Application of watermelon WRKY transcription factor ClWRKY60 in drought stress resistance

Abstract

The invention discloses application of a watermelon WRKY transcription factor ClWRKY60 in drought stress resistance, and belongs to the technical field of gene engineering. The invention discloses an application of a watermelon WRKY transcription factor ClWRKY60 in drought stress resistance. The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is as shown in SEQ ID NO. 1. The WRKY transcription factor ClWRKY60 is a positive regulation factor of watermelon responding to drought stress, the gene can provide gene resources for creation of drought-resistant new germplasm and breeding of special high-resistance new varieties, and meanwhile, the gene has very important scientific and production application significance for promoting resistance breeding, improving economic benefits of watermelons and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and more particularly to application of watermelon WRKY transcription factor ClWRKY60 in drought stress resistance. Background Art

[0002] Watermelon (Citrullus lanatus L.) is an important global crop and is grown on a large scale in many countries. my country is a major watermelon producer, and by 2022, the national watermelon planting area reached 1,384,052 hectares. 2 , with a total production of 60.3862 million tons (FAO 2022). Watermelon also contains a variety of nutrients. It not only relieves summer heat and quenches thirst, but also has diuretic, blood pressure-lowering, and beauty-enhancing properties. Its unique sweetness and refreshing taste make it one of the most popular summer fruits, enjoyed directly or in beverages like watermelon juice and smoothies. Watermelon cultivation and production require a significant amount of water. In recent years, droughts and low rainfall have plagued much of my country, making cultivation and irrigation costly and difficult, leading to slow development in many agricultural industries. Therefore, addressing the drought-related and low-yield issues of crop cultivation in arid regions is crucial. In recent years, the emergence of genetic engineering has provided new technical solutions for crop cultivation in arid regions. For example, transgenic technology has facilitated the development of crop breeding techniques, improving yields and resistance to biotic and abiotic stresses.

[0003] The WRKY transcription factor (TF) family is one of the largest in higher plants and plays a key regulatory role in plant adaptation to abiotic stress. This family is characterized by a highly conserved WRKYGQK motif and a C2H2 or C2HC zinc finger structure. This conserved structure enables binding to the W-box, which has the sequence (C / T)TGAC(T / C). Based on the number of WRKY domains and zinc finger structures, WRKY TFs are divided into subfamilies I, II, and III. Subfamily II is further divided into IIa, IIb, IIc, IId, and IIe. Numerous members of the WRKY family, such as AtWRKY46 in Arabidopsis, GmWRKY54 in soybean, TaWRKY146 in wheat, and MdWRKY31 in apple, have been found to enhance plant drought tolerance. This suggests that WRKY TFs may play an important role in plant drought stress tolerance.

[0004] So far, there are few studies on the regulation of drought stress in watermelon by WRKY genes. Therefore, providing a method for applying the watermelon WRKY transcription factor ClWRKY60 in drought stress resistance is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides an application of watermelon WRKY transcription factor ClWRKY60 in drought stress resistance.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] Application of watermelon WRKY transcription factor ClWRKY60 in drought stress resistance. The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.1.

[0008] Furthermore, the overexpression of watermelon WRKY transcription factor ClWRKY60 is used in positively regulating watermelon drought stress resistance. The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.1.

[0009] Furthermore, the use of a biological material overexpressing a watermelon WRKY transcription factor ClWRKY60 in positively regulating watermelon drought stress resistance, wherein the nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.1;

[0010] The biological material is any one of the following:

[0011] A: an expression cassette capable of overexpressing the watermelon WRKY transcription factor ClWRKY60 having a nucleotide sequence as shown in SEQ ID NO.1;

[0012] B: recombinant vector containing the expression cassette described in A;

[0013] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0014] Furthermore, the watermelon WRKY transcription factor ClWRKY60 is used in watermelon breeding. The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.1.

[0015] Furthermore, the watermelon WRKY transcription factor ClWRKY60 is used in breeding drought-resistant watermelon germplasm. The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.1.

[0016] Through the above technical solutions, it can be seen that compared with the prior art, the present invention discloses the application of the watermelon WRKY transcription factor ClWRKY60 in drought stress resistance. The present invention discovered a watermelon WRKY transcription factor ClWRKY60. At the same time, it was found that compared with the wild type (WT), the tolerance of ClWRKY60 knockout plants was reduced after drought treatment, the malondialdehyde (MDA) content was significantly increased, and the net photosynthetic rate (Pn) and superoxide dismutase (SOD) activity were significantly reduced. After drought treatment, the tolerance of ClWRKY60 overexpression plants was increased, the MDA content was decreased, and the Pn and SOD activities were increased. This indicates that the WRKY transcription factor ClWRKY60 is a positive regulator of watermelon's response to drought stress. This gene can provide genetic resources for the creation of new drought-resistant germplasm and the selection of distinctive high-resistance new varieties. It also has very important scientific and production application significance for promoting resistance breeding and improving the economic benefits of watermelon. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0018] Figure 1 Schematic diagram of ClWRKY60 gene structure, target structure and editing strain sequence information;

[0019] Figure 2 is the expression level of gene ClWRKY60 in overexpression lines OEWRKY60-1 and OEWRKY60-2;

[0020] Figure 3 The phenotypes of ClWRKY60 knockout, overexpression, and wild-type strains under drought stress are shown in Figure 2.

[0021] Figure 4 Analysis of the net photosynthetic rate (Pn) of ClWRKY60 knockout, overexpression, and wild-type lines under drought stress;

[0022] Figure 5 Analysis of malondialdehyde (MDA) content in knockout, overexpression, and wild-type lines of ClWRKY60 under drought stress;

[0023] Figure 6 Analysis of superoxide dismutase (SOD) activity in knockout, overexpression, and wild-type strains of ClWRKY60 under drought stress. DETAILED DESCRIPTION

[0024] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0025] The CDS sequence of ClWRKY60 is shown in SEQ ID NO.1.

[0026] ATGAATAACATAAATCAAACGATAAATACACTCGCTGGCGGATCTTCTGACAACAGAACCAATAATTTCGGTATGGAAGTTCCGAAATTCAAGTCTCTTCAACCTCCTCCATTTCCCATGTCTCCTTCTTCTTACCTTTCAGCTTTCTCTTCTGGTTTAAGCCC CACTGAGCTTCTAAATTCC CCTCTCCTTTTCTCATTTGGTGTTTTTCCTTCTCCTACTTCTGGTGCCTTAAATTTGAGAAATGATTATGAGGAGGGTGAGCAGCAAGAAATGAAGGCAGATGTGAAAAATTACTCTGCTTCTTCGTTTAACCCACAAA CAGGATCCTCTGTTTCGTCTTATTTTCAGTCCTCTTCTTCCAACGTGACACCACTGAATCCGAACGGTTTGTCGTGTGATGAAAGTGGAGCGAAATCAGAATTTGTTACTACAGAAATGGCGGCAGCTGAATCAAAGCCA ATTTCTCAGCTACCAATTTACAACAGAGAACAGAAAAAATCAGAGAACGATGGATATAACTGGAGAAAATACGGGCAAAAACAAGTGAAAGGAAGCGAAAATCCACGAAGCTATTACAAGTGCACTTTCCCAAGTTGCCC AACAAAGAAGAAAGTTGAAAGATCTTTAGACGGCCAAATTACTGAGATTGTTTATAAGGGAAGCCATAATCACGCCAAGCCCCAGCCCACAAGACGTTCCGGTAACTCCGCGATTTACGATCCATCTTCGGCGGATTCCG CCCTGCTGCA GGAGGATTC; SEQ ID NO.1.

[0027] Example 1 Construction of CRISPR / Cas9 editing vector PBSE402-ClWRKY60

[0028] 1) Editing site selection of gene ClWRKY60

[0029] Based on the CDS sequence of ClWRKY60 (shown in SEQ ID NO. 1) and the online target site design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2), two target sites (Target1 and Target2) were designed. Target1 and Target2 are located in the first and third exons of ClWRKY60, respectively.

[0030] Target1 sequence: CACTGAGCTTCTAAATTCC; SEQ ID NO. 2;

[0031] Target2 sequence: CCCTGCTGCAGGAGGATTC; SEQ ID NO.3.

[0032] 2) Construction of CRISPR / Cas9 editing vector

[0033] (1) PCR amplification:

[0034] Adaptor primers Target1F / Target2R were synthesized based on the two target sequence sets described above. PCR amplification was performed using the high-fidelity enzyme PrimeStarMax Premix (TaKaRa) using a 100-fold diluted intermediate vector pCBC-DT1T2 as a template. The amplification system consisted of 25 μL of PrimeStarMax Premix (2×), 2.5 μL of template, 2.5 μL of each upstream and downstream primer, and 17.5 μL of ddH2O. The PCR reaction program was as follows: 38 cycles of 98°C for 10 s, 58°C for 5 s, and 72°C for 15 s, followed by 72°C for 5 min.

[0035] The target sequence adapter primers (underlined target sequence) are as follows:

[0036] Target1 sequence primer: Target1F

[0037] ATATATGGTCTCGATTG GGAATTTAGAAGCTCAGTG GTTTTAGAGC TAGAAATAGC;SEQ IDNO.4;

[0038] Target2 sequence primer: Target2R

[0039] ATTATTGGTCTCGAAAC CCCTGCTGCAGGAGGATTC CAATCTCTTA GTCGACTCTAC; SEQ ID NO.5.

[0040] (2) Vector digestion:

[0041] The CRISPR / Cas9 vector PBSE402 was digested with the restriction endonuclease BsaI (NEWENGLAND BioLabs). The digestion system consisted of 2 μg of PBSE402, 5 μL of CutSmart buffer, 1 μL of BsaI, and 50 μL of ddH2O. Digestion was performed at 37°C for 2 h. After electrophoresis, the fragments were recovered from the gel.

[0042] Ligation of PCR product with vector: Ligate the PCR product with the digested vector PBSE402 by homologous recombination. The ligation system is: vector to insert ratio approximately 1:2; 4 μL of 5× reaction buffer; 1 μL of NovoRec Plus recombinase; and ddH2O to a volume of 20 μL. Ligate at 50°C for 10 min.

[0043] (3) Recombinant plasmid transformation:

[0044] Heat shock transform 5 μl of the ligation product into competent E. coli DH5a, plate onto LB solid culture plates containing 50 mg / L kanamycin, and incubate overnight at 37°C. Positive colonies were detected using primers U626-IDF / U629-IDR.

[0045] The specific primer sequences are as follows:

[0046] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;

[0047] U629-IDR: AGCCCTCTCTCTTTCGATCCATCAAC; SEQ ID NO.7.

[0048] After sequencing was correct, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The Agrobacterium transformation steps are as follows:

[0049] Add 1 μl of the recombinant plasmid to competent Agrobacterium tumefaciens EHA105 cells, place in an ice box for 5 minutes, then quickly freeze in liquid nitrogen for 5 minutes. Place in a 37°C water bath for 5 minutes. Add 400 μl of antibiotic-free culture medium to each tube for resuscitation. Transfer the tube to a shaker at 200 rpm and 28°C for shaking. Plate 100 μl of the resuscitated bacterial solution onto LB solid medium containing antibiotics and air-dry at room temperature. Once the bacterial solution has been fully absorbed, invert the culture dish and culture in a 28°C incubator for 2-3 days.

[0050] Example 2 Construction of overexpression vector pCAMBIA1305-ClWRKY60

[0051] (1) PCR amplification:

[0052] Specific primers OE-ClWRKY60-F / R were designed based on the reference sequence of ClWRKY60. The cDNA of watermelon germplasm 'TC' was used as a template and PCR amplification was performed with the high-fidelity enzyme PrimeStarMax Premix (TaKaRa).

[0053] The specific primer sequences are as follows:

[0054] OE-ClWRKY60-F:

[0055] ACGGGGGACTCTAGAGGATCC ATGAATAACATAAATCAAACGATA AAT ; SEQ ID NO.8;

[0056] OE-ClWRKY60-R:

[0057] ACCAATTCACACGTGTTAGTGGTGGTGGTGGTGGTG AGATAGAAA TGAGTTGATGAAGT ;SEQ ID NO.9.

[0058] The amplification system consisted of 25 μL of PrimeStarMax Premix (2×), 2.5 μL of template, 2.5 μL of upstream and downstream primers, and 17.5 μL of ddH₂O. The PCR reaction program was as follows: 38 cycles of 98°C for 10 s, 58°C for 5 s, and 72°C for 15 s, followed by 72°C for 5 min. After PCR completion, 5 μL of 10× loading buffer was added to the reaction mixture. An agarose gel was then prepared and electrophoresed. The correct bands were detected, and the PCR product was recovered using a DNA purification kit (Tiangen).

[0059] (2) Vector digestion:

[0060] The overexpression vector pCAMBIA1305 was digested with restriction endonucleases BamHI and PmlI (NEWENGLAND BioLabs). The digestion system was: 4 μg of pCAMBIA1305, 5 μL of CutSmart buffer, 1 μL of BamHI, 1 μL of PmlI, and 50 μL of ddH2O. Digestion was performed at 37°C for 2 h. After electrophoresis, the fragments were recovered from the gel.

[0061] Ligation of PCR product with vector: Ligate the PCR product with the digested vector pCAMBIA1305 by homologous recombination. The ligation system is: vector to insert ratio approximately 1:2; 4 μL of 5× reaction buffer; 1 μL of NovoRec Plus recombinase; and ddH2O to a volume of 20 μL. Ligate at 50°C for 10 min.

[0062] (3) Recombinant plasmid transformation:

[0063] 5 μl of the ligation product was heat-shock transformed into competent E. coli DH5a, plated onto LB solid culture plates containing 50 mg / L kanamycin, and cultured overnight at 37°C. Colonies were tested for positive results using gene-specific primers OE-ClWRKY60-F / R. After sequencing, the recombinant plasmid was extracted and transformed into competent Agrobacterium tumefaciens EHA105 cells. After PCR verification, it was used for genetic transformation of watermelon. The Agrobacterium transformation steps are as follows:

[0064] Add 1 μl of the recombinant plasmid to competent Agrobacterium tumefaciens EHA105 cells, place in an ice box for 5 minutes, then quickly freeze in liquid nitrogen for 5 minutes. Place in a 37°C water bath for 5 minutes. Add 400 μl of antibiotic-free culture medium to each tube for resuscitation. Transfer the tube to a shaker at 200 rpm and 28°C for shaking. Plate 100 μl of the resuscitated bacterial solution onto LB solid medium containing antibiotics and air-dry at room temperature. Once the bacterial solution has been fully absorbed, invert the culture dish and culture in a 28°C incubator for 2-3 days.

[0065] Example 3

[0066] 1) Watermelon genetic transformation:

[0067] Plump seeds of the watermelon germplasm 'TC' were soaked in distilled water at 50-55°C for approximately 30 minutes, then the husks were removed. The peeled kernels were washed in 75% alcohol for approximately 30 seconds in a laminar flow hood, rinsed twice with sterile water, and then disinfected by soaking in 3% sodium hypochlorite for 15 minutes. After rinsing again with sterile water 5-7 times, the seeds were air-dried and sown on MS solid culture medium and incubated in the dark at 25°C for 3 days.

[0068] After the seeds germinate, remove them, cut off the ends of the cotyledons, and divide the remaining cotyledons into 8 pieces for easy infection. During this period, single colonies of EHA105 containing the CRISPR / Cas9 vector PBSE402-ClWRKY60 and the overexpression vector pCAMBIA1305-ClWRKY60 were picked into LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampicin, and the bacterial solution was shaken until the OD 600 =0.8, resuspend the bacterial solution in MS culture medium (MS5194.43g / L, sucrose 30g / L, 6-BA 1.5mg / L) to a final concentration of OD 600 = 0.2 to obtain a bacterial suspension. The cut cotyledons were soaked in the bacterial suspension for 15 minutes, removed and air-dried, and then co-cultured in a co-culture medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTech Labs) 3 g / L, 6-BA 1.5 mg / L) lined with filter paper at 25°C in the dark for 3 days.

[0069] After 3 days of co-cultivation, the cotyledonary blocks were removed and washed with sterile water to remove excess Agrobacterium liquid on the surface (washed about 5-7 times) until the sterile water was clear. After being taken out and dried, they were placed on recovery medium (RM: MS5194.43 g / L, sucrose 30 g / L, G32513 g / L, 6-BA 1.5 mg / L, 200 mg / L Timentin) for recovery culture and cultured at 28°C for 7 days.

[0070] After 7 days, the cotyledons that recovered were transferred to MS medium (selective medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta for selection culture. The culture was subcultured at 28°C for 3-4 weeks, with subculture every 7 days. Explants with obvious buds were then transferred to shoot elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / L LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta) under the conditions of 28°C, 8 h / d of darkness, 16 h / d of light, and a light intensity of 8000 Lx. The selected buds were cut off (note that the incision should not contain callus), and transferred to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture at 28°C until rooting.

[0071] SH organic solution contains 10g / L nicotinic acid, 10g / L VB1, and 1g / L VB6.

[0072] When the regenerated seedlings have roots and grow to 4-5 true leaves, take them out of the culture bottle, slowly rinse off the culture medium on the roots with clean water, transplant them into a substrate that has been sterilized at high temperature and high pressure in advance, water them thoroughly and keep them warm and moist. After 3-4 days, you will see water droplets on the hole tray cover, and gradually open the cover to harden the seedlings.

[0073] 2) Detection of gene-edited plants:

[0074] The PBSE402 vector carries a GFP fluorescent tag, and the CTAB method was used to extract the DNA of the GFP-fluorescent watermelon regenerated seedlings. The steps were as follows: a small number of young leaves were quickly ground into powder in liquid nitrogen and placed in a 1.5 ml centrifuge tube; 800 μl of preheated CTAB extraction buffer was added and the tube was incubated in a 65°C waterbath for 30 min; an equal volume of chloroform / isoamyl alcohol was added, where the volume ratio of chloroform to isoamyl alcohol was 24:1, the tube was mixed, and the tube was centrifuged at 8000 rpm for 10 min; the supernatant was transferred to a new centrifuge tube, 2 / 3 of the volume of isopropanol was added, and the tube was gently mixed by inverting; the tube was centrifuged at 10000 rpm for 10 min; the supernatant was discarded, and the precipitate was rinsed twice with 75% ethanol by volume, the remaining liquid was discarded, and the tube was dried and dried for 3 min. The tube was then dissolved in 100 μl of ddH2O (containing 0.1% RNase) and stored at 4°C for later use.

[0075] Using the extracted DNA as a template, the edited lines used target 1 primers CRJC-ClWRKY60F / R to perform PCR amplification on the sequences of the two target sites respectively. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA.

[0076] The specific primer sequences are as follows:

[0077] CRJC-ClWRKY60F: CGGTATGGAAGTTCCGAAATTC; SEQ ID NO.10;

[0078] CRJC-ClWRKY60R: GTCGTCCACCGAGTTGCTAA; SEQ ID NO. 11.

[0079] The amplification system was: 2× Taq PCR StarMix with loading dye 10 μL, template 1 μL, upstream and downstream primers 1 μL each, ddH2O 7 μL. The PCR reaction program was: 94°C for 3 minutes; 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute, 30 cycles; 72°C for 5 minutes. PCR products were recovered based on band size and TA cloned. After positive PCR test results were obtained, clones were selected and sent for testing to confirm the editing event. Results are shown in the table. Figure 1 A total of two gene-edited plants, crwrky60-1 and crwrky60-2, were obtained, both of which were heterozygous for editing between Target1 and Target2.

[0080] 3) Detection of overexpression plants:

[0081] Using the cDNA reverse transcribed from the extracted RNA as a template, the expression level of the overexpression strain was detected using primers qRTPCR-ClWRKY60-F / R.

[0082] The specific primer sequences are as follows:

[0083] qRTPCR-ClWRKY60-F: ACCGACCTACACCGACCAACAT; SEQ ID NO.12;

[0084] qRTPCR-ClWRKY60-R: GGAATGATGATGCTTCTGCTCCAATT; SEQ ID NO. 13.

[0085] See the results Figure 2 A total of two overexpression lines, OEWRKY60-1 and OEWRKY60-2, were obtained. qRT-PCR analysis showed that the expression level of the ClWRKY60 gene in the overexpression lines was significantly higher than that in the wild-type plants.

[0086] The expression levels of ClWRKY60 genes in overexpression and wild-type strains were analyzed using Student's t test (**, P < 0.01, ****, P < 0.0001).

[0087] 4) Phenotypic observation of transgenic watermelon plants:

[0088] Seeds of the wild type (WT), overexpression lines OEWRKY60-1 and OEWRKY60-2, and edited plants crwrky60-1 and crwrky60-2 were soaked for 6 hours and then germinated in a dark environment at 28°C for about 30 hours. After the seeds turned white, they were sown individually in nutrient pots (8×7×7 cm). The seedlings were grown at 28°C / 18°C (day / night) and 18h / 6h (light / dark). Watering was done regularly and quantitatively every day. When the seedlings grew to three leaves and one heart, 50 seedlings with consistent growth were selected from each line and subjected to natural drought stress treatment. On the eighth day of treatment, photos were taken and samples were collected. The sample was the second fully expanded true leaf below the seedling growth point, for a total of three biological replicates.

[0089] See the results Figure 3 The results showed that under normal growth conditions (Drought 0d), there were no significant phenotypic differences between knockout, overexpression, and wild-type plants. However, after 8 days of drought treatment, the crwrky60-1 and crwrky60-2 knockout lines showed reduced tolerance to drought stress compared to wild-type plants, while OEWRKY60-1 and OEWRKY60-2 overexpression plants showed increased tolerance to drought stress.

[0090] 5) Determination of physiological indicators of transgenic watermelon plants:

[0091] (1) Net photosynthetic rate (Pn) was determined using the LI-6800 photosynthetic measurement system for photosynthetic physiological parameter analysis. The conditions for photosynthetic parameter determination were set as follows: gas flow rate 500 μmol s -1 , CO2 concentration in the reference chamber is 400 μmol mol -1 , relative humidity 50%, leaf chamber temperature 28 ℃. After the system was balanced, the net photosynthetic rate (Pn) was measured. Each treatment was repeated three times, and the data were analyzed using IBM SPSS Statistics 21 software. The Student's t test was used for statistical analysis (*, P < 0.05, **, P < 0.01, ****, P < 0.0001). The results are shown in Figure 4 .

[0092] (2) Determination of malondialdehyde (MDA) content: 0.2 g of fresh watermelon leaves were ground into a homogenate in 5 mL of phosphate buffer (50 mM, pH 7.8) in an ice bath. The homogenate was then transferred to a test tube and 5 mL of 0.5% thiobarbituric acid was added and boiled for 15 minutes. After the solution cooled to room temperature, it was centrifuged at 5000 g for 15 minutes. The absorbance of the supernatant at 532 nm and 600 nm was measured and recorded as A532 and A600, ΔA = A532-A600. MDA content (nmol / g Fw) = 25.8 × ΔA ÷ Fw, where: Fw is fresh weight. Each treatment was repeated three times, and the data were analyzed using IBM SPSS Statistics 21 software. The Student's t test was used for statistical analysis (*, P < 0.05, **, P < 0.01, ***, P < 0.001). The results are shown in Figure 5 .

[0093] (3) Superoxide dismutase (SOD) assay: 0.2 g of fresh watermelon leaves were ground into a homogenate in 5 mL of phosphate buffer (50 mM, pH 7.8) in an ice bath. The homogenate was then centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was the enzyme extract. 0.1 mL of the enzyme extract, 0.3 mL of phosphate buffer, 0.3 mL of 750 mM methionine, 0.3 mL of 7.5 μM nitro blue tetrazolium (NBT), 0.3 mL of 100 μM EDTA-Na2, 0.3 mL of 20 μM riboflavin, and 0.5 mL of distilled water were then vortexed and mixed. The test tube containing the above mixture was incubated under 4000 lx light for 20 minutes. The maximum absorbance value Ao of the mixture without the enzyme extract under light was recorded. The mixture without the enzyme extract under dark conditions was used as a blank for zero adjustment. The absorbance As was read at 560 nm. The SOD activity unit is defined as the unit that inhibits 50% of the photochemical reduction of NBT. -1 ·h-1 )=

[0094] [(Ao-As)×V×60] / (Ao×0.5×Fw×a×t), where: Fw is fresh weight, a is the volume of enzyme extract added, V is the total volume of extract, and t is the reaction time. Each treatment was repeated three times, and data were analyzed using IBM SPSS Statistics 21 software. Statistical analysis was performed using Student's t test (*, P<0.05, **, P<0.01). Results are shown in Figure 6 .

[0095] By measuring the physiological indicators of ClWRKY60 knockout, overexpression and wild-type plants, the results showed that ( Figure 4-6 ). Under normal growth conditions, net photosynthetic rate (Pn), malondialdehyde (MDA) content, and superoxide dismutase (SOD) activity did not differ significantly between knockout, overexpression, and wild-type plants (except between the WT and knockout lines). However, after drought treatment, MDA increased significantly in both knockout lines, while Pn and SOD activities decreased compared to the wild-type. Conversely, MDA decreased in the overexpression plants under drought stress, while Pn and SOD activities increased compared to the wild-type. These results suggest that knockout of ClWRKY60 reduces drought stress tolerance in watermelon, while overexpression increases it.

[0096] In summary, the present invention provides the watermelon WRKY transcription factor ClWRKY60 and clarifies its function in watermelon drought stress resistance, providing genetic resources for improving the drought tolerance of excellent watermelon germplasm and laying the foundation for the breeding of new varieties suitable for cultivation in water-scarce areas.

[0097] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of watermelon WRKY transcription factor ClWRKY60 in drought stress resistance, characterized in that: The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.

1.

2. Application of overexpression of watermelon WRKY transcription factor ClWRKY60 in positively regulating watermelon drought stress resistance, characterized in that: The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.

1.

3. Application of biomaterials overexpressing watermelon WRKY transcription factor ClWRKY60 in positively regulating watermelon drought stress resistance, characterized in that: The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.1; The biological material is any one of the following: A: an expression cassette capable of overexpressing the watermelon WRKY transcription factor ClWRKY60 having a nucleotide sequence as shown in SEQ ID NO.1; B: recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

4. Application of watermelon WRKY transcription factor ClWRKY60 in watermelon breeding, characterized in that: The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.

1.

5. Application of watermelon WRKY transcription factor ClWRKY60 in breeding drought-resistant watermelon germplasm, characterized in that: The nucleotide sequence of the watermelon WRKY transcription factor ClWRKY60 is shown in SEQ ID NO.1.

Images