Site-specific mutagenesis vector and use method thereof
By constructing a site-directed mutagenesis vector and the Golden Gate method, combined with a secretory expression vector and the protease-deficient host bacteria SMD1168, the expression stability and efficiency problems of Escherichia coli and yeast expression systems were solved, achieving efficient expression of antimicrobial peptides and simplifying the construction process.
Patent Information
- Application Number
- CN202410389482.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-02
- Publication Date
- 2025-10-14
AI Technical Summary
The E. coli expression system has poor stability and weak activity when expressing antimicrobial peptides, and is prone to causing suicide in the host; although the yeast expression system has advantages, the expression level is low and the antimicrobial peptides are easily degraded by secreted proteases, making it impossible to achieve efficient expression.
By constructing a site-directed mutagenesis vector and using the Golden gate method to directly assemble multiple copies into the system, combined with a secretory expression vector and the protease-deficient host bacteria SMD1168, the expression efficiency of the antimicrobial peptide was improved and the copy number was increased at the DNA level.
The efficient expression of antimicrobial peptides was achieved, the expression level was increased and degradation by proteases in the host bacteria was avoided, the construction process was simplified and the success rate was improved.
Smart Images
Figure CN120775894A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of genetic engineering in the biotechnology and pharmaceutical industry, and in particular to a site-directed mutagenesis vector and a method for using the same. Background Art
[0002] Using E. coli to express antimicrobial peptides is a well-established and commonly used expression method, and has achieved widespread market adoption. For example, the composite antimicrobial peptide AL32-P113 and the recombinant antimicrobial peptide UBI 18-35 were expressed in E. coli at expression levels of 12.1 mg / L and 6 mg / L, respectively. The antimicrobial peptide Fowlicidin-3 can also be expressed in E. coli as a fusion: Trx-Fowlicidin-3a expressed at 0.84 mg / mL, and Trx-Fowlicidin-3b expressed at 0.71 mg / mL. The antimicrobial peptide SMAP-29 can also be expressed in E. coli. After optimizing expression conditions, the expression rate of SMAP-29 reached 11.35% of the total protein.
[0003] However, in actual applications, it has been found that the E. coli expression system lacks the late-stage translation and protein modification capabilities of eukaryotic organisms, resulting in poor stability and activity of the antimicrobial peptides it expresses. Furthermore, the E. coli expression system is prone to producing endotoxins during the expression process, which can cause the antimicrobial peptides to "commit suicide" in the host during the later stages of expression, effectively killing the host bacteria.
[0004] Yeast, as a eukaryotic organism, boasts the advantages of rapid single-cell growth and ease of genetic manipulation. Yeast expression systems also offer superior capabilities for accurate protein processing and post-translational modification compared to Escherichia coli. These inherent advantages have led to a growing body of research and application in yeast expression systems. To date, a variety of antimicrobial peptides have been successfully expressed in yeast.
[0005] However, when using Pichia pastoris to express exogenous antimicrobial peptides, the lack of a stable episomal plasmid necessitates integrating the target fragment into the yeast genome for expression. This low expression yield is a disadvantage of the yeast expression system. Furthermore, Pichia pastoris secretes proteases that degrade the expressed antimicrobial peptides. Summary of the Invention
[0006] The purpose of the present application is to provide a site-directed mutagenesis vector and a method for constructing the same. The method constructs a multi-copy vector using the Golden Gate method, assembling multiple copies directly into the system in one step, saving time and omitting the tedious steps of multiple enzyme digestion and ligation.
[0007] The present application provides a site-directed mutagenesis vector, which contains BbsI restriction sites at other locations except the multiple cloning region. The site-directed mutagenesis is to mutate the base of the BbsI restriction site, remove the BbsI site, and keep the amino acid unchanged.
[0008] In the present application, the base of the BbsI restriction site of the vector is mutated, so that the vector that cannot be applied to the multi-copy method can be applied to the multi-copy vector.
[0009] A further preferred technical solution is: the site-directed mutagenesis vector is obtained by mutating a vector containing a BbsI restriction site at other positions except the multiple cloning region, and the C in the BbsI restriction site of the vector except the multiple cloning region is mutated to T, while keeping the amino acid unchanged.
[0010] A further preferred technical solution is that the site-directed mutagenesis vector is obtained by site-directed mutagenesis of any one of pAO815, pPIC9K or pPICZα.
[0011] A further preferred technical solution is: the site-directed mutagenesis vector is obtained by site-directed mutagenesis of pAO815, and the site-directed mutagenesis vector is pAO815-3, and the sequence is shown in SEQ.ID.NO.2.
[0012] A further preferred technical solution is as follows: the mutation sites of pAO815-3 are selected from positions 2784 and 7590 of the POA815 sequence, C is mutated to T, and a BbsI site is added at position 942.
[0013] A further preferred technical solution is: a recombinant bacterium comprising the site-directed mutagenesis vector described in claim 4.
[0014] Its further preferred technical solution is: including:
[0015] Designing a target fragment, cloning the target fragment into a Pichia pastoris vector pPIC series or pGAP series to obtain a recombinant plasmid, and amplifying the recombinant plasmid to obtain an amplified product;
[0016] Mixing the amplified product with the site-directed mutagenesis vector and performing a golden gate reaction to obtain a reaction product;
[0017] The reaction product is transformed into Escherichia coli, and after identification, plasmid extraction is performed, and the plasmid is linearized. The linearized plasmid is transferred into Pichia pastoris competent cells, cultured, and screened to obtain engineered bacteria.
[0018] A further preferred technical solution is: the culture medium is YPD culture medium.
[0019] A further preferred technical solution is that the target fragment is any one of antimicrobial peptide and human collagen.
[0020] A further preferred technical solution is that the target fragment is the LL-37 nucleotide sequence after synthetic design and optimization, as shown in SEQ.ID.NO.1.
[0021] Currently, the construction of in vitro multi-copy vectors uses the same tail enzyme method, which requires only one enzyme digestion and ligation to add one copy. This process is cumbersome and has a low success rate. The site-directed mutagenesis vector and its construction method provided in this application reconstruct vectors that are not suitable for multi-copy methods to obtain multi-copy vectors. Using the Golden Gate method, multiple copies can be directly assembled into the system in a single step, saving time and eliminating the tedious steps of multiple enzyme digestion and ligation. This invention effectively improves the expression rate of antimicrobial peptide proteins by establishing a method for constructing and expressing recombinant antimicrobial peptides.
[0022] The host bacteria itself secretes proteases that can degrade antimicrobial peptides, affecting their expression. The present invention uses secretory expression vectors to prevent the expressed antimicrobial peptides from being degraded by proteases within the host bacteria. Furthermore, the present invention utilizes the protease-deficient host strain SMD1168 to enhance expression. The present invention utilizes codons preferred by Pichia pastoris to improve the expression efficiency of antimicrobial peptides to a certain extent. Pichia pastoris lacks stable episomal plasmids, and when expressing antimicrobial peptide genes, the expression vectors used are almost always capable of integrating into the yeast genome. The present invention constructs multicopy vectors in vitro to increase the copy number of the antimicrobial peptides. Furthermore, the present invention utilizes a tandem technology to cascade antimicrobial peptide genes, thereby enhancing their expression at the DNA level. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.
[0024] Figure 1 This is the result diagram of the recombinant PCR identification test provided in this application.
[0025] Figure 2 This is the transformant after pAO815-4*LL-37 provided in this application was transferred into SMD1168.
[0026] Figure 3 This is a diagram showing the electrophoresis detection results of the fermentation broth in Example 1 of the present application.
[0027] Figure 4 This is a diagram showing the antibacterial effect of LL-37 in Experimental Example 1 of this application. DETAILED DESCRIPTION
[0028] The present application provides a method for constructing a site-directed mutagenesis vector, the method comprising:
[0029] S1: Synthesize LL-37 nucleotide sequence
[0030] The antimicrobial peptide LL-37 was sequence-optimized based on the host bacteria Pichia pastoris to avoid the BbsI restriction site. It was then tandemly linked twice, with a His tag fused to the N-terminus. The His tag is labeled: HHHHHH, separated by GGS. The synthesized nucleotide sequence is shown in SEQ.ID.NO.1.
[0031] SEQ.ID.NO.1 was cloned into the pPIC9K vector and the product was named pPIC9K-LL-37.
[0032] S2: Construction of multiple copies of target gene
[0033] Using pPIC9K-LL-37 as a template, 2-F and I were used to amplify the 2-1 fragment, the sequence of which is shown in SEQ.ID.NO.3. J and 2-R were used to amplify the 2-2 fragment, the sequence of which is shown in SEQ.ID.NO.4. 2-1 and 2-2 were then subjected to fusion PCR (overloop) to generate fragment 2, the sequence of which is shown in SEQ.ID.NO.
[0034] Using fragment 2 as a template, primers 1-F and 1-R were used to amplify to generate fragment 1, and the sequence of fragment 1 is shown in SEQ.ID.NO.2. Primers 3-F and 3-R were used to amplify to generate fragment 3, and the sequence of fragment 3 is shown in SEQ.ID.NO.7. Primers 4-F and 4-R were used to amplify to generate fragment 4, and the sequence of fragment 4 is shown in SEQ.ID.NO.8.
[0035] Amplification primers are as follows:
[0036] Primer name Primer sequences I GAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTC J GACATCCTCTTGATTAGAATCTAGCAAGACCGGTCTTC 1-F GAAGACGAgaatATGAGATTTCCTTCAATTT 1-R GAAGACGATCTCACTTAATCTCTGTACTCTGAAG 2-F GAAGACGAgagaTCTAACATCCAAAGACGAAAGG 2-R GAAGACGAaactTCTCACTTAATCTCTGTACTCTGAAG 3-F GAAGACGAagttTCTAACATCCAAAGACGAAAGG 3-R GAAGACGAcatgTCTCACTTAATCTCTGTACTCTGAAG 4-F GAAGACGAcatgTCTAACATCCAAAGACGAAAGG 4-R GAAGACGcagac TCAACTTTCTTGTCCGGGGCACT
[0037] Combine fragments 1-4 with the pAO815-3 vector to create a Golden gate:
[0038] The pAO815-3 vector and fragments 1, 2, 3, and 4 were used as Golden gates. The system was as follows:
[0039] Reagent name Volume (µl) 10×T4 buffer 2 Clip 1 2 (~50ng) Clip 2 2 (~50ng) Clip 3 2 (~50ng) Clip 4 2 (~50ng) Skeleton carrier 1 (100ng) BbsI 1 T4 ligase 1 ddH2O 7
[0040] The PCR program was: (37°C, 5 min, 16°C, 10 min) × 80 cycles, 37°C, 10 min, 65°C, 10 min.
[0041] Thus, four copies of the target gene were inserted into pAO815-3, the sequence of which is shown in SEQ.ID.NO.2, to construct the pAO815-4*LL-37 plasmid.
[0042] The product pAO815-4*LL-37 plasmid was transformed into DH5a competent cells, and the recombinants were selected for PCR identification experiments. The results were as follows: Figure 1 shown.
[0043] S3: Transformation of Pichia pastoris SMD1168
[0044] The pAO815-4*LL-37 plasmid was extracted using a plasmid extraction kit (omage: D6943);
[0045] Plasmid linearization
[0046] The expression plasmid was digested with SalI using the following enzyme digestion system:
[0047] Reagent name Volume (µL) 10×FD buffer 10 Recombinant plasmid 40µg SalI 8 <![CDATA[ddH2O]]> Final volume to 100
[0048] Incubate the enzyme digestion reaction at 37°C for 2 h. Remove 5 μL of the aliquot and perform electrophoresis on a 1.0% agarose gel. Use a DNA purification kit (Omage: D2500) to recover the linearized plasmid.
[0049] Add 20 μL (~10 μg) of linearized plasmid to 100 μL of SMD1168 competent medium, mix the plasmid and competent medium evenly, and place on ice for 5 minutes.
[0050] Select the preset program of the electroporator, Fungi - Pichia pastoris - 2mm electroporation cuvette.
[0051] Add the mixture (plasmid and competent cell) into a pre-cooled electroporation cuvette and immediately perform electroporation (Fungi - Pichia pastoris - 2 mm electroporation cuvette).
[0052] Immediately after electroporation, place the cells on ice and add 1 mL of pre-chilled 1 M sorbitol. Place the cells in a 28°C incubator (Shanghai Zhichu Instrument Co., Ltd., Model ZQZY) for 1.5 h to recover.
[0053] Centrifuge the cells at 1000 rpm for 5 min, keep 200 μL of supernatant to resuspend the cells, spread on MD solid medium, invert the plate and culture at 28 ° C for 48 h. Figure 2 shown.
[0054] S4: Screening and expression testing of engineered bacteria
[0055] Single clones were selected and cultured separately.
[0056] a) Pick the monoclonal bacteria obtained in the above step and culture them in 5 mL of fresh YPD medium at 28°C and 250 rpm for 24 hours to activate the SMD1168 yeast.
[0057] b) After culturing the bacterial solution of the monoclonal culture in a) for 24 h, 250 μL of the bacterial solution was transferred to 25 ml of BMGY medium and cultured at 28° C. and 250 rpm in a shaking incubator for 36 h.
[0058] c) Collect all bacterial suspension into a 50 mL centrifuge tube and centrifuge at 5000 rpm for 5 min. Discard the remaining supernatant and resuspend the cells in 50 mL of BMMY liquid. Incubate at 28°C and 250 rpm.
[0059] d) Induction: 100% methanol was added to the above culture medium every 24 hours to ensure a final concentration of 1%, and the culture was continued for 72 hours.
[0060] e) Sampling: Collect 1 mL of supernatant sample at 24 h, 48 h, and 72 h.
[0061] S5: SDS-PAGE electrophoresis detection
[0062] The collected bacterial suspension was transferred to clean centrifuge tubes, centrifuged, collected bacteria, weighed, and resuspended in PBS of equal volume. The bacteria were broken by ultrasound (130W, 2min, working 3s, stopping 3s), centrifuged at 12000rpm for 1min, and the supernatant was collected. The expression of the target protein was evaluated by SDS-PAGE. The theoretical molecular weight of the target protein was 5.5kDa. The results were as follows: Figure 3 shown.
[0063] Experimental Example 1
[0064] LL-37 antibacterial experiment
[0065] Remove frozen glycerol stock of E. coli DH5α from the -80°C freezer and inoculate 100 μl into 10 ml of LB liquid medium. Incubate at 37°C, 180 rpm, and incubate overnight. Measure the OD600 of the suspension using a spectrophotometer. Gently spread 300 μL of the diluted suspension onto an LB plate using a sterile spreader.
[0066] Sample preparation: Dissolve 10 mg of LL-37 in 1 ml of sterile saline, mix thoroughly, and then serially dilute by 2-fold to achieve final sample concentrations of 5, 2.5, 1.25, 0.625, and 0.312 mg / mL, respectively, for later use.
[0067] Soak the prepared antimicrobial peptide samples in paper and stick them on LB plates. Incubate them at 37°C overnight and observe the size of the inhibition zone. The antibacterial effect of 5 mg / mL LL-37 is as follows: Figure 4 This example verifies the activity of the antimicrobial peptide prepared by the method provided by the present invention.
[0068] Currently, the construction of in vitro multi-copy vectors uses a tailing enzyme method. This method requires only one enzyme digestion and ligation to add one copy, a cumbersome process with a low success rate. However, the present invention constructs multi-copy vectors by mutating vector sites, reconstructing vectors that are inherently incompatible with the Golden Gate method so that they can be used with the Golden Gate method. This simplifies the process that typically requires multiple copies into a single step of direct assembly of multiple copies onto the system, saving time and eliminating the tedious steps of multiple enzyme digestions and ligations. The present invention creates a site-directed mutagenesis vector that can express high levels of antimicrobial peptide proteins.
[0069] The host bacteria itself secretes proteases that can degrade antimicrobial peptides, affecting their production. The present invention utilizes secretory expression vectors to prevent degradation of the expressed antimicrobial peptides by proteases within the host bacteria. Furthermore, the present invention utilizes the protease-deficient host strain SMD1168 to enhance expression. The present invention utilizes codons preferred by Pichia pastoris to improve the expression efficiency of antimicrobial peptides to a certain extent. Pichia pastoris lacks stable episomal plasmids, and when expressing antimicrobial peptide genes, the expression vectors used are almost always capable of integrating into the yeast genome. The present invention constructs multicopy vectors in vitro to increase the copy number of the antimicrobial peptides, thereby enhancing their expression at the DNA level.
[0070] In the present application, "LL-37" refers to the amino acid sequence of the antimicrobial peptide LL-37 (NP_004336.4) published in NCBI.
[0071] The embodiments described above are part of the embodiments of the present application, rather than all of the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the present application for protection, but merely represents selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.
Claims
1. A site-directed mutagenesis vector, characterized in that: The vector contains BbsI restriction sites at other positions except the multiple cloning region. The site-directed mutagenesis is to mutate the base of the BbsI restriction site to remove the BbsI site while keeping the amino acid unchanged.
2. A site-directed mutagenesis vector according to claim 1, characterized in that The site-directed mutagenesis vector is obtained by mutating a vector containing BbsI restriction sites at other locations except the multiple cloning region, wherein the C in the BbsI restriction sites of the vector except the multiple cloning region is mutated to T while keeping the amino acid unchanged.
3. The site-directed mutagenesis vector according to claim 2, characterized in that The site-directed mutagenesis vector is obtained by site-directed mutagenesis of any one of pAO815, pPIC9K or pPICZα.
4. The site-directed mutagenesis vector according to claim 3, characterized in that The site-directed mutagenesis vector is obtained by site-directed mutagenesis of pAO815. The site-directed mutagenesis vector is pAO815-3, and the sequence is shown in SEQ.ID.NO.
2.
5. The site-directed mutagenesis vector according to claim 4, characterized in that The mutation sites of pAO815-3 were selected from positions 2784 and 7590 of the POA815 sequence, C was mutated to T, and a BbsI site was added at position 942.
6. A recombinant bacterium, characterized in that It comprises the site-directed mutagenesis vector described in claim 4.
7. The method for using the site-directed mutagenesis vector according to any one of claims 1 to 5, characterized in that: include: Designing a target fragment, cloning the target fragment into a Pichia pastoris vector pPIC series or pGAP series to obtain a recombinant plasmid, and amplifying the recombinant plasmid to obtain an amplified product; Mixing the amplified product with the site-directed mutagenesis vector, performing a golden gate reaction, and obtaining a reaction product; The reaction product is transformed into Escherichia coli, and after identification, plasmid extraction is performed, and the plasmid is linearized. The linearized plasmid is transferred into Pichia pastoris competent cells, cultured, and screened to obtain engineered bacteria.
8. The method for using the site-directed mutagenesis vector according to claim 7, characterized in that: In the culture, the culture medium is YPD culture medium.
9. The method for using the site-directed mutagenesis vector according to claim 8, characterized in that: The target fragment is any one of antimicrobial peptide and human collagen.
10. The method for using the site-directed mutagenesis vector according to claim 9, characterized in that: The target fragment is the LL-37 nucleotide sequence after synthetic design and optimization, as shown in SEQ.ID.NO.1.