmark), and perfused (as described above) through the heart for 15 minutes with 10% neutral buffered formalin. The brain was post-fixed on a rocking platform for 16 hours at RT, and then stored for two days in 30% sucrose in PBS, with cryoprotectant tissue, and subsequently frozen on dry ice. 30 μm sections were cut on the coronal plane of the rostral-caudal range of the whole hypothalamus. Sections were pre-treated in 0.3% glycine for 10 minutes, washed in PBS-T, and incubated for 10 minutes in 0.03% SDS. The sections were then blocked in 5% blocking buffer for 1 hour at RT and incubated with rabbit anti-p-AKT (Ser-473) (1:300; No. 4060, Cell Signaling Technology, Beverly, MA) in 1% blocking buffer for 48 hours. The sections were then incubated in 5% blocking buffer containing goat anti-rabbit Alexa Fluor 647 (ab150083, Abcam, Cambridge, UK) or biotinylated goat anti-rabbit (BA-1000, Vector Laboratories, CA, without sodium azide in the blocking buffer). Fluorescent sections were mounted with Mowiol 4-88 mounting medium and visualized using an Olympus BX61 microscope. Images were captured with an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (National Institutes of Health, MA). For chromogenic detection, the sections were visualized using The p-AKT signal was amplified using an ABC-HRP kit (1:500, PK-4000, Vector Laboratories, California) and visualized using a 0.1% H2O2 DAB solution (3,30-diaminobenzidine, ICN980681, Thermo Fisher Scientific, Massachusetts) peroxidase substrate kit (Vector Laboratories, United Kingdom). p-STAT3 and p-AKT immunopositive cells were visualized using a Leica DM2000 LED brightfield microscope using a Leica DMC6200 camera and Leica Application Suite X software.
[0204] General Procedure for E. coli CSPG-ECM Immunofluorescence Analysis
[0205] ARC CSPG-ECM was assessed stereologically throughout the rostral-caudal ARC. The ARC was divided into three zones: the rostral ARC (-1.22 / -1.58 mm anterior-posterior), the medial ARC (-1.58 / -1.94 mm anterior-posterior), and the caudal ARC (-1.94 / -2.18 mm anterior-posterior). CSPG-ECM was quantified in the VMH and RSG cortex (-1.58 / -1.94 mm anterior-posterior).
[0206] All image quantifications were performed in Image J (National Institutes of Health) software (National Institutes of Health, Massachusetts). Raw images were background subtracted using a rolling ball algorithm to minimize any potential differences in background and tissue autofluorescence. To quantify the area and intensity of CSPG-ECM within each brain region (ARC, VMH, or RSG cortex), images were thresholded and binarized to create a region of interest (ROI) mask of only CSPG-ECM. For each brain region, the CSPG-ECM ROI area (μm) was calculated. 2 ) and intensity (the sum of all pixel intensities within the ROI). This process is automated to minimize bias and take into account the differences in brain nucleus size across multiple images. Brain nuclei are defined according to the Paxinos and Franklin mouse brain atlas (http: / / labs.gaidi.ca / mouse-brain-atlas / ). The area and intensity of CSPG-ECM in each region are normalized relative to the corresponding control.
[0207] To determine the colocalization of ECM components (HA, HAPLN1, tenascin-C, aggrecan, versican, phosphocan, brevican, neurocan) within the CSPG-ECM (WFA positive staining), 2 masks were generated per image: one for total CSPG-ECM staining and the other for component staining within the ARC. The overall area and intensity of the total CSPG-ECM structure were calculated. The area and intensity of the components within the CSPG-ECM were determined by quantifying only the expression within the total CSPG-ECM mask. This allows the characterization of ECM components that are specifically expressed within the ARC CSPG-ECM. The area and intensity of the CSPG-ECM within each region were normalized relative to the corresponding control. In contrast, to determine the colocalization of WFA-labeled ARC CSPG-ECM within the ARC CSPG-ECM components, 2 masks were generated per image; one for total CSPG-ECM staining and the other for component staining within the ARC. The overall area and intensity of the total component structure were calculated. By only quantitatively expressing WFA within the total component mask, the area and intensity of the CSPG-ECM comprising the component were determined. The area and intensity of the CSPG-ECM in each district were normalized relative to the corresponding control. This combined approach further characterized the specificity of the component to the CSPG-ECM district.
[0208] General Procedure F. Quantification of ARC Neurons within CSPG-ECM
[0209] To determine which metabolism-related ARC neurons are encapsulated within the CSPG-ECM during the development of metabolic disease, brains collected from Npy-GFP (for visualizing AgRP / NPY neurons) and Pomc-GFP (for visualizing POMC neurons) mice fed with HFHS at 0, 4, and 12 weeks were analyzed. As described in the immunohistochemistry section, ARC sections were stained for GFP and WFA and analyzed using Image J (National Institutes of Health) software. To determine the number of GFP-positive neurons encapsulated within the CSPG-ECM, two masks were generated. To define the CSPG-ECM structure in the ARC image, the image was thresholded and binarized to create a CSPG-ECM mask. To identify individual GFP-positive neurons, the image was thresholded and binarized to create a GFP mask. To define individual GFP neurons, the GFP mask was segmented using a watershed separation algorithm. The total number of GFP-positive cells was counted within the entire ARC region and within the CSPG-ECM mask. This quantified the percentage of GFP cells encompassed by the CSPG-ECM in the ARC.
[0210] In order to determine the intensity of the CSPG-ECM of the independent GFP cell around the ARC, GFP image was thresholded and binarized. Using the expansion, distance map and Voronoi process in ImageJ software, a ROI of 1.29 μm (the average size of the ECM around the cortical neurons) was created around each GFP cell. This produced a mask that can specifically analyze the CSPG-ECM bordered by independent GFP cells. Using this mask, the CSPG-ECM staining intensity around the GFP cells present in the ARC CSPG-ECM was determined.
[0211] General Procedure G. Behavior Satisfaction Order
[0212] Mice were fasted overnight and housed individually in transparent cages with free access to water. Two hours after the light cycle began (9 a.m.), pre-weighed food was provided to mice, and mice were observed undisturbed and carefully for 90 minutes. During the 90-minute observation, instantaneous behavior was scored every 30 seconds. Behavior at every 30-second interval was recorded according to the following classification: eating (animals at the hopper attempted to obtain food, chew or gnaw), drinking water (animals licked the water spout), grooming (animals scratched, bit or licked any part of their anatomical structure), resting (animals curled up and closed their eyes to rest), active (animals showed activity, including movement, smelling, feeding) or inactive (animals did not move when conscious, or had signs of sickness behavior). Data were organized into 5-minute statistical stacks, and several variables were assessed, including: the average percentage of time the mouse engaged in each recorded behavior (% of total behaviors), food intake, transition from eating to resting, and time to satiety (the time at which the frequency of eating behavior intersects the frequency of resting behavior).
[0213] General Procedure for Hyperinsulinemic Euglycemic Clamping in Conscious Freely Behaving Mice
[0214] To perform hyperinsulinemic euglycemic clamp, mice were anesthetized under isoflurane and the right jugular vein was cannulated for infusion as previously described by Dodd et al., 2018. The catheter was attached to an implant button (BMSW25, RWD Life Sciences, Shenzhen, China). The implant button was capped to allow group housing of mice, and the catheter was kept open by daily flushing with 40 μL saline containing 200 units / mL heparin. On the day of the experiment, food was removed at 7:00 am. After fasting for 3.5 hours, a start (1 minute, 1.25 microcuries / minute) and a continuous infusion (0.05 microcuries / minute) of [3-3H] glucose (NET331A001MC, PerkinElmer, MA) were administered to measure systemic glucose turnover as previously described by Dodd et al., 2018. 90 minutes later, mice received a 40 mU / Kg insulin bolus over 10 minutes, followed by a continuous insulin infusion (4 mouse units / kg / minute of gelofusine). Euglycemia (approximately 8-10 mM blood glucose) was maintained by a variable infusion of 30% glucose solution.
[0215] During steady-state conditions (Ra = Rd), tail blood samples were collected at 80, 90, 100, 110, and 120 minutes to determine Rd and Ra as described above. At 120 minutes, a 13 uCi bolus of [ 14 C]-2-Deoxy-D-glucose (NEC495A250UC, PerkinElmer, MA) was injected into the jugular vein, and blood was sampled at 122, 125, 135, 145, and 155 minutes. At the end of the experiment, tissues were extracted for glucose uptake determination.
[0216] General Procedure I. Pair Feeding
[0217] C57BL / 6J mice fed a 12-week HFHS diet were bilaterally injected with vehicle or chABC into the ARC. The 24-hour food intake of mice treated with chABC in the ARC was determined, and groups of mice treated with vehicle in the ARC were pair-fed, limiting food availability to the average food consumption of mice treated with chABC in the ARC.
[0218] General Procedure J. Metabolic Assessment
[0219] Metabolic measurements were performed in the Melbourne Mouse MetabolicPhenotyping Platform (Melbourne Mouse MetabolicPhenotyping Platform, University of Melbourne, Australia). D-glucose (2 mg / g lean body weight and 1 mg / g lean body weight for db / db and HFHS+STZ mice) was injected into the peritoneal cavity, and glucose in the tail blood was measured immediately before and after injection at 15, 30, 45, 60, 90, and 120 minutes using an Accu-Check blood glucose meter (Roche, Germany). Glucose tolerance tests were performed on conscious mice that had fasted for 6 hours. The area under the blood glucose fluctuation curve was determined and expressed as millimoles / liter × minute. Fasting (12-hour fasting) plasma insulin or blood glucose levels were determined using rat / mouse insulin ELISA (EZRMI-13K, Merck Millipore, CA, USA) or an Accu-Check blood glucose meter. HOMA-IR was calculated using the equation [(glucose × insulin) / 405]. Obesity propensity was measured using a TD-NMR minispec (Bruker Optics Inc., Billerica, MA).
[0220] Mice were acclimated for 24 hours and then monitored for 48 hours in an environmentally controlled Promethion metabolic screening system (Sable Systems International, NV) equipped with indirect open-circuit calorimetry, food consumption, and activity monitors to measure activity, caloric intake, and energy expenditure. The respiratory quotient was calculated as the ratio of CO2 production to O2 consumption, and the respiratory exchange ratio and energy expenditure were calculated using the Weir equation (Kcal h-1 = 60 × (0.003941 × VO2 + 0.001106 × VCO2)). To account for differences in body mass / composition, ANCOVA was used, and energy expenditure was analyzed and adjusted using scripts available on the National Mouse Metabolic Phenotyping Centers (MMPC, Nashville, TN, USA) energy expenditure analysis page (https: / / www.mmpc.org / shared / regression.aspx).
[0221] To provide an indicator of ingWAT and BAT heat production, infrared thermography was used to measure temperature changes in the inguinal and interscapular regions, as previously described (Dodd et al., 2019). A FLIR T1010 thermal imaging camera (FLIR Systems Australia Pty Ltd, VIC, Australia) was mounted on a tripod and the animals were positioned at a standard distance of 70 cm from the camera. The animals were anesthetized, shaved in the area of interest, and whole-body images were collected in both the prone and supine positions. Temperature was analyzed using the FLIR ResearchIT Max 4 program (FLIR Systems, OR, United States). Peak temperatures in ingWAT and BAT were determined.
[0222] General Procedure K. Stereotactic Surgery
[0223] All stereotactic injections were performed under isoflurane anesthesia using an ultraprecision stereotaxic apparatus (963 Kopf, Munich, Germany) or an ultraprecision rotating stereotaxic apparatus (69100, Reward Life Sciences, Shenzhen, China) and a stereotactic nanoinjector (788130, KD Scientific, Holliston, MA) with a neuroinjector (Hamilton, NE).
[0224] To disassemble the CSPG-ECM within the ARC, mice received bilateral (unless otherwise stated) administration of 15 mU / side of active chABC (C3667, Sigma, St. Louis, MI, dissolved in 1 M trehalose) or heat-inactivated chABC protein as a vehicle (chABC in 1 M trehalose was heat-inactivated at 85°C for 45 minutes, as previously described in Alonge et al., 2020) in a total volume of 150 nl / side. To pulse CSPG-ECM within the ARC or RSG, mice received bilateral (unless otherwise stated) administration of biotinylated WFA (0.3 μg / side in a volume of 150 nl). To disrupt IR in AgRP neurons, 12-week HFHS-fed AgRP-Cas9 mice were stereotactically injected with AAV expressing a U6-driven guide RNA targeting the InsR gene or a scrambled sequence (5'GTGTAG TTC GAC CAT TCG TG'3 (SEQ ID NO: 14)) along with a CAG-driven mCherry FLEX switch. Unless otherwise indicated, injections were made bilaterally into the ARC (coordinates, bregma: anterior-posterior, -1.70 mm; dorso-ventral, -5.85 mm; lateral, + / -0.18 mm, 200 nl / side) or into the RSG (coordinates, bregma: anterior-posterior, -1.40 mm; dorso-ventral, -1.80 mm; lateral, + / -0.50 mm, 200 nl / side). WFA-biotin was injected unilaterally into the cc (coordinates, bregma: anterior-posterior, -1.40 mm; dorsal-ventral, -5.80 mm; lateral, + / -0.20 mm, 200 nl / side).
[0225] General procedures for L. viruliferum production
[0226] To generate AAV-g scramble (pAAV-U6>mScramble-GTGTAGTTCGACCATTCGTG (SEQ ID NO: 14)-CAG>LL:rev(mCherry):rev(LL):WPRE) and AAV-gIR (pAAV[-U6>mInsr[gRNA-TATCGACTGGTCCCGTATCC (SEQ ID NO: 15)]-U6>mInsr[gRNA-GTCTG TCCAGGCACCGCCAA (SEQ ID NO: 16)]-CAG>LL:rev(mCherry):rev(LL):WPRE) viral vectors, sgRNAs were first designed using online CRISPR tools (http: / / crispr.mit.edu and http: / / chopchop.cbu.uib.no / ). Potential off-target gRNA binding was assessed in silico using Off-Spotter (https: / / cm.jefferson.edu / Off-Spotter / ), and guides exhibiting ≥3 mismatches to nonspecific genomic regions were considered (Anderson et al., 2015). For AAV-g scrambled sequences, the pUp-U6>Scramble gRNA vector was generated using Gibson assembly of the pDONR P4-P1R backbone and primers 5'GGGGACAACTTTGTATAGAAAAGTTGGAGGGCCTATTTCCCATGATTC'3 (SEQ ID NO: 17) and 5'GGGGACTGCTTTTTTGTACAAACTTGAAAAAAGCACCGACTCGGTGCC'3 (SEQ ID NO: 18). For AAV gIR, use AarI digested pUp-U6-gRNA-AarI-Stuffer-AarI backbone along with primers 5'ATATCTTGTGGAAAGGACGAAACACCGTATCGACTGGTCCCGTATCCG'3 (SEQ ID NO: 19) and 5'AACTTGCTATT TCTAGCTCTAAAACTTGGCGGTGCCTGGACAGAC'3 (SEQ ID NO: 19) NO:20) The pUp-U6>mInsr[gRNA-TATCGACTGGTCCCGTATCC (SEQ ID NO:15)]-U6>mInsr[gRNA-GTCTGTCCAGGCACCGCCAA (SEQ ID NO:16)] gRNA vector was generated.For both AAV-g scrambled and AAV-g1R, the p-Up vector was cloned with pDown-CAG and pTail-LL:rev(mCherry):rev(LL) to generate the final vector by LR reaction using the Gateway method. AAV vectors were packaged into AAV-DJ / 8 serotype at a titer of >2 10^13 GC / ml. All vector cloning and AAV packaging were performed using VectorBuilder (Chicago, IL).
[0227] General Procedure: Insulin Extravasation in M.ARC
[0228] The C57BL / 6J of 12 weeks HFHS feeding or the control of age-matched feed feeding received vehicle or chABC to the bilateral injection in ARC.After injection 3 days (before seeing body weight difference), mice fasted for 6 hours.In order to assess the situation that insulin extravasates into ARC mice, described mice are administered insulin-FITC (50 μ g / animal, volume is 100 μ l, iv, I3661, the Sigma company of St. Louis, Michigan) or FITC (64.3 micromoles / animal, volume is 100 μ l, iv, F3651, the Sigma company of St. Louis, Michigan).After injection, mice were perfused (as described above) 30 minutes.In order to assess the situation that insulin extravasates into ARC, no matter BBB, directly insulin-FITC (1 μ g / animal, volume is 2 μ l) is administered to mice in lateral ventricle. To this end, mice were anesthetized and insulin-FITC was stereotaxically injected (as described above) into the lateral ventricle (coordinates, bregma: anterior-posterior, -0.20 mm; dorsal-ventral, -2.4 mm; lateral, +0.10 mm) at a rate of 200 nanoliters / minute. Mice were perfused (as described above) 20 minutes after the start of the injection. For the evaluation of insulin-FITC, the brains were post-fixed overnight and cryoprotected in 30% sucrose in PBS. To preserve the autofluorescence signal, the brains and sections were kept in the dark and mounted and imaged immediately after sectioning.
[0229] General Procedure for N. lateral ventricular catheterization
[0230] Under isoflurane anesthesia, C57BL / 6J or AgRP-Cas9 mice fed a 12-week HFHS diet were stereotaxically implanted into the right lateral ventricle (0.2 mm posterior and 1.0 mm lateral to the bregma). The guide cannula was positioned 1.3 mm above the injection site (1 mm ventral to the surface of the skull). AgRP-Cas9 mice were treated with AAV-g scrambled or AAV-gIR, and guide cannula placement was performed 7 days after AAV administration. Mice were administered ICV with vehicle (ddH2O), fluoroamine (100 μg / animal / day or 250 μg1 / animal / day) in a volume of 2 μl / animal, and all compounds were delivered approximately 1 hour before lights out (7 pm).
[0231] General Procedure O. Intranasal Drug Delivery
[0232] Awake mice are restrained by scraping and are inverted parallel to the floor, with their chin and neck at an angle of about 180 degrees. Using 10 μ L tips, 5 μ L of vehicle (ddH o) or fluoroamine (1 mg / animal in 20 μ L or 5 mg / animal in 20 μ L) are loaded in a pipette. The tip of the filled pipette is placed near the left nostril at a 45-degree angle, and the drug is ejected to form a small 5 μ l droplet at the tip, for the mouse to inhale. After the mouse inhales the first droplet, the remaining solution is sprayed immediately to form another droplet, for the mouse to inhale through the same nostril. Before repeating the procedure in the right nostril, the mouse is kept in this position for 15 seconds. The mouse is put back in the cage for 2 minutes, and the process is repeated so that each mouse receives four drops, 5 μ l for each droplet, delivering a total of 20 μ l of solution. All drugs are applied and delivered approximately 1 hour (7 p.m.) before lights out.
[0233] General procedures for P. cSPG-ECM tracker validation and quantification
[0234] To determine CSPG-ECM turnover in the ARC, RSG, or CC, mice received stereotaxic injections of biotinylated WFA (WFA-biotin) as described in the Stereotactic Surgery section. At the experimental endpoint, mice were transcardially perfused, and pulse-labeled ARC CSPG-ECM was identified by immunofluorescence detection of WFA-biotin (CSPG-ECM at the time of the pulse) and WFA-FITC (total CSPG-ECM), as described in the Immunohistochemistry section.
[0235] To track pulsed WFA-biotin in the ARC, sections were imaged and analyzed using Image J (National Institutes of Health). Raw images were background subtracted using a rolling ball algorithm to minimize background and tissue autofluorescence. To quantify the area of staining within the ARC, images were thresholded and binarized to create ROI masks for WFA-biotin and WFA-FITC. For each image, the area of the stained ROI (μm) was calculated. 2 ) and intensity (the sum of all pixel intensities within the ROI).
[0236] To validate the CSPG-ECM tracker technology, 8-week-old C57BL / 6J mice were stereotaxically injected unilaterally with WFA (0.3 μg / side in a volume of 150 nl) to pulse CSPG-ECM into one side of the ARC, and saline was injected into the other side. One day later, the mice were transcardially perfused, and ARC brain sections were stained and analyzed for CSPG-ECM tracker analysis. To determine the fidelity of the pulsed WFA-biotin to represent the present CSPG-ECM, the area percentage of colocalization of WFA-biotin (pulsed) and WFA-FITC (total CSPG-ECM present) was quantified.
[0237] To verify that the traced WFA-biotin signal represented true CSPG-ECM staining, WFA (0.3 μg / side, volume 150 nl) was stereotaxically injected bilaterally into the ARC of 8-week-old C57BL / 6J mice. Three days later, mice received a unilateral ARC injection of chABC (15 mU / side, volume 150 nl) or vehicle to disassemble the WFA-biotin-bound CSPG-ECM. To determine the specificity of the pulsed WFA-biotin, the area and intensity of WFA-biotin staining were quantified and compared in the chABC- and vehicle-treated sides of the ARC.
[0238] To determine the CSPG-ECM turnover in thin and obese mice, WFA-biotin (0.3 μg / side in a volume of 150 nl) was stereotaxically injected bilaterally into the ARC of C57BL / 6J mice fed a 12-week HFHS diet or age-matched controls. Brains were extracted one day after surgery (day 0) or 1 week, 3 weeks, 5 weeks, and 10 weeks after injection. Brain sections were stained to determine the presence of WFA-biotin and WFA-FITC, and the area of WFA-biotin staining was quantified as described above. To determine CSPG-ECM turnover, the WFA-labeled CSPG-ECM present at the beginning of the experiment (day 0) was compared with the WFA-labeled CSPG-ECM remaining at week 1, week 3, week 5, and week 10. CSPG-ECM was labeled with WFA-FITC at each time point to verify the presence of ARC CSPG-ECM and to ensure that changes in WFA-biotin labeling were not due to loss of CSPG-ECM over time. The same process was used to assess turnover in RSGs and vessels of the CC.
[0239] General Procedure Q.ARC CS-GAG and HA Quantification
[0240] Microdissected ARC tissues from male mice fed the HFHS diet for 0 and 12 weeks were placed in a 5% flask containing 8 M urea, 0.5% triton X-100, 5 mM Tris 2-carboxyethylphosphine, and no cOmplete. TM The protein extracts were incubated in an extraction buffer containing a mixture of protease inhibitors of mini ETDA (Merck) for 30 minutes, gently mixed, and then homogenized. The sample was centrifuged at 5000 rpm for 30 minutes, and the supernatant was collected and the buffer was exchanged into PBS using an Amicon Ultracell-10 kMWCO centrifuge tube. The protein concentration of each sample was estimated using Bradford assay. 20 μg of each protein extract was reduced at 50° C. using 5 mM dithiothreitol for 30 minutes, and alkylated at room temperature for one hour with 10 mM iodoacetamide, then blotted onto a 0.45 μm PVDF membrane (Millipore, catalog number IPVH20200) and dried overnight. Each sample point was transferred to a 96-well plate and blocked using a 1% (v / v) polyvinyl pyrrolidone solution.
[0241] The disaccharide analysis procedure was adapted from Moh et al., 2022 with the following modifications. GAG disaccharides were released from PVDF sample spots using an enzyme mixture containing 5 mU chondroitinase ABC (chABC; Sigma, catalog number C3667), 50 ng each of heparinase I / II / III (R&D Systems) in 100 mM ammonium acetate (pH 7), and 5 mM calcium chloride and incubated overnight at 30°C. An additional mixture of purified GAG polysaccharides containing 1 μg each of bovine kidney heparan sulfate (Sigma-Aldrich, H7640), 10 μg of shark chondroitin sulfate (Sigma-Aldrich, C4382), and 1 μg of Streptococcus equi HA (Sigma-Aldrich, 53747) was digested with the samples as an enzyme reaction control and retention time standard. The digested disaccharides were collected and dried under low pressure for labeling with 2-AB (2-aminobenzamide) according to a commercially available protocol (Ludger LT-KAB-VP24-Guide-v2.0). The samples were labeled with 2-AB along with a standard mixture of 8 common HS (Iduron, UK, HS mixture) and 8 common CS disaccharides (Iduron, UK, CS mixture) and washed twice with octanal to remove excess labeling agent. The cleaned samples in the aqueous layer were dried and resuspended in 75% acetonitrile with 10 mM ammonium acetate (pH 6.8).
[0242] The labeled disaccharides were separated by liquid chromatography using an Agilent 1260 Infinity II with fluorescence detection at 35°C using a SeQuant ZIC-HILIC column (3.5 μm, 1 mm × 150 mm). Mobile phase solvent A (10 mM NH4Ac, pH 6.8) and solvent B (90% acetonitrile in 10 mM NH4Ac, pH 6.8) were run in microflow mode at a constant flow rate of 50 μL / min with the following gradient parameters: 0-3 min – 100% B, 4 min – 90% B, 20 min – 88% B, 35 min – 70% B, 36-40 min – 60% B, 42-50 min – 100% B. Fluorescence detection was performed at excitation and emission wavelengths of 320 nm and 420 nm, respectively. Peaks were identified using standard plates and polysaccharide digestion controls as retention time references, and abundance was manually quantified by peak area.
[0243] General Procedures for R. Patch-Clamp Electrophysiology
[0244] Npy-GFP male mice are placed in HFHS diet for 12 weeks, and then stereotaxically injected with vehicle (n=4) or chABC (n=4) in ARC 3 days before electrophysiological characterization. Before brain extraction, mice are anesthetized with isoflurane, and the brain is incubated in ice-cold aCSF with the following composition: 127mM NaCl, 1.2mM KH PO , 1.9mM KCl, 26mM NaHCO , 3mM D-glucose, 7mM mannitol, 2.4mM CaCl , 1.3mM MgCl (by 95% O and 5% CO saturated, pH 7.4). Coronal slices (250 μm) of ARC are cut using a vibrating microtome (Leica VTS1000S, Germany). Slices are heated at 34°C for 30 minutes, and then cooled to room temperature before recording. Slices are placed in a recording chamber and continuously perfused with room temperature aCSF.
[0245] Npy-GFP neurons in the ARC were visualized using fluorescence and differential interference contrast optics in combination with infrared video microscopy (AxioCam MRm, Zeiss, Germany) and an upright microscope (BX51WI, Olympus, Germany). For current clamp recordings, patch pipettes (8-11 MΩ) were pulled from thin-walled borosilicate glass (Sutter Instruments, BF150-86-10) using a horizontal puller (Sutter Instruments, USA) and filled with an intracellular solution containing 140 mM K-gluconate, 10 mM HEPES, 10 mM KCl, 1 mM EGTA, 4 mM Na-ATP, 0.3 mM Na-GTP, and 10 mM biocytin (300 mOsm and pH 7.3, with sucrose and KOH used to adjust osmolarity and pH accordingly). In the voltage clamp recording of the K+ current, the patch pipette (3-6 MΩ) was filled with an intracellular solution containing 130 mM K-gluconate, 6 mM NaCl, 4 mM NaOH, 11 mM EGTA, 1 mM CaCl2, 10 mM HEPES, 1 mM MgCl2, 2 mM Na-ATP, 0.2 mM Na-GTP, 0.1% biocytin (295 mOsm and pH 7.3, with sucrose and KOH adjusting osmotic pressure and pH accordingly). Cells with series resistance>20 MΩ were not included in the analysis. Recording was performed in the presence of tetrodotoxin, starting from a holding potential of -80 mV, with 11 depolarizing pulses from -40 mV to +60 mV applied in 10 mV increments for 500 milliseconds. Any residual voltage-dependent Na+ current was inactivated using a 50 millisecond prepulse to 0 mV. Whole-cell recordings were performed using a dual IPA integrated patch amplifier controlled by SutterPatch software (Sutter Instruments, USA), with all current clamp data filtered at 5 kHz. Data were analyzed using Sutterpatch (Sutter Instruments, USA) and Clampfit 10.7 (Axon Instruments).
[0246] General procedures for S. immunoblotting
[0247] The medial basal hypothalamus was microdissected and snap-frozen in liquid N2. The tissue was mechanically homogenized in 100 μl of ice-cold RIPA lysis buffer (ab156034, Abcam, UK, containing PhosStop phosphatase inhibitors, 1 tablet / 10 mL; Roche PHOSS-RO) and clarified by centrifugation (13,000 x rpm, 20 minutes at 4°C). Tissue lysates were resolved by SDS-PAGE and immunoblotted as previously described (PMID: 31509751). The antibodies used were rabbit phospho-IR (Tyr1162, Tyr1163) polyclonal antibody (1:1000, 44-804G, Invitrogen, MA), rabbit monoclonal anti-IR (1:1000, 3025x, Cell Signaling, MA), rabbit β-actin polyclonal antibody (1:2000, 4967, Cell Signaling), mouse Gapdh monoclonal antibody (1:5000, 60004-1-Ig, Proteintech, IL), mouse monoclonal anti-tubulin (1:2000, T5168, Sigma).
[0248] General Procedure for T. real-time PCR
[0249] RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA), and total RNA quality and quantity were determined using a NanoDrop 3300 (Thermo Scientific, Wilmington, DE, USA). mRNA was reverse transcribed using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) and processed for quantitative real-time PCR using SYBR Green PCR Master Mix (4309155, Applied Biosystems, MA). The following primers were used for SYBR Green expression assays:
[0250] Adamst4(f-GAACGGTGGCAAGTATTGTGAGG(SEQ ID NO:21),
[0251] r-TTCGGTGGTTTGTAGGCAGCACA (SEQ ID NO: 22)),
[0252] Adamst5(f-CTGCCTTCAAGGCAAATGTGTGG(SEQ ID NO:23)、r-CAATGGCGGTAGGCAAACTGCA(SEQ ID NO:24))、Il-6(f-GGTGCCCTGCCAGTATTCTC(SEQ ID NO:25)、r-GGCTCCCAACCAACSEQ IDGATGAQ IDGCA(SEQ ID NO:24)) NO:26))、Kcna4(f-GCAGATTGCTGAATGACACCTCG(SEQID NO:27)、r-GGACAAGCAAAGCATCGAACCAC(SEQ ID NO:28))、Kcnb1(f-GAGGAGTTCGACAACACGTGCT(SEQ ID NO:29)、r-TGAGTGACAGGGCAATGGTGGA(SEQ ID NO:30))、Kcnb2(f-GCTGGAGAAACCTAACTCGTCC(SEQ ID NO:31)、r-CTCGTCGTTTTCTTGCAGCTCTG(SEQ IDNO:32))、Kcnc3(f-GAAGAGGTGATTGAAACCAACAGG(SEQ ID NO:33)、r-TGGGCTCTTGTCTTCTGGAGAC(SEQ ID NO:34))、Kcnc4(f-CCAGCTCGAATCGCCCATTTAC(SEQ IDNO:35)-AGCCATGCCATGCC NO:36))、Kcnd2(f-CCTACATGCAGAGCAAGCGGAA(SEQ ID NO:37)、r-GTGGTTTTCTCCAGGCAGTGAAG(SEQ ID NO:38))、Kcnd3(f-AGAAGAGGAGCAGATGGGCAAG(SEQ ID NO:39)、r-CTTGATGGTGGAGGTTCGTACAG(SEQ ID NO:40))、Kcnj11(f-TGCGTCACAAGCATCCACTCCT(SEQ ID NO:41)、r-GGACATTCCTCTGTCACCATGC(SEQ ID NO:41) NO:42))、Kcnj3(f-CAGTTCGAGGTTGTCGTCATCC(SEQ ID NO:43)、r-CCCAAAGCACTTCGTCCTCTGT(SEQ ID NO:44))、Kcnj6(f-GGAACTGGAGATTGTGGTCATCC(SEQIDNO:45)、r-TCTTCCAGCGTTAGGACAGGTG(SEQ ID NO:46))、Kcnj9(f-TCTCACCTCTCGTCATCAGCCA(SEQ ID NO:47)、r-GCTTCGAGCTTGGCACGTCATT(SEQ ID NO:48))、Kcnma1(f-CCTGAAGGACTTTCTGCACAAGG(SEQ ID NO:49)、r-ACTCCACCTGAGTGAAATGCCG(SEQ ID NO:50))、Kcnn3(f-TCCACCGTCATCCTGCTTGGTT(SEQ ID NO:51)、r-CAGGCTGATGTAGAGGATACGC(SEQ ID NO:52))、Kcnq3(f-AAGCCTACGCTTTCTGGCAGAG(SEQ ID NO:53)、r-ACAGCTCGGATGGCAGCCTTTA(SEQ ID NO:54))、
[0253] Mmp13(f-AGCAGTTCCAAAGGCTACAACT(SEQ ID NO:55)、
[0254] r-GGATGCTTAGGGTTGGGGTC(SEQ ID NO:56))、
[0255] Mmp14(f-AGCACTGGGTGTTTGACGAA(SEQ ID NO:57)、
[0256] r-CCGGTAGTACTTATTGCCCCG(SEQ ID NO:58))、
[0257] Mmp2(f-GTCGCCCCTAAAACAGACAA(SEQ ID NO:59)、
[0258] r-GGTCTCGATGGTGTTCTGGT(SEQ ID NO:60))、
[0259] Mmp9(f-GCTGACTACGATAAGGACGGCA(SEQ ID NO:61)、
[0260] r-TAGTGGTGCAGGCAGAGTAGGA(SEQ ID NO:62))、
[0261] r18s(f-CAGCTCCAAGCGTTCCTGG(SEQ ID NO:63)、
[0262] r-GGCCTTCAATTACAGTCGTCTTC(SEQ ID NO:64));
[0263] Tgfβ1(f-GGATACCAACTATTGCTTCAG(SEQ ID NO:65) .
[0264] r-TGTCCAGGCTCCAAATATAG(SEQ ID NO:66))、
[0265] Tgfβ2(f-CTAATGTTGTTGCCCTCCTACAG(SEQ ID NO:67);
[0266] r-GCACAAGTTAGCATTGTACCC(SEQ ID NO:68)) .
[0267] Tgfβr1(f-GGACCATTGTGTTACAAGAAAGC(SEQ ID NO:69) .
[0268] r-CATGGCGTAACATTACAGTCTGA(SEQ ID NO:70));
[0269] Tgfβr2(f-TCCTAGTGAAGAACGACTTGACC(SEQ ID NO:71) .
[0270] r-TACCAGAGCCATGGAGTAGACAT(SEQ ID NO:72))、
[0271] Timp1(f-TCTTGGTTCCCTGGCGTACTCT(SEQ ID NO:73);
[0272] r-GTGAGTGTCACTCTCCAGTTTGC(SEQ ID NO:74));
[0273] Timp3(f-GCTAGAAGTCAAACAAATACCAG(SEQ ID NO:75)、
[0274] r-TAGGCAGGACTTGATCTTG(SEQ ID NO:76))、
[0275] Tnfα(f-CTGTGAAGGGAATGGGTGTT(SEQ ID NO:77)、
[0276] r-GGTCACTGTCCCAGCATCTT (SEQ ID NO:78)).
[0277] Gene expression was normalized to r18s, and relative quantification was achieved using the ΔΔCT method. Reactions were performed using a BioRad CFX 384 (Bio-Rad, Hercules, CA).
[0278] General Procedure U.CSPG-ECM Binding Assay
[0279] In order to determine the interaction of insulin and CSPG-ECM components in vitro, flat-bottomed 96-well plates were first coated with 10 μg / ml poly-L-lysine overnight, followed by water rinsing. Purified CSPG mixture was coated onto 96-well plates at RT at a concentration of 10 μg / ml, for 4 hours, the mixture containing neurocan, phosphoproteoglycan, versican and aggrecan (CC117, Merck Millipore, Massachusetts), purified aggrecan (A1960, Merck Millipore, Massachusetts) or purified 4-chondroitin sulfate (S9004, Selleck Chemicals, Texas, TX)), followed by water rinsing. Insulin-FITC was incubated for 2 hours at RT in the range of 5 ng / ml-1 mg / ml on a plate containing ECM, and protected from light. Control wells were free of ECM, bovine serum albumin (10 μg / ml) or contained poly-L-lysine separately. The wells were washed three times with water and imaged at 495 nm using a SPECTROstar Nano microplate reader (BMG Labtech, Germany). To digest or eliminate the negative charge of CSPG-ECM, after ECM coating, the wells were incubated with chABC (0.5 U / ml) or poly-l-arginine (10 μg / ml, P7762, Merck Millipore, MA) at 37° C. for 1 hour, washed three times with water, and then incubated with insulin-FITC.
[0280] General Procedures Q. Statistical Analysis
[0281] Statistical significance was determined by one-way or two-way ANOVA with multiple comparisons or repeated measures, or one-tailed or two-tailed paired Student's t test or ANCOVA (as appropriate), or simple linear regression. p < 0.05 was considered significant: *p < 0.05, **p < 0.01, and ***p < 0.001. Statistical details of the individual experiments, such as the exact value of n and the exact statistical test, can be found in the figures and legends.
[0282] result
[0283] Example 1. Unique CSPG-ECM exists within ARC
[0284] To identify CSPG-ECM in the hypothalamus, immunostaining was performed using Wisteria flos flos agglutinin (WFA), a lectin that selectively binds to N-acetylgalactosamine residues on the chondroitin sulfate (CS) chains of CSPG-ECM. CSPG-ECM expression was detected throughout the rostral-caudal extent of the medial basal hypothalamus in mice ( Figure 1 ac). There is a prominent expression of CSPG-ECM in ARC ( Figure 1 ac), with expression in the adjacent ventromedial hypothalamus being notably and significantly reduced (VMH, -90.2 ± 2.2%). CSPG-ECM in the brain canonically surrounds and regulates parvalbumin cortical neurons. In the retrosplenial cortex (RSG), CSPG ECM was observed to surround 89.5 ± 4.3% of parvalbumin neurons. However, cells surrounded by CSPG-ECM in the ARC were not parvalbumin-positive, and there were clear differences between the CSPG-ECM present in the ARC and the conventional CSPG-ECM in other brain regions.
[0285] Example 2. Neurofibrosis with ARC develops during progression of metabolic disease
[0286] To explore the effects of obesity on ARC CSPG-ECM, expression was quantified in C57BL / 6J mice fed a high-fat, high-saccharide (HFHS) diet for 12 weeks, resulting in diet-induced obesity and insulin resistance. The area and intensity of ARC CSPG-ECM expression were robustly increased throughout the craniocaudal region in obese mice compared to lean, age-matched mice ( Figure 1 ac). This finding is highly robust (n=45) and was observed in several independent experiments. Figure 1 No increase in CSPG-ECM after HFHS diet was observed in the gi or RSG, suggesting that obesity-driven CSPG-ECM remodeling occurs specifically within the ARC.
[0287] To explore whether the glycan composition of the ARC CSPG-ECM is also remodeled, glycomics was used to quantify the sulfation of the chondroitin sulfate glycosaminoglycan (CS-GAG) side chains. CS-GAG side chains are regulated by sulfotransferases, which add sulfate groups to CS-GAG at different sites that regulate biological functions. CS-GAG sulfation occurs at the C4 or C6 position of N-acetylgalactosamine (CS-4S and CS-6S, respectively) or at the C2 position of glucuronic acid (CS-2S). CS-GAG chains can also be non-sulfated (CS-0S) or exist through a combination of sulfation patterns. It was identified that the major CS-GAG sulfation in ARC is CS-4S ( Figure 1 d). In the ARC of obese mice, significant changes in the abundance of CS-GAG sulfation were observed, with increases in ΔCS-4S, ΔCS-0S, and ΔCS-2S6S. There was no effect on ΔCS-4S6S expression ( Figure 1 d), which is consistent with the increase of CSPG-ECM detected by immunohistochemistry.
[0288] To determine the validity of this phenomenon, CSPG-ECM expression was quantified in several independent dietary and genetic mouse models of obesity. Consistent increases in CSPG-ECM expression were observed in the ARC of obese Sprague-Dawley rats and obese BALB / cJ mice fed a high-fat, high-cholesterol diet. Increases in CSPG-ECM were also present in both single-gene (leptin receptor deficiency, db / db) and polygenic (New Zealand obesity) mouse models of metabolic disease, indicating that CSPG-ECM remodeling is observed in many obesity and metabolic disease models.
[0289] The development of deleterious metabolic adaptations drives metabolic disease progression following both acute and chronic HFHS diet consumption. Defects in ARC neuron signaling have been reported 72 hours after ingestion of an obesity-promoting diet (Olofsson et al., 2013), tissue-specific insulin resistance disappears within one to three weeks, and obesity propensity increases, with these effects progressively worsening over time. To identify the temporal pattern of CSPG-ECM remodeling during the progression of metabolic disease, ARC CSPG-ECM content was determined in mice fed a HFHS diet for 3 days, 1 week, 4 weeks, 8 weeks, and 12 weeks. CSPG-ECM expression was significantly elevated within 4 weeks of HFHS feeding and further increased at 8 and 12 weeks ( Figure 1e, f). These effects are associated with key pathophysiological markers of metabolic diseases (such as increased weight, increased obesity tendency, and impaired glycemic control). During the development of metabolic diseases, the excessive deposition and remodeling of CSPG-ECM in the ARC observed is what the inventors refer to as a phenomenon of neurofibrosis.
[0290] Example 3. Aggrecan is a key CSPG species underlying neurofibrosis in ARC
[0291] The CSPG-ECM consists of four core components: 1) CS-GAG chains; 2) CSPG core proteins to which the CS-GAG chains are covalently bound; 3) a hyaluronic acid (HA) backbone; and 4) linkers and glycoproteins that stabilize CSPG aggregates. To explore how the composition of the ARC CSPG-ECM is remodeled in neurofibrosis, the extent of changes in the HA backbone was first determined. Using biotinylated HABP, heterogeneous staining of HA was noted throughout the brain parenchyma, with almost complete colocalization of WFA in the ARC (96 ± 4.5%). Consistent with obesity-promoting neurofibrosis within the ARC, both the area and intensity of staining of the HA backbone increased, consistent with the increased HA abundance observed in the ARC GAG profile ( Figure 1 d). Notably, changes in ARC HA expression occurred in non-CSPG-ECM regions of the ARC, likely reflecting a role for the HA backbone in supporting other ECM components.
[0292] The increase in HA backbones within the ARC of diet-induced obese mice occurred in conjunction with a significant increase in the abundance of hyaluronan and a proteoglycan linking protein (HAPLN1) within the ARC. These linking proteins serve to bind CSPGs to the HA backbone and are widely expressed throughout the hypothalamus, indicating a function for the ECM outside of the ARC CSPG-ECM. Similarly, the CSPG cross-linking glycoprotein, tenascin C, also showed increased staining intensity within the ARC of obese mice. The increased staining intensity contributes to the ARC CSPG-ECM, but tenascin C is also expressed throughout other hypothalamic regions, indicating non-ARC CSPG-ECM-specific expression.
[0293] To identify the relevant CSPGs present in the ARC CSPG-ECM, we next stained for versican, phosphocan, neurocan, brevican, and aggrecan (the major CSPG components expressed in the CSPG-ECM elsewhere in the brain). Although all CSPG components were present to some extent in the ARC, aggrecan (91.5 ± 3.1%, Figure 1g, j, k) mainly colocalized with WFA in the ARC, where other CSPG components exhibited a spatial pattern distinct from that of the ARC WFA-labeled CSPG-ECM ( Figure 1 g, jk). Obesity also promotes enhanced expression of versican, neurocan, brevican, and aggrecan in the ARC region ( Figure 1 gi), however, phosphoproteoglycan expression did not change. Furthermore, during the development of obesity, increased expression of aggrecan occurred within a time frame similar to that of WFA-labeled CSPG-ECM ( Figure 1 m, n). Taken together, these results indicate that obesity promotes an increase in most major ECM components, but aggrecan is the privileged CSPG species that supports neurofibrosis in the ARC.
[0294] Example 4. CSPG-ECM Tracker: A New Tool for Determining Site-Specific CSPG-ECM Turnover
[0295] CSPG-ECM is described as exhibiting a slow biological turnover rate and persisting in adult tissues for months to years. Our results suggest that after exposure to an obesogenic diet, the ARC undergoes relatively rapid remodeling and expansion of its CSPG composition ( Figure 1 To explain this, we hypothesized that i) the turnover rate of CSPG-ECM in the ARC is different from that in other brain regions, and ii) the turnover rate of CSPG-ECM in the ARC is impaired in obesity, leading to enhanced CSPG-ECM deposition and neurofibrosis.
[0296] To experimentally determine the turnover rate of CSPG-ECM in vivo, a novel technology called "CSPG-ECM tracker" was developed ( Figure 2 a). The CSPG-ECM tracker is a "pulse-chase" method that utilizes stereotactic injections of biotinylated WFA (WFA-biotin) to "pulse" and label CSPG-ECM in the brain region of interest. After the in vivo incubation period, the brain is extracted and processed ex vivo to determine the presence of WFA-biotin to "chase" the labeled CSPG-ECM remaining from the time of injection (day 0). Sections are simultaneously co-stained with WFA-FITC to reveal total CSPG-ECM expression at the time of "chase". Areas of CSPG-ECM that are positive for WFA-biotin represent matrix that is still present from day 0, while areas that express only WFA-FITC are simply new matrix synthesized after day 0 ( Figure 2 a).
[0297] To validate this method as a bona fide tracker of CSPG-ECM turnover, we first determined the extent to which intra-ARC injected WFA-biotin faithfully labeled CSPG-ECM within the ARC ( Figure 2 To this end, ARC was unilaterally "pulsed" with WFA-biotin or saline in adult chow-fed mice, and expression was tracked one day later ( Figure 2 b, c). Using this approach, we identified almost complete co-expression of pulsed WFA-biotin with WFA-FITC (total CSPG-ECM), indicating that the CSPG-ECM tracker faithfully labels CSPG-ECM in the ARC in vivo ( Figure 2 d). WFA-positive spots outside the ARC indicate that WFA-biotin leaks into the circulation and binds to CSPG-ECM expressed in blood vessels ( Figure 2 c).
[0298] To verify that the "pulsed" WFA-biotin signal faithfully binds to and labels the CSPG-ECM present only at the time of injection, and is not the rebinding of free WFA-biotin to newly synthesized CSPG-ECM, the ARC of mice fed an adult diet were bilaterally pulsed with WFA-biotin, and three days later the CSPG-ECM in the ARC was digested with chondroitinase ABC (chABC), an enzyme that specifically digests CSPG-ECM. Compared to the vehicle, enzymatic digestion of the "pulsed" WFA-biotin-bound CSPG-ECM was completely abolished after chABC treatment, indicating that WFA-biotin only binds to the CSPG-ECM components present at the time of the pulse injection. The CSPG-ECM tracker is the first feasible method to assess the in vivo turnover of CSPG-ECM in a brain region-specific manner.
[0299] Example 5. ARC CSPG-ECM exhibits dynamic and rapid turnover
[0300] To determine basal CSPG-ECM turnover within the ARC, WFA-biotin was “pulsed” into the ARC of adult chow-fed mice and its expression was “tracked” at 0, 1, 3, 5, and 10 weeks post-injection ( Figure 2 e). Using a CSPG-ECM tracker, we identified that CSPG-ECM within the ARC of chow-fed C57BL / J mice exhibited a 5-week turnover period characterized by a temporal decrease in CSPG expression at 1 and 3 weeks post-injection ( Figure 2f, g). To assess whether CSPG-ECM turnover is consistent in other brain regions, WFA-biotin was "pulsed" into the RSG of mice fed an adult diet, and its expression was "tracked" at 0 and 5 weeks after injection. Unlike in the ARC, CSPG-ECM in the RSG was still present at five weeks, despite a 61% reduction. Significant CSPG-ECM expression was further identified in the blood vessels adjacent to the corpus callosum, which did not show degradation within a 5-week period after injection. These results indicate that the ARC exhibits a unique rapid degradation rate of CSPG-ECM and sets a precedent for differentiated ECM turnover throughout the brain.
[0301] Example 6. Impaired CSPG-ECM turnover in obesity drives neurofibrosis
[0302] We hypothesized that neurofibrosis in the ARC is due to attenuated CSPG-ECM degradation. To test this, we pulsed WFA-biotin into the ARC of obese mice and tracked its expression at 0, 1, 2, 5, and 10 weeks post-injection. Figure 2 e, f). As expected, there was higher CSPG-ECM expression in the obese ARC compared to lean age-matched controls, recapitulating the above findings that obesity drives neurofibrosis in the ARC ( Figure 1 ). It was determined that the rate of CSPG-ECM degradation in the ARC of obese mice was significantly reduced compared to lean mice (lean = 2.6% / day vs. obese = 0.1% / day, Figure 2 G). This reduction in CSPG-ECM turnover causes the presence of WFA-biotin in the ARC up to 10 weeks after injection, which is twice that seen in lean mice (5 weeks). These results identify that neurofibrosis is driven by reduced CSPG-ECM degradation and illustrate the significant deformation of the CSPG-ECM in the ARC during the development of metabolic diseases.
[0303] To further elucidate the molecular mechanisms behind obesity-driven alterations in CSPG-ECM turnover, we quantified the gene expression of established ECM synthesis / degradation enzymes in the medial basal hypothalamus of lean versus obese mice. ECM composition and remodeling are tightly controlled by the balance of matrix metalloproteinases (MMPs), proteolytic enzymes known to degrade ECM, and their inhibitors, tissue inhibitors of metalloproteinases (TIMPs). Significant reductions in the expression of several key ECM proteases (Adamst4, Adamst5, Mmp2, Mmp9, Mmp13, Mmp14) were observed in the medial basal hypothalamus of obese mice ( Figure 2h). In contrast, elevated expression of TIMPs (Timp1 and Timp3) was also observed, which may promote neurofibrosis by inhibiting MMPs ( Figure 2 h). In addition, elevated expression of profibrotic inflammatory factors Tnfα, Tgfβ1, Tgfβ2, Tgfβr1, Tgfβr2, and Il6 was observed ( Figure 2 h), said profibrotic inflammatory factors are established regulators of fibrosis in peripheral tissues.
[0304] Example 7. Neurofibrosis occurs around AgRP neurons in the ARC
[0305] The ARC contains two metabolic-related neuronal populations, called agouti-related peptide (AgRP) neurons and pro-opiomelanocortin (POMC) neurons. AgRP and POMC neurons are well-established neuronal populations within the ARC that are crucial for the regulation of metabolism and play a central role in the development of metabolic diseases. Using Npy-GFP (labeling AgRP neurons) and Pomc-GFP mice, we identified that under chow-fed conditions, 44% ± 13% of AgRP neurons in the ARC ( Figure 3 a, b) and 24% ± 9% of POMC neurons ( Figure 3 d, e) were encapsulated in CSPG-ECM. It was determined that after 4 weeks of HFHS feeding, the amount of AgRP encapsulated in CSPG-ECM was significantly more (60% ± 6%, Figure 3 a, b), but POMC neurons (23% ± 5%, Figure 3 After 12 weeks of HFHS feeding, further recruitment of AgRP neurons was noted (78% ± 7%; Figure 3 a, b), while the surrounding WFA staining is enhanced ( Figure 3 c), there is no such effect around POMC neurons ( Figure 3 f) and was independent of changes in neuronal number.
[0306] Earlier, enhanced abundance of aggrecan was identified as a constitutive hallmark of neurofibrosis within the ARC ( Figure 1 Consistent with this, aggrecan-positive CSPG-ECM was detected around AgRP neurons in chow-fed mice ( Figure 3 As expected, aggrecan-positive CSPG-ECM coated AgRP neurons to a similar extent as WFA and exhibited similar recruitment of AgRP during the development of neurofibrosis ( Figure 3 Collectively, these results suggest that neurofibrosis develops around metabolism-associated AgRP neurons in the ARC during the progression of metabolic disease.
[0307] Obesity affects the intrinsic excitability of AgRP neurons, as both firing rate and resting membrane potential are increased after prolonged high-fat feeding. Furthermore, removal of CSPG-ECM expressed around cortical and brainstem neurons reduces membrane excitability, as evidenced by a decrease in firing rate. Therefore, the effects of CSPG-ECM recruitment on AgRP neuron function were investigated using whole-cell patch clamp electrophysiology. At 12 weeks of HFHS feeding, more than 82% of AgRP neurons spontaneously fired ( Figure 3 j), whereas when chABC was used to disassemble the CSPG-ECM within the ARC, spontaneous firing was reduced to 33% ( Figure 3 j). This is consistent with the significant decrease in discharge frequency ( Figure 3 k, l), a trend of decreasing resting membrane potential was also observed ( Figure 3 m, p=0.065), supporting the role of ARCC SPG-ECM in regulating the intrinsic electrophysiological properties of AgRP neurons.
[0308] Example 8. Ablation of ARC Neurofibrosis Protects Against Obesity
[0309] Obesity is characterized by an increased tendency to adiposity and impaired glycemic control, effects that are caused by hyperphagia, reduced adaptive thermogenesis, and insulin resistance. The functional contribution of ARC neurofibrosis to the development of metabolic diseases is unclear. To address this issue, chABC was used to selectively disassemble CSPG-ECM within the ARC of obese HFHS-fed mice. Intra-ARC delivery of chABC significantly reduced the expression of CSPG-ECM within the ARC ( Figure 4 a). Notably, disassembly of the ARC CSPG-ECM in obese mice promoted progressive and substantial weight loss ( Figure 4 b), which was due to a significant reduction in obesity tendency (24 ± 16%; Figure 4 c) mediated. Changes in body mass and composition were due in part to a substantial reduction in caloric intake, as mice lacking CPSG-ECM in the ARC consumed significantly less food than HFHS-fed controls ( Figure 4 d) Ablation of neurofibrosis regulates food intake by promoting satiety without inducing non-food-specific adverse behaviors such as nausea, excessive grooming, or sedation.
[0310] To explore the extent to which suppression of feeding contributes to weight loss, vehicle-treated mice were pair-fed so that they consumed the same amount of food as mice lacking CSPG-ECM in the ARC, and the effects on body weight and obesity propensity were assessed. Figure 4 e) and fat body mass reduction ( Figure 4f), although not to the extent observed in mice treated ad libitum with chABC ( Figure 4 e, f). This suggests that chABC-mediated suppression of food intake partially explains the effects on body weight loss. Despite these effects, significant differences remained between pair-fed vehicle compared to ad libitum fed chABC-treated mice, suggesting that calorie intake alone cannot explain the differences in body weight and may include a contribution from energy expenditure ( Figure 4 g) Using indirect calorimetry to measure energy expenditure, mice lacking CSPG-ECM in the ARC exhibited elevated whole-body energy expenditure and oxygen consumption, with no effects solely on substrate partitioning or ambulatory activity.
[0311] Consistent with the increase in energy expenditure, a significant upregulation of adipose tissue thermogenesis was also observed in both inguinal white adipose tissue (ingWAT) and brown adipose tissue (BAT) depots following intra-ARC chABC treatment ( Figure 4 hk). Disassembly of CSPG-ECM in the ARC of diet-induced obese mice was accompanied by increased browning of ingWAT, as assessed by: (1) gross morphology ( Figure 4 h) and histology, monitoring the presence of multi-locular lipid droplets ( Figure 4 i); (2) Immunofluorescence, monitoring UCP-1 positive adipocytes ( Figure 4 i); and (3) increased skin ingWAT temperature ( Figure 4 j, k). In addition, chABC treatment also increased skin BAT temperature, indicating substantial activation of adaptive thermogenesis.
[0312] Elimination of ARC neurofibrosis was also accompanied by significant improvement in glucose homeostasis, as evidenced by a reduction in glycemic excursions during glucose tolerance testing ( Figure 4 l) and fasting blood glucose, as well as reductions in circulating insulin and the HOMA-IR (homeostasis model assessment of insulin resistance) index (as a measure of whole-body insulin resistance) Figure 4 m). Importantly, these tests were performed before the onset of significant effects on body weight 4 days after chABC, indicating that the direct effects of neurofibrosis elimination on glucose metabolism were independent of changes in body weight.
[0313] To further explore the role of ARC neurofibrosis in the development of systemic insulin resistance, whole-body insulin sensitivity and glycemic control were assessed using a hyperinsulinemic euglycemic clamp in weight-matched mice. The glucose infusion rate (GIR) required to maintain euglycemia during the clamp was significantly increased in mice treated with chABC within the ARC, consistent with improved whole-body insulin sensitivity after ablation of ARC neurofibrosis. Figure 4n). Improvement in insulin sensitivity is achieved through increased suppression of endogenous glucose production ( Figure 4 o) and glucose disposal rate, which are corresponding measures of hepatic gluconeogenesis and bone glucose uptake. Enhanced glucose uptake was observed in skeletal muscle, however, this effect was not present in epididymal white adipose tissue, heart, or brain ( Figure 4 p). It has been previously shown that ARC neurons coordinate glucose metabolism through thermogenesis in ingWAT and BAT. Consistent with this regulation, disassembly of neuropil within the ARC promotes glucose uptake in BAT and ingWAT ( Figure 4 The beneficial effects of intra-ARC injection of chABC on body weight, obesity tendency, glycemic control, and insulin resistance were also reproduced in genetically severely obese and type 2 diabetic db / db mice treated with chABC ( Figure 4 qt), further confirming the causal role of ARC neurofibrosis in the development of metabolic diseases.
[0314] Taken together, these results demonstrate that the brain's ECM exhibits a profound and unprecedented causal role in the development of metabolic disease. These studies link the generation of neurofibrosis within the ARC to the progression and maintenance of metabolic disease through the development of hyperphagia, systemic insulin resistance, increased obesity, and impaired adaptive thermogenesis. Notably, disassembly of neurofibrosis within the ARC resulted in weight loss and reversal of key metabolic disease phenotypes.
[0315] Example 9. Neurofibrosis blocks insulin entry into the ARC and promotes neuronal insulin resistance
[0316] Given the association between fibrosis and insulin resistance in peripheral tissues, we hypothesized that accumulated CSPG-ECM might impede insulin delivery from the circulation into the ARC and that this might represent a novel mechanism underlying insulin resistance. To explore this, vehicle or chABC was administered bilaterally into the ARC of obese and chow-fed mice fed a 12-week HFHS diet, and its effects on insulin receptor activation were assessed. Figure 5 As expected, systemic insulin administration in chow-fed mice induced robust expression of phosphorylated AKT (p-AKT) within the ARC. This effect was significantly attenuated in obese mice, suggesting that obesity drives the development of insulin resistance within the ARC ( Figure 5 b, c). Disassembly of the ARC CSPG-ECM in obese mice rapidly improved insulin resistance within ARC neurons, as evidenced by the expression of p-AKT in the ARC two days after chABC injection (before any effect on body weight) and eight days after chABC injection. Figure 5 b, c) and restoration of both insulin receptor phosphorylation ( Figure 5 b, c).
[0317] The CSPG-ECM in the brain regulates neuronal function by physically hindering the contact and interaction of extracellular molecules with target cells. Therefore, it was hypothesized that obesity-driven neurofibrosis within the ARC CSPG-ECM may mechanistically promote insulin resistance by preventing insulin from reaching neurons within the ARC. To explore this, fluorescein isothiocyanate-labeled insulin (insulin-FITC) was peripherally administered, and insulin entry and signaling in the ARC in lean mice versus obese mice were quantified ( Figure 5 d). Robust insulin-FITC appearance and internalization were observed in the ARC of lean mice ( Figure 5 e.g.), followed by p-AKT signaling, confirming that circulating insulin enters and signals directly to cells in the ARC ( Figure 5 eh). Impaired incorporation of insulin-FITC into obese mice ( Figure 5 e.g.), this effect was accompanied by a corresponding decrease in insulin-induced p-AKT signaling ( Figure 5 e, h). Notably, CSPG-ECM disassembly in the ARC of obese mice restored insulin entry into the ARC, similar to that observed in lean mice ( Figure 5 eh), and thereby restored insulin-induced p-AKT signaling ( Figure 5 eh).
[0318] To examine whether neurofibrotic obstruction of insulin transport is mediated by CSPG-ECM surrounding the blood-brain barrier (BBB), insulin-FITC was infused into the cerebrospinal fluid, thereby bypassing the BBB. Here, insulin-FITC entered the ARC of lean mice, an effect that was dramatically attenuated in obese mice and rescued after CSPG-ECM disassembly. Taken together, these results suggest that neurofibrotic CSPG-ECM within the ARC, but not within the BBB, impedes insulin entry into the ARC, thereby promoting insulin resistance. CSPG-ECM regulation of insulin-FITC entry into the ARC is an insulin-specific effect.
[0319] To gain insight into how neurofibrosis impedes insulin infiltration and signaling within the ARC, an in vitro binding assay was performed to assess insulin-ECM interactions. Insulin-FITC was incubated for 2 h on plates coated with mixed CSPGs (aggrecan, neurocan, phosphocan, and versican) or specific core CSPG-ECM components that constitute neurofibrosis (aggrecan or chondroitin-4-sulfate). Figure 5i). Specific dose-dependent binding of insulin-FITC to mixed CSPGs, aggrecan, and C4S was observed, an effect that was abolished in the presence of chABC ( Figure 5 j). To mechanistically explain the interaction between ECM and insulin, it was hypothesized that the highly negative charge of sulfated GAGs attached to CSPGs hinders ligand-receptor binding. To explore this, insulin-FITC was incubated with the CSPG mixture in the presence of polyarginine (a positively charged peptide that neutralizes the negative charge of CSPG). It was found that in the presence of polyarginine, the insulin-ECM interaction was significantly reduced, indicating that the negative charge of GAGs in the CSPG-ECM also regulates the insulin-ECM interaction ( Figure 5 j).
[0320] Putative potassium (K+) currents were detected in AgRP neurons in the ARC. To determine whether an increase in the ability of insulin to access and signal to ARC neurons underlies neuropil-mediated regulation of AgRP membrane excitability ( Figure 3 jm), whole-cell electrophysiology was performed. Activation of K+ channels on AgRP neurons is known to hyperpolarize the resting membrane potential, leading to a decrease in firing rate. To directly address the potential role of neurofilaments in regulating K+ currents in AgRP neurons, current-voltage relationships were examined in the presence of tetrodotoxin. Following neurofilament removal, firing rate and membrane potential were reduced in AgRP neurons of diet-induced obese mice ( Figure 3 jm), it was observed that the current-voltage curve shifted upward, indicating that K+ current enhanced. In order to determine the contribution of the improvement of insulin signaling after neurofibrosis removal to the regulation of K+ current, gene expression analysis was performed in the medial base of the hypothalamus to several K+ channels known to be present in AgRP / Npy neurons. In diet-induced obese mice, after ARC CSPG-ECM digestion, the upregulation of several K+ channels was demonstrated. In order to determine whether these changes are due to the improvement of insulin contacting these neurons and regulating the activity of K+ channels, an insulin receptor antagonist (S961) was utilized. It has been shown that S961 weakens the upregulation of K+ channels after neurofibrosis elimination, revealing the insulin receptor-dependent regulation of neuronal activity after ARC CSPG-ECM digestion.
[0321] Collectively, these findings demonstrate that ARC CSPG-ECM directly interacts with insulin and that the development of neurofibrosis promotes insulin resistance and AgRP excitability by impairing the ability of insulin to reach and signal to key ARC neuronal populations.
[0322] Example 10. ARC neurofibrosis promotes metabolic disease through dysfunctional AgRP-insulin signaling
[0323] Since neurofibrosis occurs specifically around AgRP neurons ( Figure 4 ), hypothesized that impaired insulin signaling within AgRP neurons might be the cell type behind these effects. To determine whether the development of neurofibrosis around AgRP neurons drives changes in neuronal circuits controlling metabolism, the expression of AgRP peptide was examined within ARC terminals that project to the paraventricular hypothalamus (PVH). This ARC AgRP to PVH circuit is a well-established output of AgRP neurons to regulate metabolism and glycemic control. It was observed that AgRP peptide expression innervating the PVH was significantly increased in obese mice compared to lean mice, an effect that was reversed after attenuation of neurofibrosis. The reduction in AgRP peptide expression and the subsequent reduction in AgRP inhibition of the melanocortin circuit of the PVH could explain how neurofibrosis around AgRP neurons propagates metabolic dysfunction.
[0324] To define the causal role of neurofibrosis in driving impaired AgRP insulin signaling, a mouse model was generated that was able to conditionally delete the insulin receptor in AgRP neurons in a state of adult diet-induced obesity. Using CRISPR gene editing, two guide RNAs (sgRNAs) were identified that target the proximal region of exon 2 of the mouse insulin receptor (InsR) gene. In the presence of the Cas9 endonuclease, these sgRNAs excised a region of approximately 82 bp of InsR exon 2, resulting in almost complete ablation of IR protein expression. An AAV expressing the two IR sgRNA sequences as well as Cre-dependent mCherry was then constructed to report AAV-transduced neurons (gIR-AAV, Figure 6 a). To target CRISPR-mediated excision of IR in AgRP neurons, Agrp-IRES-Cre was crossed with Rosa26-LSL-Cas9-GFP knock-in mice to generate AgRP-Cas9 (Agrp-IRES-Cre; Rosa26-LSL-Cas9-GFP) mice, which express Cas9 and GFP specifically in AgRP neurons. To examine the efficacy of CRISPR-mediated destruction of InsR in AgRP neurons in vivo, AAV-gIR or scrambled sgRNA control AAV (AAV-g scrambled) was bilaterally injected into the ARC of 12-week-old adult AgRP-Cas9 mice. Successful CRISPR-mediated destruction of InsR was confirmed by the presence of an approximately 419 bp PCR product (ΔInsr) in the medial basal hypothalamus of AgRP-Cas9 mice. CRISPRCRISPR-mediated disruption of the IR in AgRP neurons resulted in impaired insulin signaling, further validating efficient AgRP-specific disruption of IR expression.
[0325] To define the contribution of AgRP-IR signaling to the neurofibrotic attenuation of systemic metabolism, AAV-gIR or AAV-scrambled was injected bilaterally into the ARC of obese 12-week-old AgRP-Cas9 mice ( Figure 6 b). One week later, mice received bilateral intra-ARC chABC or vehicle administration to disassemble neurofibrosis within the ARC. Replicating previous findings, chABC treatment in the ARC of diet-induced control (AAV-g scrambled) AgRP-Cas9 mice promoted weight loss ( Figure 6 c) Reduced tendency to obesity ( Figure 6 d) Reduced calorie intake ( Figure 6 e) Increased energy consumption ( Figure 6 f) and improved blood sugar control ( Figure 6 g, h). Notably, all effects on systemic metabolism depended on functional insulin receptor signaling in AgRP neurons, as it was significantly attenuated in chABC-treated AAV-IR AgRP-Cas9 mice ( Figure 6 In summary, obesity-driven neurofibrosis promotes the development of metabolic diseases through impaired insulin signaling in AgRP neurons. Furthermore, degradation of ARC neurofibrosis improves systemic metabolism and glycemic control, at least in part, by restoring insulin receptor signaling within AgRP neurons.
[0326] Example 11. Pharmacological Attenuation of Neurofibrosis Promotes Weight Loss in Obesity
[0327] Targeting the ECM surrounding metabolic neural circuits, rather than the cells themselves, offers a unique therapeutic strategy. The major therapeutic challenge in targeting the ECM lies in the development of small molecule inhibitors that can reverse the fibrotic ECM. Although the enzyme chABC effectively digests CSPG-ECM and ameliorates neurofibrosis when injected into discrete brain regions, its enzymatic activity is rapidly depleted at body temperature. Therefore, its therapeutic capacity is limited. To explore the pharmacological feasibility of targeting neurofibrosis within the brain, a recently characterized small molecule inhibitor, fluoxamine (per-O-acetylated-4-FN-acetylglucosamine), was used. Fluoxamine is a competitive inhibitor of 4-epimerase, an essential enzyme that produces the nucleotide sugar substrate UDP-N-acetylgalactosamine, which is required for the assembly and elongation of CS-GAG chains on CSPGs. To directly target the brain, fluoxamine was delivered intracerebroventricularly (ICV, bypassing effects on peripheral tissues) to obese mice for 10 days ( Figure 7 a). Using WFA immunostaining, it was observed that fluoxetine treatment significantly attenuated neurofibrosis in the ARC ( Figure 7 b, c). Central fluoxetine administration did not reduce CSPG-ECM in other brain regions (such as the RSG cortex) and, at the highest dose, only partially attenuated expression in the habenula, an effect that may be explained by the rapid turnover of CSPGs in the ARC. Consistent with enzymatic CSPG-ECM disassembly in the ARC, central fluoxetine treatment promoted weight loss ( Figure 7 d), reduced the tendency to obesity ( Figure 7 e), enhanced energy expenditure independent of ambulatory activity ( Figure 7 f), inhibiting food intake by enhancing satiety ( Figure 7 g), and improved glucose tolerance ( Figure 7 h). In addition, fluoxetine treatment enhanced insulin-induced p-AKT signaling in the ARC, indicating a significant restoration of ARC insulin sensitivity ( Figure 7 i, j). Mechanistically, fluoxetine enhances systemic insulin sensitivity ( Figure 7 k), hepatic glucose production and tissue-specific glucose uptake (i.e., in skeletal muscle, BAT, and ingWAT) to improve glycemic control, as assessed using a hyperinsulinemic euglycemic clamp in weight-matched obese mice. In a mouse model of late-stage type 2 diabetes (HFHS plus low-dose streptozotocin treatment, Figure 7 The efficacy and ability of fluoxetine treatment to promote remission of metabolic diseases was also observed in Figures 1, 2, and 3, further demonstrating the utility of targeting neurofibrosis to treat different stages of T2D progression.
[0328] Although fluramine and chABC differ in their mechanisms of disassembling CSPG-ECM, fluramine phenocopies the effects of chABC on metabolism. Consistent with this, we explored the extent to which the effects of fluramine on metabolism are mediated through AgRP insulin receptor signaling. To address this question, AAV-gIR or AAV-g scrambled sequences were injected bilaterally into the ARC of obese 12-week-old AgRP-Cas9 mice, and one week later, vehicle or fluramine (100 μg / animal, ICV) was delivered daily for 10 days ( Figure 7 n). Replicating previous findings, fluoxetine treatment promoted weight loss in control AAV-g scrambled, AgRP-Cas9 mice ( Figure 7 o), reduced obesity tendency, and reduced calorie intake ( Figure 7 p), enhanced energy expenditure independent of ambulatory activity ( Figure 7 q), and improved blood sugar control ( Figure 7 These positive metabolic consequences of fluoxetine treatment were at least partially mitigated in AAV-IR AgRP-Cas9 mice, suggesting that a requirement for insulin receptor signaling in AgRP neurons mediates the sequelae of fluoxetine-induced metabolic benefits ( Figure 7 or).
[0329] To facilitate therapeutic translation to humans, intranasal delivery of fluramide was explored as a possible route of administration to ensure targeted delivery of neurofibrosis inhibitors to the brain. To determine whether neurofibrosis inhibitors could be successfully delivered intranasally, biotin-conjugated fluramide molecules were intranasally administered to C57BL / 6J mice, and their biodistribution throughout the brain was determined ( Figure 8 a, b). A large amount of fluoroquinolone accumulation was detected in the brain, with a significant accumulation in the ARC ( Figure 8 b), indicating that fluoxetine was successfully delivered to the site of neurofibrosis. To determine the efficacy of brain-targeted delivery of neurofibrosis inhibitors for the treatment of metabolic diseases, fluoxetine was delivered intranasally to diet-induced obese mice for 14 days ( Figure 8 c). Intranasal delivery of fluramide successfully attenuated ARC neurofibrosis ( Figure 8 d, e) and replicated the systemic metabolic improvements observed with intraventricular delivery ( Figure 8 These effects may be mediated by enhanced insulin signaling to neurons within the ARC ( Figure 8 m, n).
[0330] Taken together, these results further confirm the role of neurofibrosis in the development of central insulin resistance and systemic metabolic dysfunction.
[0331] Example 12. Intranasal delivery of biotin-conjugated fluoroamine (PZ6005) to the brain
[0332] PZ6005 conjugated with biotin (PZ6005-biotin) or unconjugated PZ6005 ( Figure 8 a) Intranasal delivery to mice for 3 days and subsequent quantification of biotin-streptavidin signal. Compared to the control group, high biotin ( Figure 8 Significant biotin expression was also observed in the lungs of PZ6005-biotin-treated mice ( Figure 8 fh). However, this was to a much lesser extent than that seen in the ARC (quantitative). These results indicate that PZ6005-biotin can be delivered to the ARC and lungs via intranasal administration.
[0333] Example 13. Intranasal administration of flutamide (PZ6005) attenuates CSPG-ECM expression in the ARC
[0334] To determine whether intranasally administered PZ60005 inhibits ARC CSPG-ECM expression, obese mice fed a 12-week HFHS diet were subjected to intranasal administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day) for 14 days ( Figure 9 a), and quantitative WFA immunostaining of CSPG-ECM expression in ARC ( Figure 9 b). Both doses of intranasal PZ6005 treatment robustly reduced the area and intensity of ARC CSPG-ECM. The CSPG-ECM area of the 1 mg and 5 mg treatment groups was 13.54±1.03% and 13.59±4.09% lower than that of the control, respectively ( Figure 9 c, d). In the 1 mg treatment, the intensity was reduced by 15.94±7.17%, and further reduced by 30.16±1.52% in the highest dose of intranasal PZ6005 treatment ( Figure 9 e, f). These results indicate that intranasal administration of PZ60005 dose-dependently reduces ARC CSPG-ECM expression and attenuates obesity-driven ARC neurofibrosis.
[0335] Example 14. Therapeutic ablation of ARC neurofibrosis using intranasal fluocinolone (PZ6005) promotes weight loss while reducing obesity excess
[0336] Figure 3 Body weight changes in obese mice fed a 12-week HFHS diet during 14 days of intranasal administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day). Intranasal PZ6005 treatment induced weight loss in a dose-dependent manner, as assessed by significant differences in weight change across groups. The 1 mg and 5 mg treatment groups experienced a robust loss of body weight starting on day 7 and day 3, respectively. On day 9, the 5 mg treatment began to lose significantly more weight than the 1 mg treatment, and this loss persisted through day 14. At the end of the experiment, mice in the highest dose of PZ6005 treatment had lost 6.36 ± 0.88% of their body weight, and mice in the 1 mg treatment had lost 16.32 ± 1.41% of their body weight, while control littermates maintained 3.57 ± 1.28% of their body weight ( Figure 10 a).
[0337] To determine the effects of intranasal PZ6005-mediated attenuation of neurofibrosis on tissue-specific obesity propensity and body composition, peripheral tissue and fat body mass of mice were weighed after 14 days of administration. In the 1 mg treatment, the mass of epiWAT, BAT, and liver decreased, while the highest dose of intranasal PZ6005 significantly reduced tissue mass ( Figure 11 a, b). In addition, the reduction in total fat mass was dependent on the dose of PZ6005. Compared to the pre-treatment mass, the post-treatment fat mass decreased by 12.59±2.29% in the 1 mg treatment and further decreased by 23.21±9.27% in the 5 mg treatment ( Figure 11 c, d). These results indicate that intranasal delivery of PZ6005 is associated with dose-dependent weight loss, accompanied by amelioration of tissue-specific adiposity and reduction of fat body mass.
[0338] Example 15. Therapeutic Ablation of ARC Neurofibrosis Using Intranasal Flunarizine (PZ6005) Dose-Dependently Improves Glucose Homeostasis While Enhancing Insulin Sensitivity
[0339] Obese mice that received vehicle or PZ6005 (1 mg or 5 mg / animal / day) intranasally were subjected to IP. GTT was performed after a 6-hour fasting period, and IP insulin tolerance test (ITT) was performed after a 4-hour fasting period. The reduction in blood glucose excursions in both the GTT and ITT indicated that mice treated with intranasal PZ6005 had better glucose tolerance ( Figure 12 a, b), and also have enhanced insulin sensitivity ( Figure 12 c, d). In addition, in the GTT, 60 minutes after IP glucose injection and 0 minutes after IP insulin injection, 5 mg PZ6005 treatment showed a significantly higher glucose clearance rate than the 1 mg treatment group and the control ( Figure 12ad). Reductions in fasting (12-hour) blood glucose levels further confirmed that both doses of intranasal PZ6005 treatment improved glycemic control ( Figure 12 e).
[0340] These results suggest that intranasal IV delivery of PZ6005 enhances systemic insulin sensitivity and improves glucose homeostasis in a dose-dependent manner.
[0341] Example 16. Therapeutic Ablation of ARC Neurofibrosis Using Intranasal Flurane (PZ6005) Improves Insulin Receptor Signaling in the ARC
[0342] ARC pAKT+ve. cells from obese mice that received 14 days of intranasal administration of vehicle or PZ6005 (1 mg or 5 mg / animal / day) were examined to demonstrate the extent to which intranasal PZ6005-mediated attenuation of CSPG-ECM affects insulin receptor signaling within the ARC ( Figure 13 a). Both doses of intranasal PZ6005-treated ARC enhanced insulin receptor signaling as assessed by a robust increase in ARC pAKT+ve. cells ( Figure 13 b) These results suggest that intranasally administered PZ6005, a neurofibrosis inhibitor, enhances insulin sensitivity in the ARC parenchyma.
[0343] Example 17. Intermittent administration of PZ6005 attenuates CSPG-ECM expression and maintains this inhibition over time
[0344] To determine whether therapeutic attenuation of ARC neurofibrosis with PZ6005 would enhance liraglutide-mediated improvements in both energy and glucose metabolism, obese C57BL / 6j mice fed a 12-week HFHS diet were administered ICV every other day for the first 14 days of a 28-day treatment period; concurrently, mice received daily subcutaneous (SC) injections of vehicle or liraglutide ( Figure 14 a).
[0345] The efficacy of every-other-day PZ6005 injections in targeting neurofibrosis was assessed by quantification of CSPG-ECM expression within the ARC by WFA immunostaining. Figure 14 b). Single liraglutide treatment showed no effect on altering CSPG-ECM. In contrast, a significant decrease in the area and intensity of ARC CSPG-ECM was observed in mice treated with PZ6005. The CSPG-ECM area in the PZ6005 and liraglutide / PZ6005 treatment groups was 31.56±3.73% and 32.39±6.77% lower than that in the liraglutide group, respectively. Figure 14c, d). Compared with mice receiving liraglutide, ARC CSPG-ECM intensity was reduced by 22.65±7.851% and 37.32±5.143% after PZ6005 treatment and co-administration of liraglutide and PZ6005 ( Figure 3 .4.1e,f). During the final 14 days of treatment, mice did not receive PZ6005, and ARC CSPG-ECM expression remained lower in mice than in mice receiving vehicle or liraglutide alone.
[0346] These results indicate that every other day administration of PZ6005 effectively inhibits ARC neurofibrosis compared with control and liraglutide treatment, and this effect can be maintained long-term.
[0347] Example 18. Therapeutic Attenuation of ARC Neurofibrosis Restores Neuronal Insulin Receptor Signaling and Enhances GLP-1 Sensitivity
[0348] Following 28 days of liraglutide and / or PZ6005 treatment in Example 17, the extent to which (co-)administration of liraglutide and / or PZ6005 affects hormone signaling in the ARC parenchyma was assessed by delivering a bolus of insulin and liraglutide IP to mice.
[0349] Mice treated with liraglutide alone showed enhanced ARC insulin receptor signaling compared to control littermates ( Figure 15 a, b), consistent with the finding that long-term liraglutide administration can mitigate the loss of brain insulin receptors and restore neuronal insulin sensitivity. PZ6005 (alone or co-administered with liraglutide) can augment the improvement of insulin resistance, as assessed by the observation of more ARC pAKT+ve. cells in mice receiving PZ6005 than in mice in the liraglutide-alone group ( Figure 15 a, b).
[0350] To determine whether PZ6005 enhances the effects of liraglutide on ARC in diet-induced obesity, GLP-1 receptor signaling was assessed by anti-pERK immunostaining, a marker of GLP-1 receptor activation ( Figure 16 A significant increase in ARC pERK+ve. cells was observed with PZ6005 alone or co-administered with liraglutide treatment compared to control and liraglutide treatment alone ( Figure 16b). In addition, PZ6005 may improve access of liraglutide to the ARC parenchyma via elongated cell transport, consistent with the impaired ARC liraglutide uptake in elongated cell-GLP-1 receptor knockout mice. Enhanced GLP-1 receptor signaling was accompanied by a robust increase in pERK+ cells within the ARC and a slight but nonsignificant increase in the number of elongated ARC cells lining the third ventricle ( Figure 16 c, d).
[0351] These results suggest that pharmacological ablation of neurofibrosis using PZ6005 enhances ARC insulin sensitivity and also allows elongated cells to transport more liraglutide to the ARC parenchyma.
[0352] Example 19. Co-administration of liraglutide and PZ6005 is superior to liraglutide and PZ6005 monotherapy in improving systemic metabolism in diet-induced obesity
[0353] To determine the functional contribution of co-administration of liraglutide with PZ6005 on systemic metabolism, the effect on weight loss was assessed by measuring the body weight of diet-induced obese mice that received PZ6005 and / or liraglutide during the 28-day treatment period. On day 28, the mean absolute body weight change from baseline (day 0) in the PZ6005 / liraglutide-treated group was -13.50 ± 0.73 g compared with vehicle-treated mice; -4.70 ± 0.73 g compared with liraglutide treatment, and -6.04 ± 0.73 g compared with Z6005 treatment (PZ6005 / liraglutide-treated mice). Figure 17 a). The mean percentage changes in body weight were 5.22±1.08%, -17.22±1.84%, -13.02±1.15% and -28.98±2.57% in the vehicle, liraglutide, PZ6005 and PZ6005 / liraglutide treated groups, respectively ( Figure 17 b) Treatment with PZ6005 alone and liraglutide alone resulted in a decrease in body weight, while dual administration of PZ6005 and liraglutide significantly reduced body weight to a greater extent than that of the other three groups.
[0354] The effects of the four treatments on altering tissue-specific obesity propensity and body composition were also compared. Compared with control littermates, ingWAT, epiWAT, and liver mass were lower in liraglutide-treated and PZ6005-treated mice ( Figure 18 a, b). PZ6005 / liraglutide treatment reduced epiWAT more than liraglutide treatment, and mice in this treatment showed less BAT and liver mass than control and PZ6005 treatment ( Figure 18a, b). Liraglutide / PZ6005 treatment was also superior to single-agent therapy in reducing fat body mass, as assessed by robust reductions in both intra- and post-treatment fat body mass ( Figure 18 c, d). The effect of PZ6005 on improving systemic metabolism was sustained for 14 days, as there was no significant difference in fat body mass during and after PZ6005 treatment.
[0355] To further explore how PZ6005 enhances liraglutide-mediated weight loss, food intake and energy expenditure were assessed over 24 hours. Co-administration of liraglutide with PZ6005 significantly enhanced the appetite suppressant effects of both monotherapies, as food intake was lower in the dual therapy group (co-administration of liraglutide with PZ6005) than in the liraglutide and PZ6005 monotherapy groups ( Figure 19 a). In addition, liraglutide treatment had no effect on energy expenditure and oxygen consumption ( Figure 19 During both daytime and nighttime periods, mice in both groups receiving PZ6005 expended more energy without increasing their movements ( Figure 19 be), which is consistent with the improvement in all-day energy expenditure observed in the ICVPZ6005 experiment.
[0356] Taken together, these results demonstrate that dual administration of PZ6005 and liraglutide reduces appetite to achieve superior weight loss compared with monotherapy in diet-induced obesity. This enhanced weight loss was not associated with any adverse effects (such as sedation and hyperactivity) and was accompanied by a decrease in stored fat and reductions in epiWAT, BAT, and liver mass.
[0357] Example 20. Co-administration of liraglutide and PZ6005 is superior to liraglutide and PZ6005 monotherapy in improving glycemic control in diet-induced obesity
[0358] To demonstrate the effect of co-administration of liraglutide and PZ6005 on glycemic control, obese mice administered vehicle or liraglutide and / or PZ6005 were fasted for 6 hours and then subjected to IPGTT. PZ6005 alone and liraglutide alone reduced glycemic excursions to a similar extent compared to control treatment ( Figure 3 .4.4a,b). Liraglutide / PZ6005 treatment significantly reduced peak blood glucose during the GTT, with the peak occurring 15 minutes earlier than in the control group and both monotherapies ( Figure 20 a) These results indicate that the combination therapy of liraglutide and PZ6005 treatment has an increased beneficial hypoglycemic effect compared to liraglutide and PZ6005 treatment alone.
[0359] Taken together, these results demonstrate that dual delivery of liraglutide and PZ6005 resulted in superior weight loss and improved glycemic control compared with either liraglutide or PZ6005 alone. The attenuated ARC neurofibrosis with PZ6005 was also accompanied by enhanced central GLP-1 signaling and improved central insulin resistance. Furthermore, these advantages of the combination therapy further fuel interest in the therapeutic potential of targeting the ARC for the treatment of obesity and type 2 diabetes.
[0360] Example 21. Neurofibrosis inhibition enhances and maintains the ability of GLP-1R agonists to promote remission of obesity and type 2 diabetes
[0361] animal
[0362] All animal procedures were approved by the University of Melbourne Animal Ethics Committee (Ethics ID: 25349) and adhered to the National Health and Medical Research Council guidelines for the use and care of animals in research. C57BL / 6J male mice were obtained from the Australian Animal Resource Center.
[0363] Eight-week-old C57BL / 6J male mice were maintained on a 12-hour light / dark cycle in a temperature-controlled high-barrier facility at room temperature (23±2°C) and room humidity of 40%-70% in accordance with the NHMRC Australian Code of Animal Care and Use. To induce diet-induced obesity in adulthood, mice were given free access to water and a high-fat, high-sugar (HFHS) diet (43% of total energy from fat, SF04-001, Speciality Feeds, Australia) starting at eight weeks of age for 12 weeks. Age-matched chow-fed C57BL / 6J male mice were given free access to a standard chow diet throughout the duration of the experiment.
[0364] Lateral ventricular catheter
[0365] Under 2-5% (v / v) isoflurane in 1 liter / min oxygen, 12-week HFHS diet-fed and age-matched chow-fed C57BL / 6J male mice were stereotaxically implanted with a guide cannula into the right lateral ventricle (coordinates were measured as described in Chapter 2; anterior / posterior: -1.00 mm, medial / lateral: +0.20 mm). The guide cannula was made by polishing the shaft of a hypodermic needle (19 gauge, Livingstone, Australia) to 1.00 mm long. The tip of the guide cannula was positioned 1.00 mm above the target area (1.00 mm ventral to the surface of the mouse skull). The mice were allowed to recover for 2-3 days before further experimental manipulation. To evaluate the therapeutic potential of pharmacologically attenuated brain CSPG-ECM in prolonging the anti-obesity and anti-diabetic effects of liraglutide, mice were administered intracerebroventricularly with vehicle (ddH2O) and PZ6005 (100 μg / animal) every two days approximately 1 hour before lights out (7 PM) for a 14-day treatment period in a total volume of 2 μl / animal.
[0366] Intraperitoneal injection
[0367] C57BL / 6J male mice fed a 12-week HFHS diet and an age-matched chow diet were awakened, restrained by scraping, and inverted with their heads down. A 25-gauge syringe was injected into the lower right / lower left quadrant of the mouse abdomen, and the mice were then returned to their cages. During the 14-day treatment period, liraglutide (200 μg / kg body weight, Novo Nordisk, Denmark) was administered intraperitoneally at 6-7 pm every night before lights out.
[0368] Metabolic assessment
[0369] Metabolic measurements were performed at the Melbourne Mouse Metabolic Phenotyping Platform (University of Melbourne, Australia). Obesity and lean body mass were measured using an EchoMRI-900 body composition analyzer (EchoMRI LLC, USA) using a TD-NMR minispec (Bruker Optics, USA). Interscapular brown adipose tissue, inguinal and epidermal white adipose tissue, and liver were weighed to determine tissue-specific obesity propensity.
[0370] After 24 hours of adaptation, metabolic parameters of mice were assessed in environmentally controlled monitoring cages at 5-minute intervals for 48 hours. Calorie intake was manually quantified by food consumption. Whole-body energy expenditure (VO2 consumption and energy expenditure) and locomotor activity were measured using the Promethion Metabolic Screening System (Sable Systems International, USA) equipped with food consumption, indirect open-circuit calorimetry, and activity monitors. Energy expenditure was calculated using the Weir equation (kcalh-1 = 60 × (0.00394 × VO2 + 0.001106 × VCO2)). To account for differences in energy expenditure based on body mass / composition, ANCOVA analysis was analyzed and adjusted using the National Mouse Metabolic Phenotyping Center Energy Expenditure Analysis page (https: / / www.mmpc.org / shared / regression.aspx, USA). Fat and carbohydrate utilization were calculated as the ratio of VCO2 production to VO2 consumption.
[0371] By injecting D-glucose (2mg / g lean body weight) into the peritoneal cavity, and using Accu-Check blood glucose meter (Roche, Germany) to collect tail blood immediately at 0 minute, 15 minute, 30 minute, 60 minute, 90 minute and 120 minute after injection, conscious mice that fasted for 6 hours were subjected to glucose tolerance test. Determine the area under the blood glucose fluctuation curve and express it as millimoles / liter × minute. Use Accu-Check blood glucose meter to measure fasting (24 hour fasting) blood glucose level.
[0372] Insulin tolerance test was performed on awake mice fasted for 4 h by intraperitoneal injection of human insulin (0.6 mU / g bw for chow-fed mice and 0.8 mU / g bw for HSHF-fed obese mice, Actrapid, Novo Nordisk, Denmark) and measurement of blood glucose levels by collecting tail blood immediately at 0, 15, 30, 45, and 90 min after injection using an Accu-Check blood glucose meter.
[0373] Behavior Satisfaction Order
[0374] 3 hours before observation, by 12 weeks HFHS diet feeding and age-matched C57BL / 6J male mice fasted overnight, and independently transferred to transparent cage, can contact water at will.After light cycle starts (12 o'clock noon) five hours, provide food to mice, and mice are observed undisturbed and carefully.In 90 minutes of observation, transient behavior is monitored once every 30 seconds.Behavior is scored from 0 to 1 according to the following classification: eating (mice obtain and chew food), drinking water (mice try to lick the water spout), grooming (mice lick or scratch its body), active (mice are moving and sniffing), inactive (mice show motionless or disease signs when awake) and rest (mice are sleeping).Collected data are sorted into 5 minute period statistical stacks, and are used to analyze the average time percentage (accounting for % of total behavior) spent by each type of behavior of animals, the transition from eating to rest and the time of reaching satiety.
[0375] result
[0376] To determine the functional contribution of co-administration of liraglutide and PZ6005 to the rebound effect of slowing systemic metabolism, metabolic measurements were performed in three periods: 1) pre-treatment period (Day -2 to Day 0); 2) treatment period (Day 1 to Day 14); and 3) off-treatment period (Day 15 to Day 62).
[0377] Obese C57BL / 6j and age-matched chow-fed mice fed a high-fat, high-saccharide (HFHS) diet for 12 weeks received intravenous (ICV) delivery of vehicle or PZ6005 every other day; concurrently, mice received daily subcutaneous injections of vehicle or liraglutide during a 14-day treatment period. Treatment was discontinued on day 15, but all groups continued to receive ad libitum access to the HFHS diet to assess post-treatment rebound.
[0378] During the treatment period, the PZ6005 / liraglutide group lost more weight than the other treatment groups. On Day 14, the mean weight loss compared to baseline (Day 0) was 22.97 ± 2.39% for the PZ6005 / liraglutide group, 15.72 ± 1.32% for liraglutide, and 15.08 ± 1.45% for PZ6005. Figure 21 a, b). After cessation of treatment, the rate of weight regain in the PZ6005 / liraglutide-treated group was more slowed than that in the liraglutide-treated group, indicating that PZ6005 prolonged the weight rebound observed after liraglutide treatment alone. Mice receiving PZ6005 / liraglutide required 22.40 ± 1.727 days to recover 50% of their net weight loss, which was 14.5 ± 1.75 days, 12.07 ± 1.73 days, and 2.73 ± 1.55 days later than the vehicle, liraglutide, and PZ6005 groups, respectively ( Figure 21c). The PZ6005 / liraglutide group returned to baseline body weight on day 35.5±2.50, compared to day 24.44±2.17 for the vehicle group, day 28.00±3.08 for the liraglutide group, and day 30.00±1.72 for the PZ6005 group ( Figure 21 c) Treatment with liraglutide alone and PZ6005 alone required a similar time to return to baseline body weight as vehicle, whereas dual administration of PZ6005 and liraglutide significantly prolonged the maintenance of the weight loss effect.
[0379] In line with the prolonged maintenance of weight loss, treatment with PZ6005 alone and PZ6005 / liraglutide was superior in maintaining lean body mass and reducing overall adiposity. Compared with the vehicle and liraglutide alone treatment groups, the PZ6005-treated group still had a significant reduction in baseline fat mass 14 days after treatment termination, but did not affect lean body mass ( Figure 21 df). Mice receiving PZ6005 and PZ6005 / liraglutide also had lower liver mass than other littermates with similar obesity tendencies ( Figure 1 e).
[0380] To explore the extent to which neurofibrosis inhibition contributes to attenuating rebound weight gain after liraglutide cessation, metabolic rate measurements were assessed in HFHS diet-fed obese mice administered vehicle, liraglutide, and / or PZ6005, as well as vehicle-treated chow-fed mice, during the treatment and cessation periods. PZ6005 alone and PZ6005 / liraglutide-treated mice showed oxygen consumption ( Figure 22 a) and whole-body energy expenditure ( Figure 22 b) Increased, but no effect on ambulatory activity ( Figure 22 Despite these effects, PZ6005 / liraglutide administration did not demonstrate the ability to achieve low fat utilization and high carbohydrate utilization similar to a healthy lean state during the treatment period (e). Figure 22 c, d). In contrast to the effect of reduced neurofibrosis on improved metabolic rate, mice treated with liraglutide monotherapy showed reduced oxygen consumption and energy expenditure 14 days after cessation of treatment, along with altered substrate utilization ( Figure 23 ac). Specifically, discontinuation of liraglutide treatment alone resulted in a sharp decrease in carbohydrate utilization and an increase in fat utilization, but with no signs of abnormal activity ( Figure 23 c, d).
[0381] The attenuated weight regain with PZ6005 / liraglutide treatment was also accompanied by appetite suppression, as assessed by reduced food intake. During the treatment period, mice treated with PZ6005 / liraglutide consumed fewer servings of the high-fat diet compared to the vehicle, liraglutide, and PZ6005 alone groups ( Figure 24a). The superior appetite suppressant effect of dual therapy was maintained as indicated by suppressed appetite up to 16 days after cessation of treatment ( Figure 24 ad). This suggests that co-administration with PZ6005 can prolong the liraglutide-induced weight loss effect by maintaining the improved metabolic rate and reducing food intake.
[0382] To determine the effect of co-administration of liraglutide and PZ6005 on glycemic rebound, glycemic control was assessed in HFHS or chow-fed mice treated with vehicle, liraglutide, and / or PZ6005 during each treatment period. Glucose tolerance improved in mice treated with liraglutide alone and PZ6005 alone, while mice treated with PZ6005 / liraglutide dual therapy exhibited glycemic regulation comparable to lean / healthy chow-fed mice during the treatment period ( Figure 25 a). Sustained improvements in glucose tolerance, fasting glucose, and systemic insulin sensitivity were observed even after the PZ6005 / liraglutide dual therapy groups regained 50% or 100% of their original body weight ( Figure 5 bd). Notably, these assessments were performed on separate days after mice in each treatment group had regained approximately 50% and approximately 100% of their total weight loss. This indicates that PZ6005 prolonged the beneficial effects of liraglutide on remission of type 2 diabetes, independent of any effect on weight regain.
[0383] References
[0384] Alonge, KM, et al. Hypothalamic perineuronal net assembly is required for sustained diabetes remission induced by fibroblast growth factor 1 in rats. Nat Metab, 2020. 2(10): 1025-1033.
[0385] Anderson, EM, et al. Systematic analysis of CRISPR-Cas9 mismatch tolerance reveals low levels of off-target activity. J Biotechnol, 2015. 211: 56–65.
[0386] Coskun, T., LY3437943, a novel triple glucagon, GIP, and GLP-1 receptor agonist for glycemic control and weight loss: From discovery to clinical proof of concept. Cell Metabolism, 2022. 24(9), 1234-1247.
[0387] Davies, MJ, et al. Efficacy of Liraglutide for Weight Loss Among Patients With Type 2 Diabetes: The SCALE Diabetes Randomized Clinical Trial. JAMA, 2015. 314: 687-699.
[0388] Dodd, GT, et al. TCPTP Regulates Insulin Signaling in AgRP Neurons to Coordinate Glucose Metabolism With Feeding. Diabetes, 2018. 67(7): 1246-1257.
[0389] Dodd, GT, et al. Intranasal Targeting of Hypothalamic PTP1B and TCPTP Reinstates Leptin and Insulin Sensitivity and Promotes Weight Loss in Obesity. Cell Rep, 2019. 28(11): 2905-2922e5.
[0390] Keough, MB, et al. An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination. Nature Communications, 2016, 7: 11312.
[0391] Mirzadeh, Z., et al., Perineuronal Net Formation during the Critical Period for Neuronal Maturation in the Hypothalamic Arcuate Nucleus. Nature Metabolism, 2019. 1(2): 212-221.
[0392] Moh, ESX, et al. Long-term intrathecal administration of morphine vs. baclofen: Differences in CSF glycoconjugate profiles using multiglycomics. Glycobiology, 2022. 32(1): 50-59.
[0393] Olofsson, LE, et al. Modulation of AgRP-neuronal function by SOCS3 as an initiating event in diet-induced hypothalamic leptin resistance. Proc Natl Acad Sci USA, 2013. 110(8): E697-706.
[0394] Pi-Sunyer, X. et al. A Randomized, Controlled Trial of 3.0 mg of Liraglutide in Weight Management. New England Journal of Medicine, 2015. 373: 11-22.
[0395] Stephenson, EL, et al. Targeting the Chondroitin Sulfate Proteoglycans: Evaluating Fluorinated Glucosamines and Xylosides in Screens Pertinent to Multiple Sclerosis. ACS Cent Sci., 2019. 5(7): 1223-1234.
[0396] Winans, KA and Bertozzi, CR. An Inhibitor of the Human UDP-GlcNAc4-Epimerase Identified from a Uridine-Based Library: A Strategy to Inhibit O-Linked Glycosylation. Chemistry & Biology, 2022. 9(1): 113-129.
Claims
1. A pharmaceutical combination comprising (i) a 4-epimerase inhibitor and (ii) a GLP-1 receptor (GLP-1R) agonist. 2 . The pharmaceutical combination according to claim 1 , wherein the 4-epimerase inhibitor is a fluorinated N-acetyl-glucosamine derivative or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.
3. The pharmaceutical combination according to claim 1 or claim 2, wherein the 4-epimerase inhibitor is a compound of formula (I): or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof, in: R 1 、R 3 and R 5 independently selected from H or C(O)C 1-4 alkyl; and R 4 and R 4′ are independently selected from H and fluorine, wherein R 4 and R 4′ At least one of them is fluorine.
4. The pharmaceutical combination according to any one of claims 1 to 3, wherein the 4-epimerase inhibitor is a compound of formula (IA): or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof, in: R 1 、R 3 and R 5 independently selected from H or C(O)C 1-4 alkyl; and R 4 and R 4′ are independently selected from H and fluorine, wherein R 4 and R 4′ At least one of them is fluorine.
5. The pharmaceutical combination according to claim 3 or claim 4, wherein R 1 、R 3 and R 5 independently selected from H or C(O)C 1-2 alkyl.
6. The pharmaceutical combination according to any one of claims 3 to 5, wherein R 1 is H or C(O)C 1-2 Alkyl, and R 3 and R 5 Both are acyl groups.
7. The pharmaceutical combination according to any one of claims 3 to 6, wherein R 1 、R 3 and R 5 Each is an acyl group.
8. The pharmaceutical combination according to any one of claims 3 to 7, wherein the 4-epimerase inhibitor is selected from: or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.
9. The pharmaceutical combination according to claim 8, wherein the 4-epimerase inhibitor is: or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.
10. The pharmaceutical combination according to claim 1, wherein the 4-epimerase inhibitor is: or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.
11. The pharmaceutical combination according to claim 1, wherein the 4-epimerase inhibitor is a compound of formula (II), formula (III) or formula (IV): or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof, in: R 6 Selected from: R 7 Selected from: and R 8 Selected from:
12. The pharmaceutical combination according to any one of claims 1 to 11, wherein the GLP-1R agonist is GLP-1 or an analogue thereof.
13. The pharmaceutical combination according to claim 13, wherein the GLP-1 analogue is selected from liraglutide, dulaglutide, exenatide, semaglutide and lixisenatide or any combination thereof.
14. The pharmaceutical combination according to claim 12 or claim 13, wherein the GLP-1 analogue is liraglutide.
15. The pharmaceutical combination according to any one of claims 1 to 11, wherein the GLP-1R agonist is a GLP-1R co-agonist.
16. The pharmaceutical combination according to claim 15, wherein the GLP-1R co-agonist is tirzepatide or LY3437943.
17. A pharmaceutical composition comprising a 4-epimerase inhibitor and a GLP-1 agonist.
18. A method for treating or preventing insulin resistance or a related disorder, suppressing appetite and / or promoting weight loss in a subject, the method comprising administering to the subject an effective amount of a 4-epimerase inhibitor in combination with a GLP-1 receptor (GLP-1R) agonist.
19. The method of claim 18, wherein the associated condition is selected from prediabetes, type 2 diabetes, obesity, metabolic syndrome, hypertension, dyslipidemia, atherosclerosis, non-alcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), coagulopathy, and obstructive sleep apnea.
20. The method of claim 18, wherein the associated condition is a metabolic disease.
21. The method of claim 17, wherein the metabolic disease is type 2 diabetes.
22. The method of claim 20, for treating obesity, suppressing appetite and / or promoting weight loss.
23. The method of any one of claims 18 to 22, wherein the 4-epimerase inhibitor is administered intranasally.
24. The method of any one of claims 18 to 23, wherein the 4-epimerase inhibitor is administered every other day.
25. The method of any one of claims 18 to 24, wherein the GLP-1 agonist is administered by injection.
26. Use of a 4-epimerase inhibitor and a GLP-1R agonist for the preparation of one or more medicaments for treating or preventing insulin resistance or related conditions, suppressing appetite and / or promoting weight loss in a subject.
27. Use of a 4-epimerase inhibitor for the preparation of a medicament for treating or preventing insulin resistance or related conditions, suppressing appetite and / or promoting weight loss in a subject in combination with a GLP-1R agonist.
28. Use of a GLP-1R agonist for the preparation of a medicament for treating or preventing insulin resistance or related conditions, suppressing appetite and / or promoting weight loss in a subject in combination with a 4-epimerase inhibitor.
29. A combination comprising (i) a 4-epimerase inhibitor and (ii) a GLP-1R agonist for use in treating or preventing insulin resistance or a related condition, suppressing appetite and / or promoting weight loss in a subject.
Citation Information
Patent Citations
Dispensing device
US5655517A
Use of glucagon-like peptide-1 (GLP-1) or analogs to abolish catabolic changes after surgery
WO1998008873A1
Glucagon / GLP-1 receptor co-agonists
WO2008101017A2
Novel peptides and methods for their preparation and use
WO2011119657A1
GIP-GLP-1 dual agonist compounds and methods
WO2013164483A1