SNP (Single Nucleotide Polymorphism) molecular marker for identifying brood amount of female sturgeon and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker for identifying the brood amount of female sturgeons and application of the SNP molecular marker, and belongs to the field of sturgeon genetic breeding and sturgeon molecular marker-assisted breeding. The SNP molecular marker for identifying the brood amount of the female sturgeon is located at the 117bp position of a GnA gene nucleotide sequence fragment; the polymorphic form of the SNP site is C / A, and the genotype of the SNP site comprises CC, CA or AA. Wherein the female individuals with the genotype of AA belong to low-brood-amount individuals, and the female individuals with the genotypes of CC and CA belong to high-brood-amount individuals. The molecular marker provided by the invention can be used for early-stage artificial screening of female sturgeon brood quantity characters, screening can be carried out in various female sturgeon groups such as acipenser schrenckii, Huso dauricus, acipenser sibiricum and hybrid sturgeons, and the artificial breeding process of sturgeon varieties with high brood quantity can be remarkably accelerated.

Description

Technical Field

[0001] The present invention belongs to the field of sturgeon genetic breeding and sturgeon molecular marker-assisted breeding, and particularly relates to a SNP molecular marker for identifying the egg carrying capacity of female sturgeons and an application thereof. Background Art

[0002] The primary economic value of sturgeons lies in the unfertilized eggs produced by female sturgeons during sexual maturity, the highly coveted "caviar." Caviar is hailed as the "black gold of water" for its nutritional value, medicinal properties, and delicious taste. Therefore, early screening for females with high egg production is crucial for the high-quality development of the caviar industry. With the advent of the "post-genomic" era, molecular markers have been widely used in the breeding of new animal breeds and the early screening of high-quality economic traits. The gonadotropin alpha subunit (GnA) is a core regulator of the gonadotropin-releasing hormone (GnRH) signaling pathway, playing a crucial role in regulating reproductive processes such as ovarian development and progesterone production by corpus luteum cells in female animals. GnRH is a neuropeptide hormone secreted by hypothalamic neurons and acts on the anterior pituitary gland to induce transcription of the GnA gene, promoting gonadotropin (Gn) production, thereby regulating reproductive processes such as sex differentiation, gonadal maturation, and germ cell development in female vertebrates. Currently, only the sterleted sturgeon (NCBI database: GCF_902713425.1) and the Chinese sturgeon (National Center for Bioinformation database: GWHBQEF00000000) have their reference genomes officially released. Complete genome data for other Acipenser species is lacking, and sturgeon chromosomes contain numerous redundant regions, making gene annotation difficult. Based on gene sequences released by the NCBI public database, the sterleted sturgeon gene with accession number LOC117403278 is annotated as "glycoprotein hormones alpha chain-like (GLHA)." Protein annotation information published by the UniProt open proteomics database indicates that the GLHA protein is also known as "gonadotropin alpha subunit" (https: / / www.uniprot.org / uniprotkb / P01215 / entry), and the gene encoding it is also named GnA. Therefore, the name of the sturgeon gene LOC117403278 is "gonadotropin alpha subunit" or "glycoprotein hormone alpha chain."

[0003] In recent years, the rapid development of high-throughput sequencing technology has provided a powerful foundation for the efficient analysis of variant sites across the entire animal genome and the development of molecular markers. Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have been widely used in animal marker-assisted selection (MAS) breeding research and also play an important role in the early artificial selection of individuals with superior traits. Therefore, the development of molecular markers for genes associated with superior economic traits is of great significance for shortening generation intervals, early artificial screening of individuals with superior traits, and improving the efficiency of new breed selection. To date, existing technologies have not documented the presence of SNP molecular markers in the GnA gene that are associated with the female sturgeon's egg-carrying capacity. Summary of the Invention

[0004] To facilitate the identification of female sturgeon egg carrying capacity, the present invention provides a molecular marker for the gene GnA, associated with female sturgeon egg carrying capacity, and its use in artificially screening individuals with high egg carrying capacity. This SNP molecular marker can be used to identify female sturgeon egg carrying capacity. This SNP locus is significantly correlated with female sturgeon egg carrying capacity. Therefore, by identifying the genotype of this SNP locus in female sturgeons, early selection of female sturgeons with high egg carrying capacity can be achieved.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides a SNP molecular marker for identifying the egg carrying capacity of female sturgeons. The SNP molecular marker for identifying the egg carrying capacity of female sturgeons is located at the 117th bp of the GnA gene nucleotide sequence fragment SEQ ID NO: 1; its polymorphism is C / A, wherein the genotype of the SNP site includes CC, CA or AA.

[0007] Furthermore, the nucleotide sequence of the primer pair for detecting the above SNP molecular marker is:

[0008] Forward primer F: 5'-AAGGCAATAAGCATTAGTCAAAACG-3', i.e., SEQ ID NO: 2;

[0009] Reverse primer R: 5′-TAATAATGTCAAGTGCACACGACAC-3′, ie, SEQ ID NO: 3.

[0010] An application of the SNP molecular marker in identifying the egg carrying capacity of female sturgeons comprises the following steps:

[0011] Step 1: extracting genomic DNA from the caudal fin tissue of the sturgeon to be tested;

[0012] Step 2: using the primers described in SEQ ID NO: 2 and SEQ ID NO: 3 to perform PCR amplification on the sturgeon genomic DNA to obtain a GnA gene nucleotide sequence fragment, namely SEQ ID NO: 1;

[0013] Step 3: Detect the genotype at 117bp of the above-mentioned PCR amplification product; among them, female individuals with genotype AA are low-egg-yielding individuals (egg weight / body weight <0.15), and female individuals with genotypes CC and CA are high-egg-yielding individuals (egg weight / body weight >0.25).

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker associated with the female sturgeon's egg carrying capacity trait. The SNP molecular marker is located at bp 4135900 of chromosome NC_081193.1 (a non-functional region upstream of the sturgeon GnA gene), i.e., bp 117 of the GnA gene nucleotide sequence (SEQ ID NO: 1). This molecular marker contains a C / A base mutation and is significantly correlated with the female sturgeon's egg carrying capacity trait. Individuals with the AA genotype have significantly lower egg carrying capacity than those with the CA and CC genotypes. Furthermore, the genotyping results at this SNP molecular marker site match the actual egg carrying capacity trait of female individuals at a rate of up to 84.38%. The molecular marker provided by the present invention can be used for early artificial screening of female sturgeon egg carrying capacity and can be used in a variety of female sturgeon populations, including Acipenser schrenckii, Acipenser dabryanus, Acipenser sibiricus, Acipenser sibiricus, Acipenser sterletus, and hybrid sturgeon. This SNP molecular marker of the gene GnA related to the sturgeon's egg-carrying capacity trait lays the foundation for marker-assisted selection of female individuals with high egg-carrying capacity, thereby significantly accelerating the artificial breeding process of high-egg-carrying sturgeon varieties.

[0016] By detecting the allele type of the target SNP molecular marker, the present invention can significantly shorten the time for artificially selecting female sturgeons with high egg-bearing capacity, thereby significantly reducing breeding and farming costs, effectively promoting the economic development of the sturgeon farming industry, and accelerating the genetic improvement process of sturgeon fertility traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 These are the three genotype sequencing peak diagrams of the PCR amplification products in Example 2 of the present invention. DETAILED DESCRIPTION

[0018] The technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only part of the embodiments of the invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0019] Example 1:

[0020] Screening of molecular markers related to the fertility trait of female sturgeons

[0021] 1. After dissecting, collecting eggs, and weighing sexually mature female sturgeons, 40 individuals with high egg-bearing weight (egg weight / body weight > 0.25) and 40 individuals with low egg-bearing weight (egg weight / body weight < 0.15) were randomly selected. The tail fin tissues were cut and stored in a frozen state at -20°C.

[0022] 2. Sturgeon genomic DNA was extracted using a universal DNA extraction kit to construct a sequencing library. After the sequencing library passed quality control, whole-genome resequencing (sequencing depth: 10×) was performed. After filtering, quality control, and assembly of the raw sequencing data, the obtained DNA sequences were aligned to the reference genome (reference genome version number: GCF_902713425.1) using bioinformatics software.

[0023] 3. Using variant detection software, genome-wide SNPs were annotated. Whole-genome resequencing annotation revealed 48 SNPs within the GnA gene, which is associated with egg fertility. Among these, the SNP at bp 4135900 on chromosome NC_081193.1 (located in a nonfunctional region upstream of the GnA gene, g.4135900 C>A) showed significant genotyping differences between individuals with high and low egg fertility. Individuals with high egg fertility showed a predominant CC / CA genotype at this SNP, while individuals with low egg fertility showed a predominant AA genotype.

[0024] Example 2:

[0025] Identification of polymorphic sites in the GnA gene of female sturgeon

[0026] 1. Collection of High- and Low-Grain Female Sturgeon Samples: All sturgeons for testing were obtained from Hangzhou Qiandao Lake Sturgeon Technology Co., Ltd. A total of 96 robust, healthy, and vigorous adult females were selected, measuring 133.09 ± 31.74 cm in length and 42.52 ± 4.88 kg in weight. After dissection, egg retrieval, and weighing, 26 females with a relative gravidity coefficient (egg weight / body weight) exceeding 25% were designated as the high-gravidity group, while 70 females with a relative gravidity coefficient (egg weight / body weight) below 15% were designated as the low-gravidity group. The caudal fins of these sturgeons were clipped for subsequent genomic DNA extraction and stored at -20°C.

[0027] 2. Extract genomic DNA from the caudal fin tissue of the female sturgeon to be tested: Use a universal DNA extraction kit to extract genomic DNA from the sturgeon. Then, test the integrity of the DNA sample using 2% agarose gel electrophoresis. Determine the DNA concentration and purity using a NanoDrop 2000 ultra-micro-spectrophotometer. Genomic DNA samples that meet the required concentration and are of good integrity should be stored at -80°C until further use.

[0028] 3. Amplify the nucleotide fragment containing the target SNP site (g.4135900 C>A)

[0029] 3.1 Primer Design: Based on the sturgeon reference genome published in the public database (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_902713425.1 / ), the complete sequence of the sturgeon GnA gene (NCBI accession number: LOC117403278) was downloaded. Primer design software was then used to design primers based on the partial nucleotide sequence of the GnA gene (including the target SNP site), including:

[0030] Forward primer F: 5′-AAGGCAATAAGCATTAGTCAAAACG-3′ (SEQ ID NO: 2);

[0031] Reverse primer R: 5'-TAATAATGTCAAGTGCACACGACAC-3' (SEQ ID NO: 3).

[0032] 3.2 PCR Amplification: A total of 20 μL of PCR reaction system was prepared, consisting of: 10 μL of 2× TSINGKE Master Mix, 1 μL of forward primer (15 μmol / L), 1 μL of reverse primer (15 μmol / L), 1 μL of template DNA (>200 ng / μL), and 7 μL of ddH2O. The PCR reaction conditions were as follows: ① 95°C pre-denaturation for 5 min; ② 35 amplification cycles, each consisting of 95°C denaturation for 30 s, 54°C annealing for 30 s, and 72°C extension for 30 s; ③ 72°C extension for 10 min.

[0033] 4. Identification of target SNP molecular marker genotype: The PCR amplification product obtained in step 3.2 was subjected to first-generation Sanger sequencing using the ABI 3730XL sequencing platform. The genotype at the 117th bp of the PCR amplification product was the genotype of the SNP molecular marker. The sequencing peaks of the three genotypes are shown in Figure 2. Figure 1 shown.

[0034] The PCR amplification product of the above detection primers (SEQ ID NO: 2, SEQ ID NO: 3) is 423 bp in length, and the sequence is shown in SEQ ID NO: 1, which includes a molecular marker site for the C>A mutation at 117 bp.

[0035] SEQ ID NO: 1

[0036] TGAAACTATGGTGAGATTAATTTAAAAAGAATGAATAAATTACTAGAAATGTCTGCTCTCTGGTACCTGACAGAACATTGCAATATAAAACTGTCTGTCTGCTCTGCAGATTTTGG[A / C]ACAGTAAACTGTGCATTGGTCCAGTACCCTGGCAGCAGTAATCTTTAACAATTCCTTACTGGCAGGATGCATTTTCCTGCTTAGTGTCACTAT GCTATCAAACATAGCAGAACACCCACAGGACACAATCCTGCATTCGCAACACTGTCAAAAACCAACATTGCTTACCTTGTCACTGCTCTACTTAACAGCAATATAGCCAACTATGTATTTATTATTGCACTGGTAACATGTTGATTACATATTAAAAGTAGGCTTGCACTTTATGTGATTCATGTGTCGTGTGCACTTGAACATTATTAAGAA.

[0037] Example 3:

[0038] Expanded population analysis of polymorphic sites in the GnA gene of female sturgeons: A general linear model (GLM) was used to conduct an association analysis between the target SNP molecular marker and the egg-carrying capacity trait in the 96 female sturgeons to be tested (Table 1). The results confirmed that the genotype of the target SNP molecular marker was significantly positively correlated with the egg-carrying capacity trait of sturgeons (P<0.05). At the same time, the matching rate between the genotyping results of this SNP molecular marker site and the actual egg-carrying capacity trait (high / low egg-carrying capacity) was 84.38%.

[0039] Table 1 Genotype frequencies of SNPs in high and low egg-carrying groups of sturgeon

[0040]

[0041] In the process of artificially selecting female sturgeons with high egg-bearing capacity, female individuals with CC and CA genotypes can be selected and retained, while individuals with AA genotype can be eliminated.

[0042] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. A SNP molecular marker for identifying the egg-bearing capacity of female sturgeons, characterized by: The SNP molecular marker for identifying the high and low egg carrying capacity of female sturgeons is located at the 117th bp of the nucleotide sequence fragment of the GnA gene SEQ ID NO:

1. Its polymorphism is C / A, and the genotype of its base mutation site includes CC, CA or AA. The primer sequences used to detect the above SNP molecular markers are: Forward primer F: 5'-AAGGCAATAAGCATTAGTCAAAACG-3', i.e. SEQ ID NO: 2, Reverse primer R: 5′-TAATAATGTCAAGTGCACACGACAC-3′, ie, SEQ ID NO:

3.

2. Use of the SNP molecular marker according to claim 1 in identifying the egg carrying capacity of female sturgeons.

3. The use according to claim 2, characterized in that The following steps are involved: Step 1: extracting genomic DNA from the tail fin tissue of the female sturgeon to be tested; Step 2: using the primers described in SEQ ID NO: 2 and SEQ ID NO: 3 to perform PCR amplification on the sturgeon genomic DNA to obtain a nucleotide sequence fragment of the GnA gene; Step 3: Detecting the genotype of the SNP molecular marker according to claim 1; wherein, female individuals with genotype AA are individuals with low egg yield, and female individuals with genotypes CC and CA are individuals with high egg yield.

Images