Duck plague virus UL13 gene deleted strain DPV-deltaUL13 as well as construction method and application thereof
By constructing the duck plague virus UL13 gene deletion strain DPV-ΔUL13 on a bacterial artificial chromosome recombination system, the problems of long virus construction cycle and residual sites in the existing technology were solved, and the attenuation effect of duck plague virus and enhanced immune response were achieved, which is suitable for attenuated live duck plague virus vaccine.
Patent Information
- Application Number
- CN202511015541.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-23
- Publication Date
- 2025-10-10
AI Technical Summary
The existing technology has the problems of long production cycle when constructing duck plague virus UL13 gene deleted virus vaccine, possible inclusion of difficult-to-detect parental virus and residual FRT sites, which affect the virulence of the virus and vaccine development, and lacks the effect of enhancing the immune response of ducks.
The Red/ET modification technology was used to construct the duck plague virus UL13 gene deletion strain DPV-ΔUL13 on the bacterial artificial chromosome recombination system platform. The Kan gene was removed through electroporation and homologous recombination of the ΔUL13-Kan targeting fragment to obtain the infectious clone pDPV-ΔUL13. The virus was rescued by liposome transfection and purified to obtain the UL13 gene deletion strain.
It reduced the pathogenicity of duck plague virus, increased the level of immune factors in ducks, induced the increased expression of IFIT5, IFN-β and OASL, showed potential as a live attenuated vaccine, and no duck plague symptoms appeared in infected ducks.
Smart Images

Figure CN120758574A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a duck plague virus vaccine, in particular to a duck plague virus UL13 gene deleted strain DPV-ΔUL13 and a construction method and application thereof. Background Art
[0002] Duck plague virus (DPV) is a spherical, enveloped, double-stranded DNA virus belonging to the family Herpesviridae and the genus Marek's virus. The DPV genome is approximately 162 kb in size and contains 78 ORFs, 65 of which are located in the UL region, 11 in the US region, and the remaining two in the intermediate repeat sequence (IRS) and the terminal repeat sequence (TRS). Clinical symptoms of DPV-infected ducks include persistent high fever, green, loose feces, tearing of the eyelids, paralysis of the legs, and, in some cases, swelling of the head and neck. Necropsy reveals bleeding in the esophageal mucosa, often accompanied by a grayish-yellow pseudomembrane or ulcers; congestion, hemorrhage, and edema of the cloacal mucosa; and hemorrhagic macules and grayish-white necrotic lesions of varying sizes in the liver. DPV is rapidly spreading, widespread, and has high morbidity and mortality rates. The World Health Organization has designated it a Category II infectious disease, making it a serious threat to the duck industry and causing significant economic losses.
[0003] The protein encoded by the duck plague virus UL13 protein and its homologs (such as EBV BGLF4, HCMV UL97, KSHV ORF36, MHV-68 ORF36, and VZV ORF47) is a serine / threonine protein kinase. In other herpesviruses, this protein has important influences on host and viral physiology, participating in the regulation of numerous cellular and viral proteins. For example, the proteins encoded by VZV ORF47 and KSHV ORF36 are crucial for viral proliferation in T and B cells; PRV UL13 inhibits zinc finger CCHC-type protein 3 expression, thereby affecting interferon-β; EBV BGLF4 is a regulator of the EBV immune gene viral interleukin-10 and deubiquitinase / deadenylase; and an alanine substitution at Ser-18 of HSV-2 UL13 significantly reduces HSV-2 replication and intercellular spread in U2OS cells. All these indicate that UL13 plays an important role in the immune escape and viral replication of herpes viruses, but there has not yet been any development of a virus vaccine with a UL13 gene deletion in duck plague virus.
[0004] The earliest method for constructing DPV gene-deleted / recombinant strains was the traditional homologous recombination method. After constructing a transfer vector with a reporter gene using the flanking sequence of the deleted region or the insertion site of the exogenous gene as the homologous recombination sequence (long in length, generally 1~2 kb), the transfer vector is transferred into cells for homologous recombination with the parental virus or its genomic DNA. This is achieved by plaque-picking and purification of the recombinant virus carrying the reporter gene. Each gene deletion / insertion requires the construction of its own transfer vector, so this method has a long cycle, and the obtained deleted virus may contain the parental virus that is difficult to detect. Afterwards, the BAC-based molecular cloning virus technology was used to clone the DPV full genome into a bacterial artificial chromosome (BAC) transfer vector to construct a bacterial artificial chromosome recombinant DPV rescue system platform DPV CHv-BAC-G. At the same time, combined with Red / ET modification technology, DPV gene deletion and exogenous gene insertion can be quickly and conveniently completed in the prokaryotic system Escherichia coli through mature genetic manipulation methods. However, after the DPV gene is deleted / inserted on the bacterial artificial chromosome recombinant DPV rescue system platform using Red / ET modification technology, residual FRT sites and MiniF elements will remain at the deleted / inserted gene. At present, there are no reports of DPV-deleted viruses constructed using this platform infecting ducks. The residual FRT sites and MiniF elements need to be removed before infecting ducks and evaluating the virulence of the virus, which increases the workload and steps of the recombination operation. In addition, the residual FRT exogenous sites and MiniF elements have an impact on the exploration of gene function, the development and licensing of live attenuated vaccines.
[0005] It should be noted that the information disclosed in the above background technology section is only used to enhance the understanding of the background of the present disclosure, and therefore may include information that does not constitute prior art known to ordinary technicians in the field. Summary of the Invention
[0006] The purpose of the present invention is to provide a duck plague virus UL13 gene deletion strain DPV-ΔUL13 and its construction method and application. The duck plague virus UL13 gene deletion strain DPV-ΔUL13 constructed by the present invention has reduced pathogenicity to ducks, improved the immune factor level of ducks, and can be used as an attenuated and deleted live vaccine of duck plague virus.
[0007] In order to achieve the above object, the present invention provides a method for constructing a duck plague virus UL13 gene deletion strain DPV-ΔUL13, which comprises the following steps: (1) Preparation of ΔUL13-Kan targeting fragment Using pEP-Kan-S as a template, PCR amplified the ΔUL13-Kan targeting fragment using the UL13-Kan-F / R primers shown in SEQ ID NOs. 1-2. The sequence of the ΔUL13-Kan targeting fragment is shown in SEQ ID NO. 18. (2) Electric shock conversion The ΔUL13-Kan targeting fragment was added to the pDPV-CHv50 competent cell, mixed thoroughly, and then transferred to a pre-cooled electroporation cuvette. Electroporation was performed at 2.5 kV for 5.4-5.7 ms. LB was immediately added and thoroughly pipetted. The cells were cultured with shaking at 30°C. Centrifugation was performed, and the supernatant was discarded. LB was added to resuspend the cells and the cells were coated on LB / Cm+Kan plates and cultured at 30°C. Single colonies were picked and streaked onto LB / Cm+Kan plates, cultured at 30°C, and PCR was used to identify the positive targeting clone pDPV-ΔUL13-kan. The sequence of the pDPV-ΔUL13-kan is shown in SEQ ID NO. 20. (3) Removal of the Kan gene by homologous recombination The targeting positive clone pDPV-ΔUL13-kan was inoculated into LB / Cm+Kan and cultured overnight at 30°C to obtain a seed solution. The seed solution was added to LB / Cm+Kan and cultured with shaking at 30°C and 180 rpm. The solution was centrifuged and the supernatant was discarded. LB / Cm and L-arabinose were added and cultured with shaking at 30°C, then at 42°C, and again at 30°C. The bacterial solution was added to LB, mixed, and then coated on an LB / Cm plate and cultured at 30°C. A single colony was selected as a template, and the UL13 flanking sequence was amplified by PCR using primers ΔUL13-F / R as shown in SEQ ID NOs. 7-8. The PCR product was sequenced and identified. The one with the correct sequence was the infectious clone pDPV-ΔUL13 of the duck plague virus UL13 gene deletion strain DPV-ΔUL13. (4) Virus rescue pDPV-ΔUL13 plasmid DNA was transfected into DEFs at a density of 90% using a liposome transfection reagent. Samples were collected after the appearance of green fluorescent spots, repeatedly frozen and thawed at -80°C, and then re-inoculated into DEFs. The duck plague virus UL13 gene deletion strain DPV-ΔUL13 was obtained by homologous recombination in DEFs, gradient dilution, and spot picking purification after fixation with methylcellulose.
[0008] Preferably, in step (1), the PCR amplification system is: 5L DNA Polymerase MAX, 0.3L UL13-Kan-F / R, 0.3L DNA template and 4.1L ddH2O; the PCR amplification program is: 98°C 3min; 98°C 10s, 55°C 15s, 72°C 15s, 30 cycles; 72°C 10min; 12°C ∞.
[0009] Preferably, the pDPV-CHv50 competent preparation method comprises: taking GS1783 bacteria containing pDPV-CHv50 infectious clone plasmid into LB / Cm, culturing at 30°C overnight to obtain seed liquid; adding all the seed liquid to LB / Cm, shaking and culturing at 30°C and 220r / min until OD 600 The cell suspension was stirred at 42 °C and 220 rpm for 20 min, and then immediately placed in an ice bath for cooling at 4 °C and 4500 rpm for 30 min. The supernatant was removed by centrifugation at 4 °C and 4500 rpm. The cells were operated on ice, and the precipitate was repeatedly washed with ultrapure water. Ultrapure water was added to resuspend the cells to obtain the competent state of pDPV-CHv50.
[0010] Preferably, in step (2), 200 ng of the ΔUL13-Kan targeting fragment is added to 100 µL of the pDPV-CHv50 competent medium, mixed thoroughly, and then transferred to a pre-cooled electric shock cup, electroporated at 2.5 kV for 5.4-5.7 ms, and immediately added to 800 L LB and thoroughly blown, cultured at 30°C and 180 r / min, centrifuged at 4500 r / min, the supernatant discarded, LB added to resuspend the bacteria and coated on an LB / Cm+Kan plate, cultured at 30°C, and PCR identified the targeting positive clone pDPV-ΔUL13-kan; wherein, the PCR uses primers ΔUL13F / R with the sequences of SEQ ID NO.7-8.
[0011] Preferably, in step (3), the targeting positive clone pDPV-ΔUL13-kan is inoculated into LB / Cm+Kan and cultured overnight at 30°C to obtain a seed solution. 10 L of seed solution is added with 1 mL of LB / Cm+Kan, cultured at 30°C and 180 r / min with shaking, centrifuged, and the supernatant is discarded. 1 mL of LB / Cm and 27 µL of 5 mol / L L-arabinose are added, cultured at 30°C and 220 r / min with shaking, then cultured at 42°C and 180 r / min with shaking, and then cultured at 30°C and 220 r / min with shaking; 1 L of bacterial solution is added with 200 L of LB, mixed, and then coated on an LB / Cm plate and cultured at 30°C for 24 to 48 h.
[0012] Preferably, in step (3), the PCR amplification system is: 5L 2×Hieff ® PCR Master Mix, 0.3 L UL13-F / R, 0.5 L DNA template and 3.9 L ddH2O; the PCR amplification program was: 98°C for 3 min; 98°C for 10 s, 55°C for 15 s, 72°C for 15 s, 30 cycles; 72°C for 10 min; 12°C ∞.
[0013] The second object of the present application is to provide the duck plague virus UL13 gene deletion strain DPV-ΔUL13 and its infectious clone pDPV-ΔUL13 obtained by the construction method.
[0014] The third object of the present application is to provide the use of the duck plague virus UL13 gene deletion strain DPV-ΔUL13 in preparing attenuated live vaccine of duck plague virus.
[0015] Preferably, the duck plague virus UL13 gene deletion strain DPV-ΔUL13 can enhance the immune response of the host after infection of DPV, and induce the expression of IFIT5, IFN-β and OASL to be increased.
[0016] The construction method and application of the duck plague virus UL13 gene deletion strain DPV-ΔUL13 of the present application have the following advantages: The duck plague virus UL13 gene deletion strain DPV-ΔUL13 constructed by the present application, the results of infection of ducklings show that the parent virus DPV-CHv50 and the revert virus DPV-UL13Rev infected ducks have typical symptoms of duck plague such as body temperature rising and death; and the UL13 gene deletion virus DPV-ΔUL13 infected ducks and the blank control MEM injected ducks do not have any symptoms of duck plague. The difference results of anatomical lesions and microscopic pathological changes show that the tissues and organs of the DPV-CHv50 and DPV-UL13Rev infected ducks are severely hemorrhagic and necrotic, while the tissues and organs of the DPV-ΔUL13 infected ducks and the blank control MEM injected ducks have no visible lesions. The qPCR detection results show that the DPV load of each tissue and organ of the DPV-ΔUL13 infected ducks is lower than that of the DPV-CHv50 and DPV-UL13Rev infected ducks, and the immune factor level is higher than that of the DPV-CHv50 and DPV-UL13Rev infected ducks. Therefore, the duck plague virus UL13 gene deletion strain DPV-ΔUL13 constructed by the present application has reduced pathogenicity to ducks, and can be used as a DPV attenuated live vaccine. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 The PCR identification results of the DPV-ΔUL13 and DPV-UL13Rev cloned bacteria in Example 1 of the present application; lane 1 is a negative control (ddH2O), lane 2 is a parent toxic cloned bacteria control (pDPV-CHv50), lane 3 is a targeting bacteria (pDPV-ΔUL13-kan), lane 4 is a Kan removal bacteria (pDPV-ΔUL13); lane 5 is a negative control (ddH2O), lane 6 is a UL13 deletion toxic cloned bacteria control (pDPV-ΔUL13), lane 7 is a targeting bacteria (pDPV-UL13Rev-kan), and lane 8 is a Kan removal bacteria (pDPV-UL13Rev).
[0018] Figure 2 This is an image of the fluorescent spot rescued by DPV-ΔUL13 and DPV-UL13Rev and the images after purification in Example 2 of the present invention.
[0019] Figure 3 These are the results of DPV-ΔUL13 activating the host immune response in Example 3 of the present invention; A is the result of IFIT5; B is the result of IFN-β; and C is the result of OASL.
[0020] Figure 4 The temperature and weight changes of ducks infected with DPV-ΔUL13 in Example 4 of the present invention; A is the body temperature of the infected duck; B is the weight of the infected duck.
[0021] Figure 5 This is the mortality rate of ducks infected with DPV-ΔUL13 in Example 4 of the present invention.
[0022] Figure 6 These are the microscopic pathological changes in the tissues and organs of ducks infected with DPV-ΔUL13 in Example 4 of the present invention.
[0023] Figure 7 The figures show the pathological changes in the heart, liver, spleen and thymus of ducks infected with DPV-ΔUL13 in Example 4 of the present invention.
[0024] Figure 8 The diagram shows the pathological changes in the duodenum, bursa of Fabricius, proventriculus and cecum of ducks infected with DPV-ΔUL13 in Example 4 of the present invention.
[0025] Figure 9 This is the viral load of duck tissues and organs infected with DPV-ΔUL13 in Example 4 of the present invention. DETAILED DESCRIPTION
[0026] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0027] Note: If specific conditions are not specified in the examples, the experiments were conducted under conventional conditions or those recommended by the manufacturer. Instruments used without manufacturer information are commercially available. Raw materials and reagents used without manufacturer information are commercially available or can be prepared by known methods.
[0028] Throughout this disclosure, all features, such as values, amounts, amounts, and concentrations, specified in numerical ranges or percentage ranges are provided for simplicity and convenience only. Accordingly, the description of numerical ranges or percentage ranges should be considered to encompass and specifically disclose all possible subranges and individual values within those ranges (including integers and fractions).
[0029] The features described in this disclosure may be combined in any manner, and as long as there are no conflicts between the combinations of these features, all possible combinations should be considered within the scope of this specification. Each feature disclosed in this specification may be replaced by any alternative feature that provides the same, equivalent, or similar purpose. Therefore, unless otherwise specified, the features disclosed are merely general examples of equivalent or similar features.
[0030] The test materials used in the following examples are as follows: 1. Duck embryos, ducklings, and cells Nine-day-old duck embryos and 14-day-old ducklings were tested to be free of DPV and DPV antibodies. Duck embryo fibroblasts (DEFs) were prepared from nine-day-old duck embryos and cultured in MEM medium (Gibco, Shanghai, China) supplemented with 10% newborn calf serum at 37°C in a cell culture incubator with 5% CO2.
[0031] 2. Virus strains and plasmids The DPV Chinese virulent strain (DPV-CHv) (accession number: NO.JQ647509.1) and the DPV full-genome infectious clone pDPV-CHv50 constructed by 50 generations of DPV-CHv in DEF cells and using bacterial artificial chromosomes as vectors were isolated, identified, constructed and preserved by Cheng Anchun et al.; the pEP-Kan-S plasmid was also provided and preserved by Cheng Anchun et al.
[0032] 3. PCR primers The cloning / deletion primers for UL13 were designed based on the genome sequence of the Chinese virulent DPV strain CHv, and the duck immune factor primers were designed based on the duck genome sequence. The sequences are shown in Table 1.
[0033] Table 1 PCR primers used in the experiment
[0034] Example 1 Construction of pDPV-ΔUL13 and pDPV-UL13Rev The pDPV-UL13Rev was constructed by reconstituting the UL13 gene on the basis of the pDPV-UL13 infectious clone. Finally, the UL13 gene deletion strain DPV-UL13 and the revertant DPV-UL13Rev were rescued in the DEFs according to Example 2.
[0035] The specific method is as follows: 1. First round of Red homologous recombination (1) Preparation of UL13-Kan and UL13Rev-Kan targeting fragments UL13-Kan and UL13Rev-Kan targeting fragments were amplified by PCR with pEP-Kan-S as a template, UL13-Kan-F / R (SEQ ID NO. 1~2) and UL13Rev-Kan-F / R (SEQ ID NO. 3~6) primers, and the PCR system: DNA Polymerase MAX 5L, 0.3L of each of the upstream primer and the downstream primer, 0.3L of DNA, and 4.1L of ddH2O. The amplification program: 98℃ 3min; 98℃ 10s, 55℃ 15s, 72℃ 15s, cycle 30 times; 72℃ 10min; 12℃ ∞, and the UL13-Kan and UL13Rev-Kan targeting fragments were amplified, and the sequences are as follows:
[0036] UL13-Kan (SEQ ID NO. 18):
[0037] UL13Rev-Kan (SEQ ID NO.19):
[0038] (2) Preparation of pDPV-CHv50 and pDPV-UL13 competent cells Pick out GS1783 containing pDPV-CHv50 and pDPV-UL13 and inoculate them into 5 mL LB / Cm (i.e., LB containing Cm resistance) respectively, and culture them at 30°C overnight to obtain seed solution. Add all the seed solution to 100 mL LB / Cm and culture at 30°C, 220 rpm, and shake to obtain OD 600 After the cell density reaches approximately 0.5, transfer to 42°C, 220 rpm, and shake incubate for 15 minutes. Immediately cool in an ice bath for 20 minutes. Centrifuge at 4°C, 4500 rpm, and discard the supernatant. Continue on ice. Wash the pellet five times with ultrapure water, centrifuge, and discard the supernatant. Resuspend the pellet in 500 µL of ultrapure water to obtain competent cells for pDPV-CHv50 and pDPV-UL13.
[0039] (3) Electric shock conversion 200 ng of the UL13-Kan and UL13Rev-Kan targeting fragments obtained above were added to 100 µL of the pDPV-CHv50 or pDPV-UL13 competent medium obtained above, mixed thoroughly, and transferred to a 4°C pre-chilled electroporation cuvette. Electroporation was performed at 2.5 kV for 5.4-5.7 ms. 800 µL of LB was added and pipetted thoroughly before transferring to a new EP tube. Incubate at 30°C with shaking at 180 rpm for 1 hour. Centrifuge at 4500 rpm for 2 minutes, discard the supernatant, add 200 µL of LB to suspend the cells, spread on LB / Cm+Kan plates (i.e., LB containing Cm+Kan), and incubate at 30°C for 48 hours. Single colonies were picked and streaked onto LB / Cm+Kan plates and incubated at 30°C for 24 hours. PCR was then performed using primers ΔUL13F / R (SEQ ID NOs. 7-8) using a 2×Hieff PCR system. ® PCR Master Mix (5 µL), ΔUL13F / R (0.3 µL each), DNA template (0.5 µL), and ddH₂O (3.9 µL). PCR program: 98°C (3 min); 98°C (10 s), 55°C (15 s), 72°C (15 s), 30 cycles; 72°C (10 min); 12°C (∞). Positive targeting clones (pDPV-ΔUL13-kan and pDPV-UL13Rev-kan) were identified, and the sequences are as follows:
[0040] pDPV-ΔUL13-Kan (SEQ ID NO. 20):
[0041] pDPV-UL13Rev-kan (SEQ ID NO. 21):
[0042] 2. The second round of homologous recombination removes the Kan gene The target-positive clones obtained above were inoculated into LB / Cm+Kan and cultured overnight at 30°C to obtain a seed solution. 10µL of the seed solution was added to 1mL of LB / Cm+Kan and incubated with shaking at 30°C and 180 rpm for 2 hours. The solution was centrifuged and the supernatant discarded. 1mL of LB / Cm and 27µL of 5mol / L L-arabinose were added and incubated with shaking at 30°C and 220 rpm for 1 hour. The solution was then placed in a 42°C water bath and incubated with shaking at 180 rpm for 30 minutes. The solution was incubated with shaking at 30°C and 220 rpm for 2 hours. 1µL of the bacterial solution was added to 200µL of LB, mixed, and plated onto LB / Cm plates. The plates were incubated at 30°C for 24-48 hours. A single colony was selected as a template for PCR using primers UL13-F / R (SEQ ID NOs. 7-8). The PCR system used was 2×Hieff ® PCR Master Mix (5 µL), UL13-F / R (0.3 µL each), DNA template (0.5 µL), and ddH₂O (3.9 µL). PCR program: 98°C (3 min); 98°C (10 s); 55°C (15 s); 72°C (15 s), 30 cycles; 72°C (10 min); 12°C (∞). Amplify the ΔUL13 and UL13Rev sequences and sequence the PCR products. Correct sequencing indicates the successful construction of pDPV-ΔUL13 and pDPV-UL13Rev infectious clones. Sequencing results are as follows:
[0043] pDPV-ΔUL13 (SEQ ID NO. 22): aagaacaactcgcaataaaggatgcgctagaggcgcacagaaggtttttatcgccaggcctaattgatcgtctagatgatgaagaagataaactcgcaataaaggaggatttattaactgaagttgcagaaaggtgtctaccgggacccgaaaacactatagggggactatctggtaacgaatggctggacgaagacgacgaagccctattagcgaaatgaatctaccatgagtggggatagatggtagctcatcgccagtacatcactgcaaacgtcgtcgaaacacttcatggaatagttctcccgagaatattggcaacgcggacgaaacgtacggtaattgtgattatacaacacttggagaatctaacgaacatactagtaataatgaattgtgctctattgaacatgactgggg。
[0044] pDPV-UL13Rev(SEQ ID NO.23):
[0045] like Figure 1 As shown, it is the PCR identification result of pDPV-ΔUL13 and pDPV-UL13Rev in Example 1 of the present invention, and the obtained target bacteria and Kan-removed bacteria are correct.
[0046] Example 2 Rescue of recombinant virus The pDPV-ΔUL13 and pDPV-UL13Rev infectious clone plasmids in Example 1 were respectively extracted and transfected into DEFs with a density of 90%. The samples were collected after culture until viral fluorescent spots appeared, repeatedly frozen and thawed at -80°C, and then re-inoculated into DEFs. The constructed viruses DPV-ΔUL13 and DPV-UL13Rev were obtained by homologous recombination in DEFs, gradient dilution, and spot picking purification after fixation with methylcellulose.
[0047] like Figure 2 Shown are images of DPV-ΔUL13 and DPV-UL13Rev rescuing fluorescent spots and culturing in DEFs after purification in Example 2 of the present invention.
[0048] Example 3 Effect of UL13 protein deletion on DPV-induced immune response 10 2 TCID 50 DPV-ΔUL13, DPV-UL13Rev and parental virus DPV-CHv50 were grouped and infected with 14-day-old ducks according to Table 2. Four ducks in each group were randomly killed at 24h, 48h and 72h. Blood and immune organs such as spleen, bursa of Fabricius and thymus were collected. RNA was extracted and reverse transcribed into cDNA. The transcription levels of IFN-β and its downstream antiviral factors were detected by qPCR.
[0049] qPCR system: 5 µL SYBR Green, 0.3 µL each of primers F / R, 0.8 µL cDNA, and 3.6 µL ddH₂O. The reaction protocol was 40 cycles of 95°C for 30 s, 95°C for 5 s, and 60°C for 20 s. Primers used: qIFN-β-F / R (SEQ ID NOs. 11-12) for IFN-β, qOASL-F / R (SEQ ID NOs. 13-14) for OASL, and qIFIT5-F / R (SEQ ID NOs. 9-10) for IFIT5.
[0050] Table 2 Grouping of ducks in immune response experiment
[0051] like Figure 3As shown in Example 3 of the present invention, DPV-ΔUL13 activates the host immune response. The results show that DPV-ΔUL13 can significantly induce higher levels of IFIT5 in ducks than DPV-UL13Rev and DPV-CHv50 ( Figure 3 A), IFN-β ( Figure 3 B) and OASL ( Figure 3 C) Transcription, indicating that the loss of UL13 protein enhances the host immune response after DPV infection.
[0052] Example 4 Pathogenicity of DPV-ΔUL13 to ducks 1. Clinical symptoms of infected ducks To investigate whether UL13 protein is involved in the pathogenesis of DPV, 10 5 TCID 50 DPV-ΔUL13, DPV-UL13Rev and DPV-CHv50 were grouped and infected into 14-day-old ducks according to Table 3. The ducks were observed for 10 days, and the clinical symptoms, mortality, weight and temperature of the infected ducks were recorded every day.
[0053] Table 3 Grouping and infection of ducks in pathogenicity experiment
[0054] like Figure 4 Figure 4 shows the changes in body temperature and weight of ducks infected with DPV-ΔUL13, DPV-CHv50, and DPV-UL13Rev in Example 4 of the present invention. A represents the body temperature of the infected ducks, and B represents the weight of the infected ducks. The results show that the body temperature of the ducklings in the DPV-ΔUL13 and MEM groups was within the normal range (40.5-42.5°C), and no clinical symptoms of duck plague were observed. However, the body temperature of the ducklings in the DPV-CHv50 and DPV-UL13Rev groups rose sharply to over 42.8°C on the third day of infection, fluctuating between 42.8 and 43.86°C for 96 hours. The ducklings also showed swelling of the head and neck, lethargy, and reluctance to move. The body temperature returned to normal on the sixth day. The weight gain trend of the ducks infected with DPV-ΔUL13 was consistent with that of the ducks in the MEM group, showing a steady increase. The initial weight changes of ducks infected with DPV-CHv50 and DPV-UL13Rev showed a decreasing trend, and their appetite recovered and their weight increased slowly. However, compared with the DPV-ΔUL13 group and the MEM group, their weight decreased ( Figure 4 B).
[0055] like Figure 5The mortality of ducks infected with DPV-ΔUL13, DPV-CHv50 and DPV-UL13Rev in Example 4 of the present application is shown in Table 3. The ducks in the DPV-ΔUL13 group had no mortality, while 5 ducks in each of the DPV-CHv50 and DPV-UL13Rev groups died, with a mortality rate of 50%. The above results show that the pathogenicity of the deletion virus to ducks is reduced after the UL13 gene is knocked out.
[0056] 2. Pathological changes in infected ducks 36 14-day-old ducks were grouped and infected according to Table 4. On the 2nd, 6th and 10th day after infection, 3 ducks were randomly killed from each group, and the pathological changes in the heart, liver, spleen, thymus, glandular stomach, duodenum, caecum and bursa of Fabricius were observed, and samples were taken for detection of the DPV copy number.
[0057] Table 4. Grouping and infection of experimental ducks for observation of pathological changes
[0058] As Figures 7 and 8 shown in Table 3, the mortality of ducks infected with DPV-ΔUL13, DPV-CHv50 and DPV-UL13Rev in Example 4 of the present application is shown in Table 3. The ducks in the DPV-ΔUL13 group had no mortality, while 5 ducks in each of the DPV-CHv50 and DPV-UL13Rev groups died, with a mortality rate of 50%. The above results show that the pathogenicity of the deletion virus to ducks is reduced after the UL13 gene is knocked out.
[0059] Microscopic pathological observation was performed on the liver, spleen, thymus and duodenum of the ducks infected for 6 days, and the results are shown in Table 5. Figure 6As shown in the figure, the livers of ducks infected with DPV-ΔUL13 showed hepatic lobular structures, central veins, and portal areas, similar to those in the MEM control group. Hepatocyte cytoplasm contained fat vacuoles of varying sizes, resembling adipocytes. In the spleen, splenocytes formed cords surrounding the splenic sinusoids, and the splenic corpuscles were normal, without hemorrhage or other lesions. The villi of the duodenum were densely arranged in a lobular structure, without any breakage, detachment, or necrosis. The intestinal wall muscle fibers were orderly arranged with an intact muscular layer. The thymic cortex and medulla were intact, with normal corpuscles and no abnormal blood cell aggregates. However, the livers of ducks infected with DPV-CHv50 and DPV-UL13Rev showed dilation and congestion of the central veins and surrounding hepatic venous sinuses. Hepatocytes in the central lobules atrophied and disappeared, and congested areas in the central lobules of adjacent lobules were connected by congestive bands. The splenic sinusoids were abnormally filled with blood cells, with numerous splenic cell fragments. The duodenal villi were ruptured, and the intestinal wall muscle layer was thinned. Blood cells and numerous cell fragments were present in the thymic cortex.
[0060] The above results show that compared with DPV-CHv50 and DPV-UL13Rev, DPV-ΔUL13 significantly reduced its pathogenicity to ducks.
[0061] 3. Viral load in infected ducks 0.1 g of each tissue and organ from ducks killed on the 2nd, 6th, and 10th day after infection were taken and placed in 1 mL of PBS for fragmentation. After thorough homogenization, DNA was extracted. A 10-L qPCR system (2× Taq Man Mix: 5 L, primer F / R: 0.5 L each, Probe: 0.5 L, DNA: 1 L, ddH2O: 2.5 L) was prepared using the UL30-F / R primers (SEQ ID NO. 15-16) and DPV UL30 probe (SEQ ID NO. 17) in Table 1. The reaction procedure was (95°C: 30 s; 95°C: 5 s, 60°C: 30 s, 40 cycles), and the viral load in each tissue and organ was detected by qPCR.
[0062] like Figure 9 As shown in Example 4 of the present invention, the viral loads in various tissues and organs of ducks infected with DPV-ΔUL13, DPV-CHv50 and DPV-UL13Rev were 10 4.03~6.58 copies / 0.1g, while the viral load of DPV-CHv50 and DPV-UL13Rev infected ducks on the 2nd and 6th day was 10 6.13~10.20 copies / 0.1g, and decreased significantly to 10 on the 10th day. 5.52~6.80copies / 0.1g; the DPV genome copy numbers of DPV-ΔUL13 in various tissues and organs on the 2nd and 6th days after infection were significantly lower than those in the DPV-CHv50 and DPV-UL13Rev groups of ducks. Compared with the parental virus and the revertant virus, the viral loads of various tissues and organs of the UL13-deficient virus were significantly reduced, indicating that the proliferation ability of the UL13-deficient duck plague virus in ducks was significantly weakened.
[0063] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A method for constructing a duck plague virus UL13 gene deletion strain DPV-ΔUL13, characterized in that: The method comprises the following steps: (1) Preparation of ΔUL13-Kan targeting fragment Using pEP-Kan-S as a template, PCR amplified the ΔUL13-Kan targeting fragment using the UL13-Kan-F / R primers shown in SEQ ID NOs. 1-2. The sequence of the ΔUL13-Kan targeting fragment is shown in SEQ ID NO.
18. (2) Electric shock conversion The ΔUL13-Kan targeting fragment was added to the pDPV-CHv50 competent cell, mixed thoroughly, and then transferred to a pre-cooled electroporation cuvette. Electroporation was performed at 2.5 kV for 5.4-5.7 ms. LB was immediately added and thoroughly pipetted. The cells were cultured with shaking at 30°C. Centrifugation was performed, and the supernatant was discarded. LB was added to resuspend the cells and the cells were coated on LB / Cm+Kan plates and cultured at 30°C. A single colony was streaked onto an LB / Cm+Kan plate and cultured at 30°C. PCR was used to identify the positive targeting clone pDPV-ΔUL13-kan. The sequence of pDPV-ΔUL13-kan is shown in SEQ ID NO.
20. (3) Removal of the Kan gene by homologous recombination The targeting-positive clone pDPV-ΔUL13-kan was inoculated into LB / Cm+Kan and cultured overnight at 30°C to obtain a seed solution. The seed solution was added to LB / Cm+Kan and cultured with shaking at 30°C and 180 rpm. The solution was centrifuged and the supernatant was discarded. LB / Cm and L-arabinose were added and cultured with shaking at 30°C, then at 42°C, and again at 30°C. The bacterial solution was mixed with LB and applied to an LB / Cm plate, which was then cultured at 30°C. A single colony was selected as a template, and the UL13 flanking sequence was amplified by PCR using primers ΔUL13-F / R as shown in SEQ ID NOs. 7-8. The PCR product was sequenced and identified. The one with the correct sequence was the infectious clone pDPV-ΔUL13 of the duck plague virus UL13 gene deletion strain DPV-ΔUL13. (4) Virus rescue The pDPV-ΔUL13 plasmid DNA was transfected into DEFs at a density of 90%. Samples were collected after the appearance of green fluorescent spots. After repeated freezing and thawing at -80°C, the DEFs were re-inoculated. The duck plague virus UL13 gene deletion strain DPV-ΔUL13 was obtained by homologous recombination in DEFs, gradient dilution, and spot picking purification after fixation with methylcellulose.
2. The construction method according to claim 1, characterized in that In step (1), the PCR amplification system is: 5L DNA Polymerase MAX, 0.3L UL13-Kan-F / R, 0.3L DNA template and 4.1L ddH2O; The PCR amplification program was as follows: 98°C for 3 min; 98°C for 10 s, 55°C for 15 s, 72°C for 15 s, 30 cycles; 72°C for 10 min; 12°C ∞.
3. The construction method according to claim 1, characterized in that The method for preparing the pDPV-CHv50 competent state comprises: GS1783 bacteria containing the pDPV-CHv50 infectious clone plasmid were selected and inoculated into LB / Cm and cultured overnight at 30°C to obtain seed solution; All the seed solution was added to LB / Cm and cultured at 30°C and 220 r / min until OD 600 The cell suspension was shaken at 42°C and 220 rpm for 20 min, and then centrifuged at 4°C and 4500 rpm to remove the supernatant. The cells were repeatedly washed with ultrapure water on ice and finally resuspended in ultrapure water to obtain competent pDPV-CHv50.
4. The construction method according to claim 1, wherein In step (2), 200 ng of the ΔUL13-Kan targeting fragment was added to 100 µL of the pDPV-CHv50 competent medium, mixed thoroughly, and transferred to a pre-cooled electroporation cup. The mixture was electroporated at 2.5 kV for 5.4-5.7 ms. 800 L of LB was immediately added and thoroughly blown. The mixture was cultured at 30°C and 180 r / min with shaking. The mixture was centrifuged at 4500 r / min, the supernatant was discarded, LB was added to resuspend the cells, and the cells were coated on LB / Cm+Kan plates. The cells were cultured at 30°C, and PCR was used to identify the targeting-positive clone pDPV-ΔUL13-kan. The PCR used primers ΔUL13F / R with the sequences of SEQ ID NO. 7-8.
5. The construction method according to claim 1, characterized in that In step (3), the target-positive clone pDPV-ΔUL13-kan was inoculated into LB / Cm+Kan and cultured overnight at 30°C to obtain seed liquid. 10L of seed liquid was added to 1 mL of LB / Cm+Kan, cultured at 30°C and 180 r / min, centrifuged, and the supernatant was discarded. 1 mL of LB / Cm and 27µL of 5mol / L L-arabinose were added, cultured at 30°C and 220 r / min, and then placed in a 42°C water bath for culture at 180 r / min, and then cultured at 30°C and 220 r / min. 1L of bacterial liquid was added to 200L of LB, mixed, and then spread on an LB / Cm plate and cultured at 30°C for 24-48h.
6. The construction method according to claim 1, characterized in that In step (3), the PCR amplification system is: 5L2×Hieff ® PCR Master Mix, 0.3 L UL13-F / R, 0.5 L DNA template and 3.9 L ddH2O; the PCR amplification program was as follows: 98°C for 3 min; 98°C for 10 s, 55°C for 15 s, 72°C for 15 s, 30 cycles; 72°C for 10 min; 12°C ∞.
7. The duck plague virus UL13 gene deleted strain DPV-ΔUL13 and its infectious clone pDPV-ΔUL13 obtained by the construction method according to claims 1 to 6.
8. Use of the duck plague virus UL13 gene deleted strain DPV-ΔUL13 according to claim 7 in preparing a live attenuated duck plague virus deleted vaccine.
9. The use according to claim 8, characterized in that The duck plague virus UL13 gene deletion strain DPV-ΔUL13 can enhance the host's immune response after infection with DPV and induce increased expression of IFIT5, IFN-β and OASL.