Verticillium dahliae mutant strain as well as construction method and application thereof

By constructing a mutant strain of Verticillium dahliae and replacing the gene encoding stylosporin dehydratase with the hygromycin gene, the problem of low efficiency in fungal melanin extraction was solved, and simple and stable stylosporin production and efficient accumulation of melanin precursors were achieved.

CN120775705APending Publication Date: 2025-10-14INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510723446.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-10-14

AI Technical Summary

Technical Problem

The final product of fungal melanin is difficult to extract efficiently due to its complex structure and heterogeneity. Traditional methods are cumbersome and time-consuming, which limits its large-scale application.

Method used

By constructing a mutant strain of Verticillium dahliae, the hygromycin gene Hyg was used to replace the stylosporin dehydratase encoding gene VDAG_03393 to block the melanin synthesis pathway. Homologous recombination technology was used to obtain a genetically engineered strain that can accumulate stylosporin in large quantities, and stylosporin was extracted by ethyl acetate extraction.

Benefits of technology

The method realizes the simple and stable production of cylindrosporin under conventional culture conditions, overcomes the tedious and time-consuming problems of traditional extraction methods, and provides an efficient way to accumulate melanin precursor substances.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120775705A_ABST
    Figure CN120775705A_ABST
Patent Text Reader

Abstract

The invention provides a verticillium dahliae mutant strain as well as a construction method and application thereof, a homologous recombination technology is adopted to replace a cotylidone dehydratase encoding gene with a hygromycin gene, a genetic engineering strain capable of accumulating a large amount of cotylidone under conventional culture conditions is obtained, the strain is simple in culture process, stable in phenotype and high in yield, and the yield of cotylidone is increased. The method can be used for producing the cotylidone, and the fungus melanin is synthesized by using the cotylidone, so that the defects of time consumption, complicated steps and the like in the traditional fungus melanin extraction method are overcome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of microbial technology, and in particular to a mutant strain of Verticillium dahliae and a construction method and application thereof. Background Art

[0002] Melanin is a class of polymers formed by the oxidative polymerization of phenolic or indole substances and is widely found in bacteria, fungi, plants, and animals. Its unique physical and chemical properties endow it with multiple biological functions, such as resistance to ultraviolet radiation, antioxidants, anti-hydrolytic enzymes, heavy metal binding, and resistance to extreme temperatures and drought, making it crucial for the survival and self-protection of organisms. In fungi, melanin not only participates in the regulation of physiological activities (such as hyphal differentiation and spore formation) but is also closely related to its pathogenicity. For example, plant pathogenic fungi use melanin to enhance their ability to infect their hosts. In addition, fungal melanin shows a wide range of application potential in human life, including as an active ingredient in sunscreens, antioxidants, and biosemiconductor materials.

[0003] Currently, fungal melanin is primarily synthesized via two pathways: the DOPA pathway and the dihydroxynaphthalene (DHN) pathway. The DHN pathway, particularly common in Ascomycetes and Deuteromycetes, begins with the production of 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) catalyzed by polyketide synthase. This is then converted to the intermediate scytalone by reductase, and then to the final product, DHN melanin, through dehydration, oxidative polymerization, and other steps. However, the complex and heterogeneous structure of the final fungal melanin product makes it difficult to efficiently extract. Traditional methods (such as high-temperature alkaline dissolution) are cumbersome, time-consuming, and inefficient, limiting their large-scale application.

[0004] Therefore, there is an urgent need for an extraction method for precursor substances (such as cylindrosporin) for melanin synthesis, which can accumulate intermediates by blocking the synthesis pathway and provide new ideas for the development of high value-added products. Summary of the Invention

[0005] The purpose of the present disclosure is to provide a method for extracting precursor substances (such as cylindrospermone) for melanin synthesis, which overcomes the shortcomings of traditional methods for extracting fungal melanin, such as time-consuming and cumbersome steps, by blocking the synthesis pathway to accumulate intermediate products.

[0006] In order to achieve the above-mentioned object, the present disclosure provides a first aspect of a mutant strain of Verticillium dahliae, wherein the mutant strain of Verticillium dahliae is obtained by using a recombinant fragment comprising the upstream and downstream coding regions of the hygromycin gene Hyg to modify the gene encoding the cylindrosporine dehydratase in the wild-type strain of Verticillium dahliae. VDAG_03393 Knockout was performed to obtain; The sclerosporine dehydratase encoding gene VDAG_03393The nucleotide sequence is shown in SEQ ID NO.1.

[0007] In another aspect, the present disclosure provides a method for constructing the aforementioned Verticillium dahliae mutant strain, the method comprising the following steps: S1. Determine the sequence regions targeting the upstream and downstream homology arms of the VDAG_03393 gene; S2. constructing a homologous recombination knockout vector, wherein the homologous recombination knockout vector sequentially comprises an upstream homology arm, a hygromycin resistance gene Hyg expression cassette, and a downstream homology arm; S3, introducing the homologous recombination knockout vector into wild-type Verticillium dahliae through Agrobacterium-mediated genetic transformation; S4. Screen hygromycin-resistant transformants and verify the VDAG_03393 gene knockout mutant strain by PCR.

[0008] Optionally, in step S1, the lengths of the upstream homology arm and the downstream homology arm are independently 1-2 kb, and they target the VDAG_03393 The genomic sequence upstream of the gene's start codon and downstream of its stop codon.

[0009] Optionally, in step S2, the upstream homology arm, the hygromycin resistance gene Hyg expression cassette and the downstream homology arm are connected into a linear recombinant fragment by overlap extension PCR; The primer pair sequences for amplifying the upstream homology arms are shown in SEQ ID NO.2 and SEQ ID NO.3: ACTCACTATAGGGCGAATTGGGTACCATTGCTCGTAAGGTTGTGC SEQ ID NO.2, TCGACCTCGAGGGGGGGGCCCGGTACCGCTATGAGTTGGAGTCTGT SEQ ID NO.3; The primer pair sequences for amplifying the downstream homology arms are shown in SEQ ID NO.4 and SEQ ID NO.5: AGCCCGGGGGATCCACTAGTTCTAGAAAGGACCGCTCCGCTCTATC SEQ ID NO.4, TCCACCGCGGTGGCGGCCGCTCTAGATCCACCCTCTTGCTTTGCC SEQ ID NO.5.

[0010] Optionally, in step S4, the PCR verification includes performing PCR amplification using a primer pair spanning the knockout site, and the knockout is determined to be successful when the size of the amplified product differs from that of the wild-type Verticillium dahliae gene fragment by no less than 0.3 kb.

[0011] In another aspect, the present disclosure provides a method for extracting cylindrosporin from the mutant strain, the method comprising the following steps: SS1, placing the mutant strain in an activation medium for a first culture to obtain a first bacterial cell; SS2, placing the first bacterial cell in a liquid culture medium for a second culture to obtain a second bacterial cell; SS3, resuspending the second bacterial cell in sterile water, and applying the suspension to a solid culture medium for a third culture to obtain a third bacterial cell; SS4. Dry and crush the third bacterial body, extract the powder of the third bacterial body 3-4 times with ethyl acetate, and rotary evaporate and concentrate the extract.

[0012] Optionally, the activation culture medium comprises potato dextrose agar medium; the potato dextrose agar medium contains 180-220 g / L of potato, 18-22 g / L of glucose and 14-16 g / L of agar powder; The liquid culture medium includes a CM liquid culture medium; the CM liquid culture medium contains 5-7 g / L yeast extract, 5-7 g / L acid hydrolyzed casein, and 8-12 g / L sucrose; The solid culture medium includes a BMM solid culture medium; the BMM solid culture medium contains 4-6 g / L of glucose, 0.1-0.3 g / L of sodium nitrate, 0.50-0.54 g / L of potassium chloride, 0.50-0.54 g / L of magnesium sulfate heptahydrate, 1.50-1.54 g / L of potassium dihydrogen phosphate, 2-4 μM of vitamin B1, 0.1-0.3 mM of vitamin H, 14-16 g / L of agar powder, and a pH of 7.4-7.6.

[0013] Optionally, the first culture conditions include: culturing at 24-26° C. for 3-5 days; The second culture conditions include: shaking culture at 24-26°C and 140-160 rpm for 2-3 days; The conditions of the third culture include: culturing at 24-26° C. in the dark for 10-14 days.

[0014] On the other hand, the present disclosure provides the use of cylindrosporin extracted from the mutant strain in promoting fungal melanin deposition.

[0015] Optionally, the fungus includes at least one of Verticillium dahliae, Botrytis cinerea, and Rice blast fungus.

[0016] Through the above technical solution, the present disclosure provides a mutant strain of Verticillium dahliae, a construction method, and an application thereof. By using homologous recombination technology, the gene encoding stylosporin dehydratase is replaced with the hygromycin gene, thereby obtaining a genetically engineered strain capable of accumulating stylosporin in large quantities under conventional culture conditions. The strain has a simple culture process and a stable phenotype, can be used to produce stylosporin, and can be used to synthesize fungal melanin, thereby overcoming the shortcomings of traditional methods for extracting fungal melanin, such as being time-consuming and complex.

[0017] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following detailed description, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 Comparison of melanin production phenotypes between the wild type and VDAG_03393 knockout strains.

[0019] Figure 2 TLC analysis of mutant strain VDAG_03393 showed accumulation of stylosporin.

[0020] Figure 3 Mass spectrometry analysis of secreted components of Verticillium dahliae.

[0021] Figure 4 The effect of different concentrations of crude extract of cylindrosporin on melanin deposition of VDAG_03393 mutant strain. DETAILED DESCRIPTION

[0022] The following describes the specific embodiments of the present disclosure in detail. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present disclosure and are not intended to limit the present disclosure.

[0023] The present disclosure provides a mutant strain of Verticillium dahliae, wherein the mutant strain of Verticillium dahliae is obtained by using a recombinant fragment comprising the upstream and downstream coding regions of the hygromycin gene Hyg to modify the gene encoding the cylindrosporine dehydratase in the wild-type strain of Verticillium dahliae. VDAG_03393 Knockout was performed; The stylosporin dehydratase encoding gene VDAG_03393 The nucleotide sequence is shown in SEQ ID NO.1.

[0024] In another aspect, the present disclosure provides a method for constructing the aforementioned Verticillium dahliae mutant strain, the method comprising the following steps: S1. Determine the sequence regions targeting the upstream and downstream homology arms of the VDAG_03393 gene; S2. constructing a homologous recombination knockout vector, wherein the vector sequentially comprises an upstream homology arm, a hygromycin resistance gene Hyg expression cassette, and a downstream homology arm; S3, introducing the homologous recombination knockout vector into wild-type Verticillium dahliae through Agrobacterium-mediated genetic transformation; S4. Screen hygromycin-resistant transformants and verify the VDAG_03393 gene knockout mutant strain by PCR.

[0025] Optionally, in step S1, the lengths of the upstream homology arm and the downstream homology arm are each independently 1-2 kb, and target the genomic sequences upstream of the start codon and downstream of the stop codon of the VDAG_03393 gene, respectively.

[0026] Optionally, in step S2, the upstream homology arm, the hygromycin resistance gene Hyg expression cassette and the downstream homology arm are connected into a linear recombinant fragment by overlap extension PCR; The primer pair sequences for amplifying the upstream homology arms are shown in SEQ ID NO.2 and SEQ ID NO.3: ACTCACTATAGGGCGAATTGGGTACCATTGCTCGTAAGGTTGTGC SEQ ID NO. 2, TCGACCTCGAGGGGGGGGCCCGGTACCGCTATGAGTTGGAGTCTGT SEQ ID NO.3; The primer pair sequences for amplifying the downstream homology arms are shown in SEQ ID NO.4 and SEQ ID NO.5: AGCCCGGGGGATCCACTAGTTCTAGAAAGGACCGCTCCGCTCTATC SEQ ID NO.4, TCCACCGCGGTGGCGGCCGCTCTAGATCCACCCTCTTGCTTTGCC SEQ ID NO.5.

[0027] Optionally, in step S4, the PCR verification includes performing PCR amplification using a primer pair spanning the knockout site, and the knockout is determined to be successful when the size of the amplified product differs from that of the wild-type Verticillium dahliae gene fragment by no less than 0.3 kb.

[0028] In another aspect, the present disclosure provides a method for extracting cytolazone from the mutant strain, the method comprising the following steps: SS1, placing the mutant strain in an activation medium for a first culture to obtain a first bacterial cell; SS2, placing the first bacterial cell in a liquid culture medium for a second culture to obtain a second bacterial cell; SS3, resuspending the second bacterial cell in sterile water, and applying the suspension to a solid culture medium for a third culture to obtain a third bacterial cell; SS4. Dry and crush the third bacterial body, extract the powder of the third bacterial body 3-4 times with ethyl acetate, and rotary evaporate and concentrate the extract.

[0029] Optionally, the activation culture medium comprises a PDA culture medium containing 180-220 g / L of potato, 18-22 g / L of glucose and 14-16 g / L of agar powder; The liquid culture medium includes a CM liquid culture medium; the CM liquid culture medium contains 5-7 g / L of yeast extract, 5-7 g / L of acid hydrolyzed casein, and 8-12 g / L of sucrose.

[0030] The solid culture medium includes a BMM solid culture medium; the BMM solid culture medium contains 4-6 g / L of glucose, 0.1-0.3 g / L of sodium nitrate, 0.50-0.54 g / L of potassium chloride, 0.50-0.54 g / L of magnesium sulfate heptahydrate, 1.50-1.54 g / L of potassium dihydrogen phosphate, 2-4 μM of vitamin B1, 0.1-0.3 mM of vitamin H, 14-16 g / L of agar powder, and a pH of 7.4-7.6.

[0031] The first culture conditions include: culturing at 24-26° C. for 3-5 days; The second culture conditions include: shaking culture at 24-26°C and 140-160 rpm for 2-3 days; The conditions of the third culture include: culturing at 24-26° C. in the dark for 10-14 days.

[0032] On the other hand, the present disclosure provides the use of cylindrosporin extracted from the mutant strain in promoting fungal melanin deposition.

[0033] Optionally, the fungus includes at least one of Verticillium dahliae, Botrytis cinerea, and Rice blast fungus.

[0034] The present disclosure is further described in detail below through examples. The raw materials used in the examples can be obtained through commercial channels.

[0035] Example 1 This example is used to illustrate the construction process of a mutant strain of Verticillium dahliae that produces cylindrosporin: 1. Preparation of experimental materials Strains and vectors: Verticillium dahliae ( Verticillium dahliae ) wild-type strain, Agrobacterium ( Agrobacterium tumefaciens ) AGL-1 strain, knockout vector pGKO2-Hyg (containing the hygromycin resistance gene Hyg); Primer design: Based on the upstream and downstream sequences of the VDAG_03393 gene (SEQ ID NO. 1:), four pairs of primers were designed: The primer pair sequences for the upstream homology arms of the amplification vector are shown in SEQ ID NO.2 and SEQ ID NO.3: ACTCACTATAGGGCGAATTGGGTACCATTGCTCGTAAGGTTGTGC SEQ ID NO.2, TCGACCTCGAGGGGGGGGCCCGGTACCGCTATGAGTTGGAGTCTGT SEQ ID NO.3; The primer pair sequences for amplifying the downstream homology arms are shown in SEQ ID NO.4 and SEQ ID NO.5: AGCCCGGGGGATCCACTAGTTCTAGAAAGGACCGCTCCGCTCTATC SEQ ID NO.4, TCCACCGCGGTGGCGGCCGCTCTAGATCCACCCTCTTGCTTTGCC SEQ ID NO.5.

[0036] 2. Preparation of homologous recombination fragments (1) Amplify upstream and downstream homology arms: Upstream homology arm: Using the genomic DNA of Verticillium dahliae as a template, a primer pair was used to amplify a fragment of approximately 1.4 kb; Downstream homology arm: Using the same template, a primer pair was used to amplify a fragment of approximately 0.9 kb; (2) Amplification of the hygromycin resistance gene: Using the pGKO2 plasmid as a template, amplify a fragment of approximately kb using the Hyg-F / Hyg-R primers; (3) Construction of knockout cassette by fusion PCR First round of fusion: The upstream fragment was fused with the hygromycin fragment at a ratio of 1:1 and amplified using primers to obtain the fusion fragment; Second round of fusion: The fusion fragment was fused with the downstream fragment at a 1:1 ratio and amplified using primers to obtain the complete knockout cassette.

[0037] 3. Knockout vector construction (1) Enzyme digestion and ligation The knockout cassette and pGKO2 vector were double-digested with EcoRI and XbaI to recover the target fragment; Use T4 DNA ligase to connect the knockout cassette and the vector, and transform the resulting vector into E. coli DH5α competent cells.

[0038] (2) Positive clone screening Spread on LB plates containing kanamycin (50 mg / mL) and incubate at 37°C for 24 h; Single clones were picked out and PCR verification was performed, and sequencing was performed to confirm the correctness of the inserted fragment.

[0039] 4. Agrobacterium-mediated genetic transformation (1) Preparation and transformation of competent Agrobacterium The recombinant vector was introduced into Agrobacterium EHA105 by electroporation, and coated on YEB plates containing rifampicin (50 mg / mL) and kanamycin (50 mg / mL), and cultured at 28°C for 48 hours.

[0040] (2) Preparation of L. biguttula spores The wild-type strain was inoculated into PDA medium, and cultured at 25°C in the dark for 7 days. Spores were eluted with sterile water, and the concentration was adjusted to 1×10 7 / mL.

[0041] (3) Co-culture and transformation Agrobacterium liquid (OD 600 =0.6) was mixed with the spore suspension in equal volume, and coated on IM plates containing AS (200 μM), and co-cultured at 25°C for 48 hours. Then, it was transferred to PDA plates containing hygromycin (50 μg / mL) and cephalosporin (200 μg / mL), and the transformants were screened at 25°C.

[0042] 5. Verification of mutants (1) PCR verification The genomic DNA of the transformants was extracted, and gene-specific primers (such as VDAG_03393-F / R) and Hyg gene primers were used to verify the insertion site.

[0043] (2) Hybridization verification The single-copy insertion was detected using a Hyg gene probe, and the correctness of the gene knockout was confirmed.

[0044] (3) Phenotype observation The mutant (ΔVDAG_03393) and the wild-type strain were inoculated into PDA medium, and cultured at 25°C for 7 days. The melanin accumulation was observed (Fig. 2). Figure 1 ).

[0045] The above experimental results show that the VDAG_03393 gene deletion mutant capable of accumulating a large amount of melanin synthesis intermediates was identified by screening.

[0046] Example 2 Extraction of dihydroxymellein from L. biguttula ΔVDAG_03393 was activated at 25°C using potato dextrose agar medium (PDA, containing 200 g of potato, 20 g of dextrose, and 15 g of agar powder per liter). The spores were collected, and the concentration was adjusted to 1×10 VDAG_03393Gene deletion strain, the bacteria cut into CM liquid medium (containing yeast extract 6 g, acid hydrolysis casein 6 g, sucrose 10 g per liter) 25℃ 150 rpm vibration culture 2-3 d, the bacteria liquid was filtered through 4 layers of filter cloth under sterile conditions, and the bacteria were collected by centrifugation at 4000 rpm for 5 min. After resuspension in sterile water, 100-200 μL was coated on BMM solid medium (containing glucose 5 g, sodium nitrate 0.2 g, potassium chloride 0.52 g, magnesium sulfate heptahydrate 0.52 g, potassium dihydrogen phosphate 1.52 g, vitamin B1 3 μM, vitamin H 0.1 mM, agar powder 15 g, pH 7.5), 25℃ dark culture for 10-14 d. The bacteria cake after culture was dried at 50℃, then extracted with ethyl acetate until no more material was precipitated, concentrated by rotary evaporation, dried, dissolved in ethyl acetate.

[0047] Thin layer chromatography (TLC) analysis: the sample was spotted on a silica gel plate (GF254 three-color separation, Qingdao Ocean) with petroleum ether-ethyl acetate-formic acid (2:1:0.001 v / v / v) as the developing solvent, and developed for 10 min. The volatile organic solvent was removed, and 5% vanillin-sulfuric acid was sprayed evenly on the silica gel plate, and the color was developed at 95℃.

[0048] Nuclear magnetic resonance spectroscopy (Bruker 500) and UPLC-MS / MS technology were used, and the operation was carried out according to the instrument instruction (mass spectrometry conditions: Capillary (kV): 2.20; Ion Source: ESI+; Cone: 12v; Source Temperature (℃): 150; Desolvation Temperature (℃): 500; Cone Gas Flow (L / Hr): 150; Desolvation Gas Flow (L / Hr): 1000. Liquid phase conditions: sample size 5 μL; flow rate 0.3 mL / min; mobile phase: A: 0.1% formic acid water; B: acetonitrile; chromatographic column: ACQUITY UPLC BEH C18 1.7 μm 2.1 ×50mm Column; elution time 5 min).

[0049] Experimental results: TLC results showed that the mutant strain accumulated columnar ketone, as shown in Figure 2 Columnar ketone secreted by L. digitata was separated and extracted, and the obtained crystal was analyzed by nuclear magnetic resonance spectroscopy-mass spectrometry, as shown in Figure 3 There was a clear response during the methanol / acetonitrile gradient elution process and the peak shape was good, the molecular weight was 195.042, which was close to that of columnar ketone (194.184), and it was inferred that the component was columnar ketone.

[0050] (3) Detection of cylindrosporin activity The extracted cylindrosporin was added into MM culture medium and inoculated with different concentrations of Δ VDAG_03393 Mutant strains.

[0051] Results: As Figure 4 As shown in the results, the addition of stylosporin promoted the melanin deposition of Verticillium dahliae strains, and the sensitivity was positively correlated with the concentration.

[0052] The preferred embodiments of the present disclosure are described in detail above. However, the present disclosure is not limited to the specific details of the above embodiments. Within the technical concept of the present disclosure, various simple modifications can be made to the technical solutions of the present disclosure, and these simple modifications all fall within the scope of protection of the present disclosure.

[0053] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. To avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0054] In addition, the various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A mutant strain of Verticillium dahliae, characterized in that The mutant strain of Verticillium dahliae is prepared by using a recombinant fragment containing the upstream and downstream coding regions of the hygromycin gene Hyg to modify the gene encoding the cylindrospermone dehydratase in the wild-type strain of Verticillium dahliae. VDAG_03393 Knockout was performed to obtain; The sclerosporine dehydratase encoding gene VDAG_03393 The nucleotide sequence is shown in SEQ ID NO.

1.

2. The method for constructing the mutant strain of Verticillium dahliae according to claim 1, characterized in that: The method comprises the following steps: S1. Determine the sequence regions targeting the upstream and downstream homology arms of the VDAG_03393 gene; S2. constructing a homologous recombination knockout vector, wherein the vector sequentially comprises an upstream homology arm, a hygromycin resistance gene Hyg expression cassette, and a downstream homology arm; S3, introducing the homologous recombination knockout vector into wild-type Verticillium dahliae through Agrobacterium-mediated genetic transformation; S4. Screen hygromycin-resistant transformants and verify the VDAG_03393 gene knockout mutant strain by PCR.

3. The method according to claim 2, wherein: In step S1, the lengths of the upstream homology arm and the downstream homology arm are each independently 1-2 kb, and target the genomic sequences upstream of the start codon and downstream of the stop codon of the VDAG_03393 gene, respectively.

4. The method according to claim 2, wherein: In step S2, the upstream homology arm, the hygromycin resistance gene Hyg expression cassette, and the downstream homology arm are connected into a linear recombinant fragment by overlap extension PCR; The primer pair sequences for amplifying the upstream homology arms are shown in SEQ ID NO.2 and SEQ ID NO.3: ACTCACTATAGGGCGAATTGGGTACCATTGCTCGTAAGGTTGTGC SEQ ID NO.2, TCGACCTCGAGGGGGGGGCCCGGTACCGCTATGAGTTGGAGTCTGT SEQ ID NO.3; The primer pair sequences for amplifying the downstream homology arms are shown in SEQ ID NO.4 and SEQ ID NO.5: AGCCCGGGGGATCCACTAGTTCTAGAAAGGACCGCTCCGCTCTATC SEQ ID NO.4, TCCACCGCGGTGGCGGCCGCTCTAGATCCACCCTCTTGCTTTGCC SEQ ID NO.

5.

5. The method according to claim 2, wherein: In step S4, the PCR verification includes performing PCR amplification using a primer pair spanning the knockout site, and the knockout is determined to be successful when the size of the amplified product differs from that of the wild-type Verticillium dahliae gene fragment by no less than 0.3 kb.

6. A method for extracting cylindrosporin from the mutant strain according to claim 1, characterized in that: The method comprises the following steps: SS1, placing the mutant strain in an activation medium for a first culture to obtain a first bacterial cell; SS2, placing the first bacterial cell in a liquid culture medium for a second culture to obtain a second bacterial cell; SS3, resuspending the second bacterial cell in sterile water, and applying the suspension to a solid culture medium for a third culture to obtain a third bacterial cell; SS4. Dry and crush the third bacterial body, extract the powder of the third bacterial body 3-4 times with ethyl acetate, and rotary evaporate and concentrate the extract.

7. The method according to claim 6, wherein: The activation culture medium comprises a potato dextrose agar culture medium; the potato dextrose agar culture medium contains 180-220 g / L of potato, 18-22 g / L of glucose and 14-16 g / L of agar powder; The liquid culture medium includes a CM liquid culture medium; the CM liquid culture medium contains 5-7 g / L yeast extract, 5-7 g / L acid hydrolyzed casein, and 8-12 g / L sucrose; The solid culture medium includes a BMM solid culture medium; the BMM solid culture medium contains 4-6 g / L of glucose, 0.1-0.3 g / L of sodium nitrate, 0.50-0.54 g / L of potassium chloride, 0.50-0.54 g / L of magnesium sulfate heptahydrate, 1.50-1.54 g / L of potassium dihydrogen phosphate, 2-4 μM of vitamin B1, 0.1-0.3 mM of vitamin H, 14-16 g / L of agar powder, and a pH of 7.4-7.

6.

8. The method according to claim 6, wherein: The first culture conditions include: culturing at 24-26° C. for 3-5 days; The second culture conditions include: shaking culture at 24-26°C and 140-160 rpm for 2-3 days; The conditions of the third culture include: culturing at 24-26° C. in the dark for 10-14 days.

9. Use of cylindrosporin extracted from the mutant strain of claim 1 in promoting fungal melanin deposition.

10. The use according to claim 9, wherein: The fungus includes at least one of Verticillium dahliae, Botrytis cinerea, and Rice blast fungus.