Application of hydroxytyrosol in liver organ function optimization

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of hydroxytyrosol in liver organ function optimization. The invention discloses a vomitoxin antagonist screening method based on a TGR5 target spot. The vomitoxin antagonist screening method comprises the following steps: constructing a TGR5 / pCREB tool cell; screening a natural product by combining a luciferase luminescence kit; processing the tool cells; if the luminous intensity is obviously increased, the natural product has the function of activating the TGR5, and if the luminous intensity is reduced, the natural product has the activity of inhibiting the TGR5. According to the application disclosed by the invention, the hydroxytyrosol is found to simultaneously improve liver cell functions and liver organ development by activating a TGR5 receptor for the first time, and a new direction is provided for liver health maintenance and regenerative medicine.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to an application of hydroxytyrosol in optimizing the function of liver organoids. Background Art

[0002] Deoxynivalenol (DON) is a mycotoxin widely found in grains and feed. It can induce damage to various cells, including hepatocytes and intestinal epithelial cells, leading to health problems such as immunosuppression, intestinal inflammation, and liver damage. Current methods for repairing DON damage suffer from unclear efficacy, significant side effects, and unclear mechanisms of action. Hydroxytyrosol, a natural polyphenolic compound, has demonstrated antioxidant and anti-inflammatory activities, but its role and mechanism in repairing DON-induced cell damage remain unclear.

[0003] In addition to DON-induced cell damage, abnormal proliferation of liver cells (such as human L02 hepatocytes), mitochondrial dysfunction, and impaired liver tissue regeneration are also core pathological hallmarks of liver diseases such as cirrhosis and liver injury. Liver organoids, as three-dimensional culture systems that mimic the in vivo liver microenvironment, are valuable for studying hepatocyte proliferation and differentiation and evaluating drug toxicity. However, current technologies for screening natural compounds for optimizing liver organoid function lack effective targets.

[0004] Hydroxytyrosol is a natural polyphenol with antioxidant and anti-inflammatory properties, but its regulatory effects and mechanisms on normal hepatocytes and liver organoids are still unclear.

[0005] The potential effects of hydroxytyrosol have expanded from single toxin damage repair to a wider range of cellular function regulation, but no studies have revealed its effects on normal hepatocyte proliferation, mitochondrial homeostasis and liver organoid development, nor has it been clarified whether it mediates the above effects through the TGR5 receptor. Summary of the Invention

[0006] This study demonstrates for the first time that hydroxytyrosol improves both hepatocyte function and liver organoid development by activating the TGR5 receptor, providing new insights into liver health maintenance and regenerative medicine. The study investigated the effects of hydroxytyrosol on the proliferation and mitochondrial function of normal human hepatocytes (L02) and their TGR5-dependent mechanisms. The study also validated the beneficial effects of hydroxytyrosol on the proliferation, differentiation, and morphological development of mouse liver organoids.

[0007] The present invention provides a method for screening a vomitoxin antagonist based on the TGR5 target, comprising the following steps:

[0008] (1) Construction of TGR5 / pCREB tool cells;

[0009] (2) using the tool cells obtained in step (1) by processing the natural product;

[0010] (3) Detecting the luminescence intensity of luciferase: If the luminescence intensity increases significantly, it indicates that the natural product has the function of activating TGR5. If the luminescence intensity decreases, it indicates that it has the activity of inhibiting TGR5;

[0011] Furthermore, natural products that can activate TGR5 can serve as candidates for DON antagonists.

[0012] Furthermore, the specific construction process of the tool cell in step (1) is as follows: using TGR5 overexpressing cells to transfect the pCREB-TA-Luc reporter gene plasmid;

[0013] Furthermore, the vomitoxin is deoxynivalenol DON.

[0014] The present invention provides an application in screening natural products, characterized in that the candidate vomitoxin antagonist is hydroxytyrosol, hyocholic acid or a combination thereof.

[0015] Furthermore, the hydroxytyrosol activated TGR5 in the concentration range of 1–5 μM.

[0016] The present invention provides a method for optimizing liver organoid function, comprising the following steps:

[0017] (1) Adding candidate DON antagonists to the liver organoid culture system;

[0018] (2) After 8-48 hours of culture, the diameter of the liver organoids increased.

[0019] Furthermore, the liver organoids are derived from mouse or human primary hepatocytes.

[0020] The present invention provides the use of a TGR5 activator in preparing a product for resisting DON-induced liver damage.

[0021] Furthermore, the product is a functional feed additive;

[0022] Furthermore, the functional feed additive comprises hydroxytyrosol or hyocholic acid.

[0023] Furthermore, the functional feed additive is used to prevent liver damage caused by DON contamination in animal husbandry.

[0024] The present invention provides an application of a composition for resisting DON toxicity in the preparation of a liver disease treatment drug or an organoid culture medium additive;

[0025] Furthermore, the composition comprises hydroxychlorohydrin and a TGR5 activator.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] This study demonstrates for the first time that the TGR5 receptor is the core target of hydroxytyrosol's regulation of hepatocytes and liver organoids, distinct from traditional antioxidant mechanisms. This approach fills a gap in the technology for optimizing liver organoid function with natural compounds, providing a new tool for organoid applications in drug screening and liver disease modeling. Hydroxytyrosol, as a food-derived ingredient (e.g., olive oil extract), is readily available and low in toxicity, making it suitable for development as a functional food or feed additive. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the agarose gel electrophoresis diagram of the pig GPBAR1 cloned product in Example 1. Figure 1 A: Electrophoresis of porcine GPBAR1 cloned products, lane 1 (1): cloned product; lane 2 (2): molecular weight marker; Figure 1 B: Schematic diagram of molecular weight markers;

[0029] Figure 2 Schematic diagram of the VP010-CMV-3flag-mcs-EF1-NEO vector plasmid in Example 1;

[0030] Figure 3 This is the gel electrophoresis diagram of the GPBAR1 / plasmid double enzyme digestion product in Example 1. Figure 3 A: Electrophoresis of plasmid and GPBAR1 double enzyme digestion products; Lane 1: VP010-CMV-3flag-mcs-EF1-NEO EcoR I / BamH I product; Lane 2: Molecular weight marker (Marker); Lane 3: Sus GPBAR1 EcoR I / BamH I digestion product; Figure 3 B: Schematic diagram of molecular weight markers;

[0031] Figure 4 This is the sequencing result diagram in Example 1;

[0032] Figure 5 The Western blot method was used to detect the overexpression of GPBAR1 (TGR5) in Example 1; A is the expression level of the target protein in wild-type cells (WT) and TGR5-overexpressing cells, and B is the expression level of the internal reference protein β-actin;

[0033] Figure 6 This is a representative image of the morphology of liver organoids after 24 hours of DON treatment in Example 1;

[0034] Figure 7 This is a diagram of liver organoid expansion at different time points in Experimental Example 1. DETAILED DESCRIPTION

[0035] The materials used in the embodiments and experimental examples are as follows:

[0036] Cell line: normal human hepatocyte L02.

[0037] Liver organoid model: primary liver organoids from C57BL / 6 mice.

[0038] Main reagents: hydroxytyrosol (purity ≥95%), TGR5 inhibitor (INT-777), EdU staining kit, cell apoptosis kit, mitochondrial membrane potential detection kit (JC-1), ATP detection kit, and hepatocyte differentiation marker antibodies (ALB, CK19) are all commercially available products.

[0039] Main instruments: cell culture incubator, microplate reader, fluorescence inverted microscope.

[0040] Example 1

[0041] A model of DON-induced hepatocyte injury via TGR5 was constructed by evaluating TGR5 / pCREB tool cell activation or inhibition ability, human hepatocyte TGR5 mRNA expression level, human hepatocyte L02 cell viability, and mouse liver organoid expansion viability. This model can be used to screen natural products for antagonizing DON toxicity.

[0042] (1) DON inhibits the activity of cell TGR5

[0043] 1. Construction of TGR5 overexpressing cells:

[0044] Experimental reagents:

[0045] Table 1 Main experimental reagents and manufacturers

[0046] 2. Preparation of target DNA fragment and vector

[0047] According to the target sequence, design primers for PCR reaction to amplify the target fragment:

[0048] Sus GPBAR1-F SEQ ID NO.1: CGGAATTCATGCATCATCATCATCATCATTGACA;

[0049] Sus GPBAR1-R SEQ ID NO.2: CGGGATCCGTTCAAGTCAAGGTCCACGCTGCTTT;

[0050] The reaction system is shown in Table 2:

[0051] Table 2 Reaction system

[0052] PCR reaction conditions: 95℃ 10min; 95℃ 30sec, 60℃ 30sec, 72℃ 2min, 30 cycles; 72℃ 10min, 4℃ 30min. Figure 1 As shown: The molecular weight of the PCR product is about 1000 bp, which is consistent with the molecular weight of the target gene GPBAR1 (TGR5), preliminarily indicating that the cloning is correct. The product was recovered by gel and double enzyme digestion was performed.

[0053] 3. Combine the target fragment and the vector plasmid VP010-CMV-3flag-mcs-EF1-NEO (such as Figure 2 shown).

[0054] Double enzyme digestion was performed with EcoR I and BamH I. The enzyme digestion system is shown in Tables 3 and 4:

[0055] Table 3 Enzyme digestion system

[0056] Enzyme digestion at 37°C for 5 h;

[0057] Table 4 Enzyme digestion system

[0058] Enzyme digestion at 37°C for 5 h;

[0059] The results are as follows Figure 3 As shown: the products of the plasmid and GPBAR1 fragment after double enzyme digestion are about 8000bp and 1000bp respectively, which are consistent with the size of the target fragment, indicating that the double enzyme digestion process is correct and the next step of fragment connection can be carried out.

[0060] 4. Connect the recovered and purified target fragment to the recovered and purified vector. The connection system is as follows:

[0061] Table 5 Connection system

[0062] Ligate at 25°C for 5 hours. Transform the ligated product into DH5α competent cells and plate onto Amp-resistant LB solid medium. Pick a single colony and inoculate it into Amp-resistant LB liquid medium. Incubate overnight at 37°C at 250 rpm. Send the bacterial solution for sequencing. The results are as follows: Figure 4 As shown, the sequencing results were aligned correctly.

[0063] 5. Cell recovery

[0064] Remove IPEC-J2 cells from liquid nitrogen and quickly place them in a 37°C water bath. Gently shake the cryovial to dissolve the cryoprotectant. After dissolution, transfer the cells to a centrifuge tube containing 5 ml of culture medium and collect the cells by centrifugation at 1000 rpm for 5 minutes at room temperature. Discard the supernatant. Resuspend the cells in complete culture medium (DMEM + 10% FBS + 1% (Penicillin-Streptomycin Solution) containing 10% fetal bovine serum) and inoculate them into a culture dish. Gently pipette to mix thoroughly and culture at 37°C in a saturated humidity of 5% CO2.

[0065] 6. Cell passaging When the cell density reaches 80%, the cells are passaged: discard the culture medium and wash once with PBS; add 2 ml of trypsin to digest the cells and observe under a microscope. Digest for 3 minutes. When the cells are separated and rounded, the digestion is complete; quickly discard the trypsin, add complete culture medium, gently blow the cells to make a single-cell suspension, pass them at a ratio of 1:3, and expand the culture at 37°C and 5% CO2 saturated humidity.

[0066] 7. Cell transfection: Take IPEC-J2 cells in the logarithmic growth phase and in good growth condition, and use 2×10 5 Cells were seeded into 6-well plates and cultured overnight in a 37°C, 5% CO2 incubator. Two hours before transfection, the medium was changed to serum-free DMEM. Transfection steps: For each transfection sample, the following preparations were performed:

[0067] a) Dilute 4 μg of plasmid with 100 μl of serum-free Opti-MEM, mix gently with a pipette tip, and let stand at room temperature for 5 minutes;

[0068] b) Before use, gently mix Lipofectamine™ 2000, then dilute 5 μl of Lipofectamine™ 2000 in 100 μl of opti-MEM and let it stand at room temperature for 5 minutes;

[0069] c) After standing at room temperature for 5 minutes, mix Lipofectamine™ 2000 and the plasmid dilution (total volume 200 μl), mix gently, and stand at room temperature for 20 minutes;

[0070] (4) Add 200 μl of the mixture to each well and gently shake the cell culture plate back and forth to mix the mixture with the culture medium in the culture plate;

[0071] (5) The cells were cultured in a 37°C, 5% CO2 incubator. After 6 h, the mixed solution was aspirated and replaced with normal culture medium.

[0072] (6) Culture in a 37°C, 5% CO2 incubator.

[0073] 8. Cell treatment: IPEC-J2 cells in logarithmic growth phase and in good growth condition were plated at 2×105 cells / well in 6-well plates and cultured overnight at 37°C. The following groups were transfected according to the above transfection steps:

[0074] Grouping: Group A OE-NC, Group B OE-GPBAR1; Action time: Subsequent detection was performed 48 hours after transfection; Subsequent detection was performed after the required cell culture time.

[0075] Western blot was used to detect TGR5 overexpression. Figure 5 As shown, TGR5 was hardly expressed in the control group (wild-type group), while it was significantly expressed in the overexpression group, indicating that TGR5 cells were successfully overexpressed. Subsequent cell maintenance and passage were carried out using a culture medium containing 20 mg / mL neomycin.

[0076] 9. TGR5 / pCREB Cell Construction: The obtained TGR5-overexpressing cells were further transfected with the pCREB-TA-Luc reporter gene plasmid (Byotime, Catalog No. D4050). Transfection was performed according to the manufacturer's instructions. For example, for one well of a 24-well cell culture plate, the following ratio was used: 25 μL of serum-free medium, 500 ng of plasmid (Byotime, D4050-100 μg), and 0.8 μL of Lipo8000 were evenly mixed and added to one well of the 24-well cell culture plate. Cultured in a cell culture incubator for 48 hours. Treatment with drugs or natural products was then performed for 4 hours. Chemiluminescence was then measured using a luciferase reporter gene assay kit (e.g., Beyotime, Catalog No. RG5006) to generate the TGR5 / pCREB tool cells.

[0077] Natural products were screened using TGR5 / pCREB tool cells and a luciferase luminescence kit.

[0078] When TGR5 / pCREB tool cells are treated with drugs or natural products with TGR5 activating or inhibiting activity, the luminescence intensity will change significantly. If the luminescence intensity increases significantly, it indicates that the natural product has the function of activating TGR5. If the luminescence intensity decreases, it indicates that it has the activity of inhibiting TGR5.

[0079] A negative control group (untransfected IPEC-J2, i.e., IPEC-J2 cells without any treatment (including transfection and drug treatment)) was set up for the determination and correction of the baseline chemiluminescence value, a blank group, and a TGR5 / pCREB (treated with 25, 50, 100, 150, and 200 ng / mL DON) group.

[0080] As shown in Table 6, as the DON concentration increased, the chemiluminescence intensity of the transfection group decreased in a dose-dependent manner.

[0081] Table 6 DON inhibits TGR5 / pCREB cell luminescence

[0082] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0083] (2) Confirmation of DON's inhibitory effect on TGR5

[0084] For further verification, the cells were co-treated with DON using the TGR5 activator TC-G 1005 and the changes in chemiluminescence values ​​were detected.

[0085] A negative control group, a blank group, a TG-C1005 (2.5 μmol / L) group, a DON group (150 ng / mL), and a TC-G1005+DON (150 ng / mL) group were set up.

[0086] As shown in Table 7, TC-G 1005 can alleviate the decrease in luminescence activity of TGR5 / pCREB cells induced by DON, confirming that TGR5 is the target of DON-induced cell apoptosis.

[0087] Table 7 TC-G 1005 antagonizes the inhibitory effect of DON on TGR5

[0088] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0089] (3) DON inhibits the expression of TGR5

[0090] To confirm whether DON can inhibit the activity and expression of TGR5 across species and organ tissues, the human hepatocyte cell line L02 was used for verification;

[0091] L02 cells were seeded into 6-well cell culture plates and cultured normally (37°C, 100% humidity, 5% CO2) in a control group (cultured in culture medium (RMPI 1640 + 10% FBS (fetal bovine serum)) and a DON group (different from the control group, in which the culture medium also contained 100 ng / mL DON). Samples were collected 24 hours after treatment. mRNA extraction and fluorescence quantitative PCR were performed according to the instructions of a commercially available mRNA extraction kit and one-step qPCR detection kit to detect TGR5 mRNA levels (upstream primer SEQ ID NO. 3: 5'-CGGATGTTGCTGATGATGAA-3', downstream primer SEQ ID NO. 4: 5'-GCTTGATGGTGCTGTTGATG-3').

[0092] The results are shown in Table 8. After DON treatment, the expression level of TGR5 in L02 cells was significantly decreased.

[0093] Table 8 TGR5 mRNA expression levels in L02 cells in different treatment groups

[0094] Furthermore, L02 cells were seeded into 6-well cell culture plates and a control group (normal culture medium), a DON group (culture medium containing 100 ng / mL DON), a hyocholic acid (HCA) group (culture medium containing 100 μmol / L hyocholic acid as a TGR5 activator), and a DON+hyocholic acid (HCA) group (culture medium containing 100 μmol / L hyocholic acid as a TGR5 activator; containing 100 ng / mL DON) were set up. After 24 hours of treatment, samples were collected and mRNA was extracted and the level of TGR5 mRNA was detected by fluorescence quantitative PCR according to the instructions of a commercially available mRNA extraction kit and one-step qPCR detection kit (upstream primer SEQ ID NO. 3: 5'-CGGATGTTGCTGATGATGAA-3', downstream primer SEQ ID NO. 4: 5'-GCTTGATGGTGCTGTTGATG-3').

[0095] control group (normal culture medium), DON group (culture medium containing 100 ng / mL DON), hyocholic acid group (culture medium containing 100 μmol / L hyocholic acid as a TGR5 activator), and DON + hyocholic acid (HCA) group (culture medium containing 100 μmol / L hyocholic acid as a TGR5 activator; containing 100 ng / mL DON);

[0096] The results are shown in Table 9. Porcine bile acid can help L02 cells antagonize the reduction of TGR5 expression induced by DON. The results indicate that TGR5 plays an important role in antagonizing DON-induced cytotoxicity.

[0097] Table 9 TGR5 mRNA expression levels in L02 cells in different treatment groups

[0098] (4) DON inhibits L02 cell viability

[0099] The cells were cultured in a culture dish at 37°C, 100% humidity, and 5% CO2 until the cells were about 80% confluent. The culture medium was then discarded and the cells were trypsinized with phosphate-buffered saline (PBS) for 8 minutes. 1×10 cells were added to each well. 4 The number of L02 cells was inoculated into a 96-well plate, and the blank group and 25, 50, 100, 150, and 200 ng / mL DON treatment groups were set up after treating L02 cells for 24 h.

[0100] The results showed that when the DON concentration was higher than 50 ng / mL, the viability of L02 cells decreased in a dose-dependent manner (P<0.05).

[0101] Table 10 Effect of hydroxytyrosol on improving the decrease in L02 cell viability induced by DON

[0102] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0103] (5) DON inhibits the expansion of liver organoids through TGR5

[0104] Cholangiocytes were isolated from mouse livers. A control group and a DON group (100 ng / mL of DON in culture medium) were set up. Cholangiocytes were mixed with Matrigel (40182ES) and seeded into 48-well plates. 25 μL of Matrigel was added to each well and cultured in a cell culture incubator for 15 minutes. After the Matrigel solidified, 200 μL of organoid culture medium (Advanced DMEM / F12 containing 100 ng Rspondin 1, 100 ng Wnt 3a, 50 ng Noggin, 100 mg HGF, 1× N2 supplement (thermo 17502048), 1× B27 supplement (thermo, 17504044) or a commercially available hepatobiliary organoid culture medium of the same type) were added to each well. The plates were cultured in a cell culture incubator at 37°C, 100% humidity for 24 hours. The formation efficiency and diameter of the organoids were calculated.

[0105] The results showed that DON treatment for 24 h significantly reduced the formation efficiency and size of organoids (P < 0.05, Figure 6and Table 11). The formation efficiency was reduced by 61% and the diameter was reduced by more than 35%.

[0106] Table 11 Organoid formation efficiency and diameter after DON treatment

[0107] Experimental Example 1

[0108] Application of TGR5 as a target in screening natural products that antagonize DON-induced toxicity

[0109] By establishing a cell model system for DON-induced toxicity targeting TGR5, this system can be used to efficiently and accurately screen natural products that have the potential to antagonize DON toxicity.

[0110] (1) Screening of natural products with TGR5 activation activity

[0111] Based on the TGR5 / pCREB tool cells obtained in step (1) of Example 1;

[0112] Combine TGR5 / pCREB tool cells and luciferase luminescence kit to screen natural products;

[0113] Standard: When the cells are treated with a natural product, the luminescence intensity increases significantly, indicating that the natural product has the function of activating TGR5;

[0114] Therefore, wild-type cell group, TGR5 / pCREB cell group, hydroxytyrosol treatment group, oleanolic acid treatment group, naringin group, hesperidin group, hesperetin group, proanthocyanidin group, chlorogenic acid group, and vitamin E group were set, and the concentration of natural product treatment was set to 5 μmol / L;

[0115] Among them, vitamin E (application number CN202510186775.0) and chlorogenic acid (application number CN202411252077.8) were both reported to improve DON-induced cytotoxicity and were tested here as positive controls.

[0116] The results are shown in Table 12. Only hydroxytyrosol activated TGR5, while the other natural product groups had no significant effect on the luminescence intensity of TGR5. This indicates that hydroxytyrosol can precisely ameliorate DON toxicity by regulating TGR5 activity.

[0117] Table 12 Screening of natural products with TGR5 activation activity

[0118] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0119] To further verify that hydroxytyrosol activates TGR5 and improves the effect of DON, it has cross-species universality;

[0120] L02 cells were transfected with liposome transfection reagent Lipo8000 (Beyotime, Shanghai) and pCREB-TA-Luc reporter gene plasmid (Beyotime, Shanghai) at a ratio of 25 μL serum-free medium, 500 ng plasmid (beyotime, D4050-100 μg), and 0.8 μL Lipo8000. The cells were then added to one well of a 24-well cell culture plate and treated for 48 hours.

[0121] A negative control group was further set up: no plasmid was transfected;

[0122] Transfection group: transfection with pCREB-TA-Luc plasmid;

[0123] Hydroxytyrosol-treated group: 5 μmol / L hydroxytyrosol;

[0124] DON group: 100 ng / mL DON;

[0125] Hydroxytyrosol + TGR5 inhibitor (SBI-115) treatment group;

[0126] Hydroxytyrosol + DON group: 5 μmol / L hydroxytyrosol + 100 ng / mL DON;

[0127] After treatment at 37 °C and 100% humidity for 24 h, the chemiluminescence intensity was detected using the chemiluminescence function of a microplate reader.

[0128] The results are shown in Table 13. The luminescence value of the DON group was significantly reduced, while that of the hydroxytyrosol group was significantly increased. After co-treatment of hydroxytyrosol with SBI-115 and DON, it was found that both the TGR5 inhibitor and DON could inhibit the increase in luminescence value induced by hydroxytyrosol.

[0129] These results indicate that DON can inhibit cell viability through TGR5, and hydroxytyrosol can antagonize the DON-induced decrease in TGR5 activity.

[0130] Table 13 Activation effect of hydroxytyrosol on TGR5

[0131] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0132] (2) Hydroxytyrosol promotes L02 cell viability

[0133] L02 cells were seeded into 96-well cell culture plates at 1 x 10 4 Cells,

[0134] Cells were treated as follows: Control group: L02 cells cultured normally, Hydroxytyrosol group: 0.5, 1, 2.5, 5, 10, 20, 40 μmol / L hydroxytyrosol, treated for 24 hours at 37°C, 37°C, 100% humidity.

[0135] As shown in Table 14, when the concentration of hydroxytyrosol was in the range of 1-5 μmol / L, the viability of L02 cells increased by 0.5%-14% (P < 0.05), but when the concentration exceeded 10 μmol / L, it induced cytotoxicity (P < 0.05).

[0136] Table 14 Effect of hydroxytyrosol on the viability of L02 cells

[0137] Statistical analysis was performed using one-way ANOVA, and the same row label without the same lowercase letter (such as a, b, c) indicates a significant difference.

[0138] (3) Hydroxytyrosol alleviates the decrease in L02 cell viability induced by DON

[0139] L02 cells were seeded into 96-well cell culture plates at 1 x 10 4 Cells;

[0140] Cells were treated as follows: Control group: L02 cells cultured normally,

[0141] DON group: 100 ng / mL DON,

[0142] Hydroxytyrosol + DON group: 2.5 μmol / L hydroxytyrosol + 100 ng / mL DON

[0143] Treated for 24 hours at 37°C, 37°C, 100% humidity.

[0144] As shown in Table 15, DON caused a 24% decrease in the viability of L02 cells, while HT restored the viability of the cells by 19% (P < 0.05).

[0145] Table 15 Effect of hydroxytyrosol on the improvement of the decrease in L02 cell viability induced by DON

[0146] Statistical analysis was performed using one-way ANOVA, and the same row label without the same lowercase letter (such as a, b, c) indicates a significant difference.

[0147] (4) TGR5 inhibitor SBI-115 blocks the effect of hydroxytyrosol on improving cell viability

[0148] L02 cells were seeded into 96-well cell culture plates, with 1×104 cells per well.

[0149] The cells were divided into the following groups: control group: normal cultured L02 cells,

[0150] Hydroxytyrosol group: 2.5 μmol / L hydroxytyrosol,

[0151] Hydroxytyrosol + SBI-115 group: 2.5 μmol / L hydroxytyrosol + 10 μmol / L SBI-115.

[0152] The results are shown in Table 16. The TGR5 inhibitor SBI-115 can block the activity of hydroxytyrosol, further confirming that TGR5 is the target of hydroxytyrosol in improving cell viability.

[0153] Table 16 SBI-115 blocks the effect of hydroxytyrosol

[0154] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0155] (5) Hydroxytyrosol can promote the expansion of mouse liver organoids

[0156] Hepatobiliary cells were isolated from the livers of 4-6 week-old C57BL / 6 mice. A control group and a hydroxytyrosol (5 μmol / L) group were set up and cultured at 37°C, 100% humidity for 8, 24, and 48 hours. The surface area of ​​the organoids was counted;

[0157] The results are as follows Figure 7 As shown in Table 17, hydroxytyrosol treatment for 24 and 48 hours promoted the expansion of liver organoids (P < 0.05).

[0158] Table 17 Effects of hydroxytyrosol on the diameter of mouse liver organoids at different time points

[0159] Experimental Example 2

[0160] (1) Hydroxytyrosol helps mice resist DON-induced liver damage

[0161] To confirm the effect of hydroxytyrosol in improving and inhibiting DON-induced liver injury;

[0162] 4-6 week old ICR mice were used as materials to construct control group, DON group and DON+hydroxytyrosol group.

[0163] The control group was fed normally;

[0164] The DON group was orally administered with vomitoxin (deoxynivalenol) at a dose of 200 μg / kg body weight;

[0165] The DON+hydroxytyrosol group received 20 mg / kg body weight of hydroxytyrosol in addition to the DON group;

[0166] 10 mg / kg hydroxytyrosol + 5 mg / kg hyobolic acid were administered simultaneously, and the experimental period was 14 days.

[0167] After the experiment, the levels of inflammatory factor TNF-α in the mouse liver and AST and ALT in the serum were detected.

[0168] The results are shown in Tables 18-20. After the experiment, the levels of TNF-α in the livers of DON mice were significantly increased, as were the levels of AST and ALT in their serum, indicating that DON caused liver damage in the mice. However, hydroxytyrosol or the combination of hydroxytyrosol and hyobolic acid significantly reduced the levels of these factors, suggesting that oral administration of hydroxytyrosol or co-administration of hydroxytyrosol with other natural products that activate TGR5 can help protect against DON-induced liver damage in animal models.

[0169] Table 18 TNF-α expression levels in mouse liver

[0170] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0171] Table 19 AST content in mouse serum

[0172] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0173] Table 20 ALT levels in mouse serum

[0174] One-way ANOVA was used for statistical analysis. Data with no identical lowercase letters (e.g., a, b, c) within the same column indicated significant differences.

[0175] The present invention can be widely used in the food industry (such as the development of food additives that resist mycotoxin contamination), the medical field (such as the development of drugs for treating DON-related cell damage), and the animal husbandry industry (such as the preparation of feed additives that resist DON toxicity).

[0176] The present invention designs a cell damage repair technology, specifically involving deoxynivalenol (DON)-induced cell damage repair, liver cell function regulation, and cell proliferation and differentiation optimization technology based on a mouse liver organoid model.

[0177] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for screening vomitoxin antagonists based on the TGR5 target, characterized in that: The steps include: (1) Construction of TGR5 / pCREB tool cells; (2) using the tool cells obtained in step (1) by processing the natural product; (3) Detection of luciferase luminescence intensity: If the luminescence intensity increases significantly, it indicates that the natural product has the function of activating TGR5. If the luminescence intensity decreases, it indicates that it has the activity of inhibiting TGR5. Among them, natural products that have the function of activating TGR5 can serve as candidates for vomitoxin antagonists.

2. The method according to claim 1, characterized in that The specific construction process of the tool cells in step (1) is as follows: TGR5-overexpressing cells are transfected with the pCREB-TA-Luc reporter gene plasmid; Wherein, the vomitoxin is deoxynivalenol DON.

3. Use of the method according to claim 1 in screening natural products, characterized in that: The candidate vomitoxin antagonist is hydroxytyrosol, hyocholic acid or a combination thereof.

4. The use according to claim 3, characterized in that The hydroxytyrosol activated TGR5 in the concentration range of 1–5 μM.

5. A method for optimizing liver organoid function, characterized in that: Here are the steps: (1) adding the candidate vomitoxin antagonist of claim 3 to a liver organoid culture system; (2) After 8-48 hours of culture, the diameter of the liver organoids increased.

6. The method according to claim 5, wherein The liver organoids are derived from mouse or human primary hepatocytes.

7. Application of TGR5 activators in the preparation of products against DON-induced liver injury.

8. The use according to claim 7, characterized in that The product is a functional feed additive; Among them, the functional feed additive contains hydroxytyrosol or hyorbic acid.

9. The use according to claim 8, characterized in that The functional feed additive is used for preventing liver damage caused by DON pollution in animal husbandry.

10. Use of a composition for resisting DON toxicity in the preparation of a drug for treating liver disease or an additive for organoid culture medium; in, The composition comprises a hydroxychloroalcohol and a TGR5 activator.

Images