Wheat grain weight related gene TaAPC11 and application of molecular marker thereof

Abstract

The invention belongs to the technical field of plant bioengineering, and particularly relates to a wheat grain weight related gene TaAPC11 and application of a KASP molecular marker of the wheat grain weight related gene TaAPC11. The KASP molecular marker is KASP-TaAPC11, and the marker detects an SNP (Single Nucleotide Polymorphism) site (C / A) at 364138181bp according to a 2B chromosome, namely, at the 845bp position of a 3'non-coding region of an E3 ubiquitin ligase gene TaAPC11. Association analysis finds that the genotype C / C is excellent allele variation for improving grain traits, and the grain weight and grain shape of TaAPC11 transgenic rice are increased. The functional KASP molecular marker of the wheat E3 ubiquitin ligase gene TaAPC11 provided by the invention can be used for identifying whether TaAPC11 excellent alleles exist in wheat varieties / strains or not, and can be applied to assisted selective breeding and pyramiding breeding with other known grain weight related genes.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant bioengineering, and specifically relates to the development of molecular markers for the wheat grain weight-related gene TaAPC11 and its transgenic application. Background Art

[0002] Wheat (Triticum aestivum L.) is one of the world's three major staple crops, second only to maize (Zea mays L.) and rice (Oryza sativa L.) in terms of cultivated area and yield. It plays an irreplaceable role in ensuring global food security and agricultural economic stability. Wheat yield is a complex quantitative trait primarily determined by thousand-kernel weight (TKW), spike number per unit area (SN), and kernel number per spike (KNPS). Grain weight, with its high heritability and stability, has become a primary target of wheat genetic breeding.

[0003] Compared with traditional selection methods, marker-assisted selection (MAS), as an innovative strategy in wheat breeding, has significantly improved breeding efficiency by integrating modern genomics technology. The core advantages of this technology are: (1) genotyping based on molecular markers can avoid interference from environmental factors and achieve early and precise selection; (2) tracking target alleles through co-segregating markers can shorten the backcross breeding cycle; (3) high-throughput detection systems can significantly reduce the unit trait screening cost. The core goal of MAS is to develop molecular markers that are closely linked to target traits, suitable for high-throughput screening and easy to verify, especially for the fine mapping of quantitative trait loci (QTLs). With the development of biotechnology breeding, the MAS marker system has achieved a technological iteration from restriction fragment length polymorphism (RFLP) to single nucleotide polymorphism (SNP) markers. Statistics from the International Wheat Genome Sequencing Consortium (IWGSC) show that the usage rate of KASP markers has reached 78.3% in wheat MAS research published in the past five years, significantly promoting the targeted improvement of complex traits such as disease resistance and quality.

[0004] SNP-based KASP (competitive allele-specific PCR) markers have become a mainstream method in crop molecular breeding due to their flexible primer design, high detection throughput, and typing accuracy. In recent years, Song Xiaopeng et al. (2023) used a whole-genome detection system containing 50 KASP markers to genotype a population of 107 core wheat parents. They systematically analyzed the distribution patterns of allelic variation in key genes such as plant height regulation (Rht-B1 / Rht-D1), yield component (TaGW2 / TaSus2), spike sprouting resistance (VP1 / Vp1B), and stripe rust resistance (Yr15 / Yr26). This provides a molecular biological basis for molecular marker-assisted parent combination optimization and multi-trait synergistic improvement. To identify winter wheat protein quality-related traits and screen for molecular markers that effectively improve protein quality, Tian Yousheng et al. (2025) conducted genotyping tests on 341 wheat germplasm resources at SNP loci, including 1D-412160361, 1D-413224542, and 1D-413729079. They successfully developed 11 KASP markers for improving protein quality, which were highly significantly correlated with the gluten index and Zeleny sedimentation value. This suggests that these 11 KASP markers can be used for genotyping and molecular marker-assisted breeding to improve wheat protein quality. Therefore, grain weight, a key agronomic trait affecting wheat yield, has a key role. The development of molecular markers related to grain weight not only provides a theoretical basis for analyzing the genetic regulatory network of grain development but also lays a resource foundation for optimizing molecular marker-assisted selection systems by creating allelic variants with pleiotropic regulatory functions, thereby achieving genetic gain in grain weight and exploring yield potential. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the present invention provides the development of molecular markers for the wheat grain weight-related gene TaAPC11 (TraesCS2B02G268800) and its transgenic application. To achieve the above objectives, the present invention adopts the following technical solutions:

[0006] 1. A single nucleotide polymorphism (SNP) site associated with wheat grain weight, the SNP site is located at 845 bp in the 3' non-coding region of the wheat gene TaAPC11, the polymorphism is C or A, the SNP site and upstream and downstream sequences are shown in the sequence listing SEQ No. 1 and SEQ No. 2.

[0007] Preferably, the wheat variety with CC genotype at 845 bp of the 3' non-coding region of gene TaAPC11 has higher TKW, KL (kernel Length, KL) and KW (kernel width, KW) than the wheat variety with AA genotype.

[0008] 2. A molecular marker of wheat grain weight-related gene TaAPC11, the nucleotide sequence of which is shown in the sequence listing SEQ No. 1 and SEQ No. 2.

[0009] 3. A method for developing a molecular marker TaAPC11-KASP for the wheat grain weight-related gene TaAPC11, comprising the following steps:

[0010] (1) Extracting wheat DNA: Extracting wheat genomic DNA to be tested, performing PCR amplification using specific amplification primers to obtain PCR amplification products;

[0011] (2) SNP detection: The genotype is determined by detecting the fluorescent signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule as shown in the sequence list SEQ ID NO.1, the genotype of the wheat SNP marker to be tested is CC; if the PCR amplification product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule as shown in the sequence list SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is AA.

[0012] (3) Data analysis: TASSEL5.1 software was used to perform association analysis on the phenotypic data, and SPSS22.0 software was used to perform one-way analysis of variance to analyze the significance of the differences in phenotypic values ​​between the two genotypes.

[0013] Preferably, the specific amplification primers include primer KASP-TaAPC11-F1, primer KASP-TaAPC11-F2 and common primer KASP-TaAPC11-R; the nucleotide sequences of the primers are as follows:

[0014] KASP-TaAPC11-F1:GAAGGTCGGAGTCAACGGATTCCTTGCGTCATCGTATCCTTA;

[0015] KASP-TaAPC11-F2: GAAGGTGACCAAGTTCATGCTCCTTGCGTCATCGTATCCTTC;

[0016] KASP-TaAPC11-R:GAAGCACATGCCAGCCG.

[0017] 4. Application of molecular markers for the wheat grain weight-related gene TaAPC11 in assisted breeding, including:

[0018] The genotype at 845 bp of the 3' non-coding region of the gene TaAPC11 in the wheat genome to be tested is detected. If the genotype is CC, it is high TKW, KL and KW wheat; if the genotype is AA, it is low TKW, KL and KW wheat.

[0019] Preferably, the method for detecting the genotype at 845 bp of the 3' non-coding region of the gene TaAPC11 in the wheat genome to be tested comprises the following steps:

[0020] (1) Direct sequencing;

[0021] (2) The KASP-TaAPC11 primers are used to amplify the wheat genomic DNA to be tested, and the amplified products are subjected to genotyping detection.

[0022] 5. Application of wheat gene TaAPC11 to improve TKW, KL and KW of rice. The CDS of the TaAPC11 gene is shown in SEQ No. 3 in the sequence listing.

[0023] Compared with existing technologies, the present invention has the following advantages: The present invention provides a molecular marker for the wheat grain weight-related gene TaAPC11. This molecular marker, a KASP molecular marker developed targeting a single nucleotide polymorphism (SNP) site in the promoter region of the E3 ubiquitin ligase gene TaAPC11, was used to genotype and phenotype association analysis 333 wheat germplasm resources from different ecological regions in my country. The results showed that the KASP-TaAPC11 marker can classify different wheat varieties into two genotypes: haplotype TaAPC11-HapⅠ and haplotype TaAPC11-HapⅡ. The genotype of haplotype TaAPC11-HapⅠ is C / C, while the genotype of haplotype TaAPC11-HapⅡ is A / A. Combined with phenotypic data, association analysis of materials with different genotypes revealed that wheat materials carrying the C / C genotype had significantly higher TKW than materials carrying the A / A genotype under eight environmental conditions (P < 0.05); wheat materials carrying the C / C genotype had significantly higher KW than materials carrying the A / A genotype under six environmental conditions (P < 0.05); and wheat materials carrying the C / C genotype had significantly higher KL than materials carrying the A / A genotype under four environmental conditions (P < 0.05). This indicates that the C / C genotype is a superior allele variant that improves grain traits and has a positive effect on wheat TKW, KW, and KL. During the breeding process, the aggregation of favorable mutant alleles is consistent with the result of increased yield in crop breeding. Therefore, the KASP-TaAPC11 molecular marker provided by this patent can efficiently detect and track the TaAPC11 gene in wheat varieties / lines, providing technical support for improving wheat yield traits and wheat molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1The qRT-PCR analysis of the expression pattern of TaAPC11 in different organs of the present invention; wherein Figure 1 A is the expression profile of TaAPC11 during the wheat developmental cycle. Figure 1 B shows the expression profile of TaAPC11 in developing wheat grains. TaACTIN (TraesCS1A01G020500.1) was used as the reference gene. Data are expressed as mean ± SD (n = 3). a and b indicate significant differences (P < 0.05).

[0025] Figure 2 The test results of the two haplotype wheat materials in the present invention are as follows; Figure 2 A indicates that the promoter regions of the two haplotypes of the TaAPC11 gene both contain SNP sites. Figure 2 B shows the genotype identification results of wheat germplasm resources from different wheat regions in my country using the KASP marker primer set, where the scattered dots in the upper left box represent the HEX allele A, and the scattered dots in the lower right box represent the FAM allele C.

[0026] Figure 3 This is the correlation between TaAPC11-HapⅠ and TaAPC11-HapⅡ and TKW, KW and KL in 333 wheat materials under five environmental conditions in the present invention. Figure 3 A is the association of TaAPC11-HapⅠ and TaAPC11-HapⅡ with TKW; Figure 3 B is the association between TaAPC11-HapⅠ and TaAPC11-HapⅡ and KW; Figure 3 C represents the association between TaAPC11-HapⅠ and TaAPC11-HapⅡ and KL. * indicates P < 0.05; ** indicates P < 0.01. E1-E3: Tongwei, Gansu (35°11′N, 105°19′E, 1750 m above sea level), 2020, 2021, and 2022; E4: Zhuanglang, Gansu (35°21′N, 105°58′E, 2110 m above sea level), 2022; E5: Tianshui, Gansu (34°34′N, 105°53′E, 1550 m above sea level), 2023; E6: Zhuanglang, Gansu (2023); E7: Tianshui, Gansu (2024); and E8: Zhuanglang, Gansu (2024).

[0027] Figure 4 is the spatiotemporal distribution of the TaAPC11 haplotype in the present invention; Figure 4 A is the geographical distribution of TaAPC11 haplotype varieties in my country. Figure 4 B is the frequency of TaAPC11 allele variation in wheat breeding programs in China over different decades.

[0028] Figure 5Phenotypic images and statistical analysis of TaAPC11 transgenic rice in the present invention; Figure 5 A and B show the grain morphology of wild-type ZH11 and three TaAPC11-OE lines in rice, respectively. Scale bar = 5 mm. Figure 5 C, 5D, and 5E show the TKW, KL, and KW of wild-type ZH11 and three TaAPC11-OE lines in rice, respectively (n = 200). Statistics were performed after three biological replicates. Error bars represent standard deviations. * indicates p < 0.05, ** indicates p < 0.01.

[0029] Figure 6 It is the molecular marker site of TaAPC11 in the present invention, wherein the SNP site is in brackets.

[0030] Figure 7 The coding region sequence of the wheat gene TaAPC11 in the present invention is shown in FIG. 1 , wherein the underlined sequences are the start and stop codons. DETAILED DESCRIPTION

[0031] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0032] Example 1

[0033] This example provides a method for verifying the expression level of the wheat grain weight and grain shape-related gene TaAPC11 and obtaining a molecular marker, specifically including:

[0034] 1. qRT-PCR Analysis of TaAPC11 Gene

[0035] The samples were collected from roots, stems, leaves, ears at the heading stage, grains at 5, 10, 15, 20, 25, and 30 days after anthesis, palea, seed coat at 5 and 15 days after anthesis, and embryo and endosperm at 15 days. Total RNA was extracted from the collected samples using a plant tissue RNA rapid extraction kit, and RNA concentration was determined using an ultramicrophotometer. First-strand cDNA was synthesized using the FastKing gDNA isolation method (Beijing). qRT-PCR analysis was performed using FastReal qPCR PreMix (SYBR Green) to determine the relative expression of the TaAPC11 gene in different tissues. Wheat tissue development expression analysis was performed using wheat TaACTIN (TraesCS1A01G020500.1) as an internal reference gene (see L. Guo et al., 2022).

[0036] The PCR reaction volume was 20 μl, consisting of 10 μl FastReal qPCR PreMix (SYBR Green), 0.6 μl each of the forward and reverse primers, 2 μl of cDNA, and 6.8 μl of ddH2O. PCR conditions were 95°C for 2 min, 95°C for 5 s, 58°C for 10 s, and 72°C for 15 s (with fluorescence collected), for 39 cycles.

[0037] The primers used for qRT-PCR are shown in Table 1. -ΔΔC(t) Methods The relative expression level of the TaAPC11 gene was calculated (see Schmittgen & Livak, 2008). All data were obtained from three biological replicates.

[0038] Table 1 qRT-PCR primer information

[0039] Gene name Forward primer F (5'-3') Reverse primer R (5'-3') TaAPC11 TGGCTTCTTGGACATGGGAC ATTGGGCACTCATCACCAGG TaACTIN AAATCTGGCATCACACTTTCTAC GTCTCAAACATAATCTGGGTCATC

[0040] The expression levels of TaAPC11 in wheat roots, stems, leaves, ears at the booting stage, grains at 5, 10, 15, 20, 25, and 30 days after anthesis, palea, seed coat at 5 and 15 days after anthesis, and embryo and endosperm at 15 days after anthesis were determined by qRT-PCR. Figure 1 qRT-PCR results showed that the TaAPC11 gene was ubiquitously expressed in wheat roots, stems, leaves, and ear formation, and specifically expressed in the ovary and 20-, 25-, and 30-day-old kernels, at 2.79, 3.86, 2.94, and 4.09-fold higher levels than in the root, respectively. Further analysis of the TaAPC11 gene's expression in developing kernels revealed that the gene was highly expressed in the ovary, 3.98-fold higher than in the seed coat.

[0041] 2. Method for obtaining molecular markers for the wheat grain weight and grain shape-related gene TaAPC11

[0042] The wheat grain weight-related gene TaAPC11 provided by the present invention contains a conserved catalytic core ubiquitin ligase domain (RING), which contains an arginine active site that interacts with the E2 ubiquitin conjugating enzyme. Sequence polymorphism analysis of TaAPC11 was performed based on 687 wheat resequencing data from the Wheat Genome Variation Union Database (http: / / wheat.cau.edu.cn / WheatUnion / ) to identify SNP sites on the TaAPC11 mRNA and its promoter. A total of 19 SNP sites were detected in the coding region and promoter region of the TaAPC11 gene. A KASP marker was developed for the SNP at 845 bp at the 3' end of the gene, and genotyping was performed on a natural population consisting of 333 wheat varieties / lines, which were divided into two different haplotypes, namely TaAPC11-HapⅠ and TaAPC11-HapⅡ.

[0043] The wheat grain weight-related SNP site provided by the present invention is located at 845 bp at the 3' end of TaAPC11. The SNP (C / A) at 845 bp at the 3' end of TaAPC11 is converted into a homologous allele-specific PCR (KASP) molecular marker and named TaAPC11-KASP. The nucleotide sequence of TaAPC11-KASP is as follows: Figure 7 As shown, the degenerate base at 203 bp of the sequence is C or A.

[0044] Amplification primers were designed for the above-mentioned KASP molecular markers, including two forward primers and one reverse primer (Table 2), which were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0045] Table 2 KASP marker development primer information

[0046] Primer name Primer sequence (5'-3') KASP-TaAPC11-F GAAGGTCGGAGTCAACGGATTCCTTGCGTCATCGTATCCTTA KASP-TaAPC11-F GAAGGTGACCAAGTTCATGCTCCTTGCGTCATCGTATCCTTC KASP-TaAPC11-R GAAGCACATGCCAGCCG

[0047] Example 2

[0048] This example provides the application of TaAPC11-KASP molecular marker in identifying wheat genotypes

[0049] 1. Collect wheat leaves at the three-leaf stage and extract wheat genomic DNA using the CTAB method. DNA concentration and quality are determined using a NanoDrop 2000 and 1% agarose gel electrophoresis. An A260 / A280 ratio of approximately 1.8 indicates acceptable sample quality.

[0050] 2. KASP marker amplification and detection

[0051] A two-step PCR reaction system was used: DNA denaturation at a higher temperature, followed by annealing and extension at the same lower temperature. The 4 μl PCR reaction system contained 2 μl of KASP Master Mix (2×), 1 μl of SNP Primer Mix (primer mix 4×), 1 μl of DNA, and ddH20 to 4 μl.

[0052] The PCR amplification system was as follows: (1) 94°C, 15 min; (2) 94°C, 20 s; 61-55°C, decreasing by 0.6°C per cycle; 10 cycles in total; (3) 94°C, 20 s; 55°C, 45 s, 35 cycles. After the PCR amplification cycles were completed, the fluorescence value was read using the OMEGA SNP typing instrument. In this method, SNP site detection uses the fluorophores FAM (excitation light 485 nm, emission light 520 nm) and VIC (excitation light 535 nm, emission light 556 nm) to distinguish between two isogenic loci. The passive reference dye ROX (excitation light 575 nm, emission light 610 nm) was used to correct the signal difference between wells due to reaction volume error.

[0053] 3. Data Analysis

[0054] Data were analyzed using the genotype reading software KlusterCaller, in which VIC and FAM data were plotted on the x-axis and y-axis, respectively. The VIC and FAM values ​​for each reaction well were corrected using the values ​​of a reference dye (ROX) for that specific well, and the fluorescence values ​​were normalized to obtain relative fluorescence values ​​for VIC and FAM for each PCR reaction well. Samples were clustered based on relative fluorescence values, and genotypes were further determined based on sample clusters and fluorescence patterns.

[0055] Example 3

[0056] This example provides an application of the molecular marker TaAPC11-KASP, and the specific research is as follows:

[0057] 1. 333 wheat germplasm accessions from different ecological zones in my country, as listed in Table 2, were used. These accessions were planted at Tongwei Agricultural Station (35°11–105°19, 1750 m above sea level), Zhuanglang Agricultural Station (35°21–105°58, 2110 m above sea level), and Tianshui Agricultural Station (34°34–105°53, 1550 m above sea level). The eight planting environments are designated as follows: E1–E3: Tongwei, Gansu, 2020, 2021, and 2022; E4: Zhuanglang, Gansu, 2022; E5: Tianshui, Gansu, 2023; E6: Zhuanglang, Gansu, 2023; E7: Tianshui, Gansu, 2024; and E8: Zhuanglang, Gansu, 2024. All wheat accessions were sown in late September and harvested in early July of the following year. The field experiment was conducted using a randomized block design with three replicates. Each material was planted in three rows with a row spacing of 20 cm and a row length of 1 m. Thirty seeds were planted in each row. The seeds were tested after maturity. Three biological replicates were performed for each line.

[0058] 2. The TKW, KL, and KW of wheat were analyzed using the Wanshen SC-G automatic seed tester. All measurements were performed with three biological replicates. The specific data are shown in Table 3.

[0059] 3. Using the molecular markers provided in Example 1 and the method provided in Example 2, the significance between the phenotypes of wheat germplasm resources of the two genotypes was analyzed. The typing results are as follows: Figure 2 B. SPSS22.0 software was used to analyze whether there were significant differences in TKW, KL, and KW among wheat with different genotypes. The specific data are shown in Tables 3 and Figure 3 .

[0060] Table 3 Grain phenotypic data of two haplotype wheat germplasm resources of TaAPC11 gene in different ecological zones

[0061]

[0062]

[0063] Association analysis revealed that two haplotypes of the TaAPC11 gene were extremely significantly associated with TKW in eight environments, significantly associated with KW in six environments, and significantly associated with KL in four environments. Variance analysis of grain phenotypic traits of different haplotype materials revealed that TKW of haplotype TaAPC11-HapⅠ was significantly higher than that of haplotype TaAPC11-HapⅡ in all eight environments (P<0.05); KL of haplotype TaAPC11-HapⅠ was significantly higher than that of haplotype TaAPC11-HapⅡ in all four environments (P<0.05); and KW of haplotype TaAPC11-HapⅠ was significantly higher than that of haplotype TaAPC11-HapⅡ in all six environments (P<0.05). The above results indicate that haplotype TaAPC11-HapⅠ may be a superior allele variant for improving grain traits and should be given priority in future breeding.

[0064] 4. To investigate whether the superior haplotype TaAPC11-HapⅠ is actively selected in wheat breeding, we evaluated the geographical distribution of the two TaAPC11 haplotypes in China using 644 wheat accessions from 15 provinces. Figure 4 A and Table 4. In each province, if the total number of varieties containing two haplotypes is greater than or equal to 5, they can be counted; if the total number is less than 5, the province will not be counted. The ratio of the two haplotype materials in different provinces is calculated.

[0065] Table 4 Geographical distribution of wheat germplasm resources with different haplotypes of TaAPC11 gene

[0066]

[0067]

[0068] The distribution frequencies of haplotype TaAPC11-HapⅠ in 15 provinces of my country were 78.3% (Beijing), 79.5% (Gansu), 68.6% (Hebei), 52.6% (Henan), 65% (Jiangsu), 40% (Inner Mongolia), 66.7% (Ningxia), 87.5% (Qinghai), 48.6% (Shandong), 79.1% (Shanxi), 78.3% (Shaanxi), 100% (Sichuan), 87.8% (Tibet), 92.3% (Xinjiang), and 75% (Yunnan). These results indicate that TaAPC11-HapⅠ is widely selected in major wheat-producing areas of my country.

[0069] To further determine whether the haplotype TaAPC11-HapⅠ was positively selected during wheat breeding in China, we analyzed the allelic variation of the TaAPC11 gene during wheat breeding history using 641 different wheat varieties. Figure 4 B and Table 5. The years of all materials were divided into pre-1970, 1970s, 1980s, 1990s, 2000s, and post-2010 for statistical analysis, and the distribution frequencies of the two haplotype materials in the six time periods were calculated.

[0070] Table 5 Allele variation frequency of TaAPC11 in Chinese wheat breeding programs in different eras

[0071]

[0072] The results showed that the proportion of haplotype TaAPC11-HapⅠ has increased year by year in the process of wheat breeding in my country. In summary, the spatiotemporal distribution results indicate that haplotype TaAPC11-HapⅠ has been positively selected in wheat breeding and plays an important role in improving wheat grain-related traits.

[0073] Example 4

[0074] This example provides the application of the wheat grain weight-related gene TaAPC11, as follows:

[0075] 1. Cloning of wheat TaAPC11 gene and construction of transgenic vector

[0076] Total RNA from wheat spikelets was extracted using the Trizal method, and concentration was measured using a NanoDrop 2000. An A260 / A280 ratio of approximately 2.0 indicated acceptable sample quality. The coding region of the TaAPC11 gene was cloned, and a recombinant overexpression vector driven by the 35S promoter was constructed using homologous recombination.

[0077] 2. Construction of transgenic rice and screening of homozygous lines

[0078] The recombinant vector was introduced into the recipient material Zhonghua 11 using the Agrobacterium-mediated genetic transformation method, and the rice transgenic strain was obtained through resistance screening, differentiation, rooting, and seedling strengthening. The TaAPC11 overexpression homozygous strain was obtained through generation-by-generation resistance screening.

[0079] 3. Phenotypic Analysis of Transgenic Rice

[0080] The recipient Zhonghua 11 and the homozygous transgenic rice were potted in a greenhouse. After maturity, 30 plants of each material were randomly sampled and their grains were photographed. TKW, KL, and KW were measured and statistically analyzed using a Wanshen SC-G automatic seed analyzer. Phenotypic values ​​are the average of three replicates.

[0081] like Figure 5 As shown in the figure, the KL and KW of TaAPC11 transgenic rice were significantly increased compared with the recipient Zhonghua 11. Statistical analysis showed that the TKW, KL and KW of TaAPC11 transgenic rice were significantly higher than those of the recipient Zhonghua 11.

[0082] Example 5

[0083] This example provides a detailed association analysis method for TaAPC11 haplotypes and grain-related traits, as follows:

[0084] 1. Experimental Materials and Phenotypic Identification

[0085] This study used a natural population of 333 wheat varieties collected in the laboratory as experimental materials. These varieties were planted at Tongwei Agricultural Station (35°11–105°19, 1750 m above sea level), Zhuanglang Agricultural Station (35°21–105°58, 2110 m above sea level), and Tianshui Agricultural Station (34°34–105°53, 1550 m above sea level). The eight planting environments were designated as follows: E1–E3: Tongwei, Gansu, 2020, 2021, and 2022; E4: Zhuanglang, Gansu, 2022; E5: Tianshui, Gansu, 2023; E6: Zhuanglang, Gansu, 2023; E7: Tianshui, Gansu, 2024; and E8: Zhuanglang, Gansu, 2024. After wheat maturity, random samples of each variety were threshed, and grain-related traits were measured with three biological replicates.

[0086] 2. Genotyping and Haplotype Analysis of the Wheat TaAPC11 Gene

[0087] The resequencing data of 681 hexaploid wheat samples in the WheatUnion database (http: / / wheat.cau.edu.cn / WheatUnion / ) were used to obtain the variation sites of the TaAPC11 gene in different wheat materials, check the genotypes, and perform haplotype analysis on the wheat TaAPC11 gene. The results showed that 19 SNP sites were found in the coding region and promoter region of the TaAPC11 gene, and there were two haplotypes, namely TaAPC11-HapⅠ and TaAPC11-HapⅡ. Figure 2 A).

[0088] 3. Results of association analysis between the development of molecular markers for the wheat TaAPC11 gene and grain-related traits

[0089] A KASP marker was developed for the 845bp SNP (G / C) at the 3' end of the gene. A natural population of 333 wheat varieties / lines was tested to distinguish the two haplotypes TaAPC11-HapⅠ and TaAPC11-HapⅡ, and to separate the varieties with the two haplotypes ( Figure 2 B).

[0090] The association analysis of 333 natural population of wheat showed that two haplotypes of TaAPC11 gene were significantly associated with TKW in 8 environments, and significantly or extremely significantly associated with KW in 6 environments, and significantly or extremely significantly associated with KL in 4 environments. Figure 3 The variance analysis of grain phenotypic traits of different haplotype materials showed that TKW of haplotype TaAPC11-HapⅠ was significantly higher than that of haplotype TaAPC11-HapⅡ in 8 environments (P<0.05); KW of haplotype TaAPC11-HapⅠ was significantly higher than that of haplotype TaAPC11-HapⅡ in 6 environments (P<0.05); KL of haplotype TaAPC11-HapⅠ was significantly higher than that of haplotype TaAPC11-HapⅡ in 4 environments (P<0.05). The above results showed that haplotype TaAPC11-HapⅠ might be an excellent allelic variation for improving grain traits, which should be preferentially selected in future breeding.

[0091] 5. Selection of wheat TaAPC11 haplotype in Chinese wheat breeding

[0092] In order to study whether the excellent haplotype TaAPC11-HapⅠ was positively selected in wheat breeding, we evaluated the geographical distribution of two TaAPC11 haplotypes in China using 644 wheat varieties from 15 provinces of China. Figure 4 A) The results showed that the distribution frequency of haplotype TaAPC11-HapⅠ in 15 provinces of China was 78.3% (Beijing), 79.5% (Gansu), 68.6% (Hebei), 52.6% (Henan), 65% (Jiangsu), 40% (Inner Mongolia), 66.7% (Ningxia), 87.5% (Qinghai), 48.6% (Shandong), 79.1% (Shanxi), 78.3% (Shaanxi), 100% (Sichuan), 87.8% (Tibet), 92.3% (Xinjiang), and 75% (Yunnan). The results showed that TaAPC11-HapⅠ was widely selected in the main wheat producing areas of China.

[0093] In order to further determine whether haplotype TaAPC11-HapⅠ was positively selected in the process of Chinese wheat breeding, we analyzed the allelic variation of TaAPC11 gene in the historical breeding process of wheat using 641 different wheat varieties. Figure 4 B) The results showed that haplotype TaAPC11-HapⅠ was positively selected in wheat breeding, and played an important role in improving wheat grain-related traits.

[0094] 6. Grain Character Analysis of Wheat TaAPC11 Transgenic Rice

[0095] The recipient rice, Zhonghua 11, and the transgenic homozygous rice were potted in a greenhouse. After maturity, 30 plants of each material were randomly sampled and their grains were photographed. The TKW, KL, and KW values ​​of the transgenic TaAPC11 rice were measured and analyzed using a Wanshen SC-G automatic seed analyzer. The results showed that the TKW, KL, and KW values ​​of the transgenic TaAPC11 rice were significantly higher than those of the recipient rice, Zhonghua 11.

[0096] Therefore, the molecular marker TaAPC11-KASP developed for the TaAPC11 gene in the present invention can be used to screen the excellent haplotype TaAPC11-HapⅠ of the TaAPC11 gene in different wheat germplasms. This molecular marker and the screened excellent haplotype can be applied to future molecular breeding work.

[0097] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments. Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they are aware of the basic creative concepts. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention. Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Wheat kernel weight-related SNP loci, characterized by The SNP site is located at 845 bp in the 3' non-coding region of the wheat gene TaAPC11, and the polymorphism is C or A. The SNP site and upstream and downstream sequences are shown in the sequence listing SEQ No. 1 and SEQ No.

2.

2. The SNP site associated with wheat grain weight according to claim 1, characterized in that The wheat varieties with CC genotype at 845 bp of the 3' non-coding region of the gene TaAPC11 have higher TKW, KL (kernel Length) and KW (kernel width) than those with AA genotype.

3. The molecular marker TaAPC11, a gene related to wheat grain weight, is characterized by The nucleotide sequences of the molecular markers are shown in the sequence listings SEQ No. 1 and SEQ No.

2.

4. A method for developing a molecular marker for the wheat grain weight-related gene TaAPC11, characterized in that The method comprises the following steps: (1) extracting wheat DNA: extracting wheat genomic DNA to be tested, performing PCR amplification using specific amplification primers, and obtaining a PCR amplification product; (2) SNP detection: The genotype is determined by detecting the fluorescent signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence list SEQ ID NO.1, the genotype of the wheat SNP marker to be tested is CC; if the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence list SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is AA; (3) Data analysis: TASSEL5.1 software was used to perform association analysis on the phenotypic data, and SPSS22.0 software was used to perform one-way analysis of variance to analyze the significance of the differences in phenotypic values ​​between the two genotypes.

5. The wheat grain weight-related gene TaAPC11 molecular marker according to any one of claims 3 and 4, characterized in that The molecular markers were amplified using the following primers: KASP-TaAPC11-F1:GAAGGTCGGAGTCAACGGATTCCTTGCGTCATCGTATCCTTA; KASP-TaAPC11-F2: GAAGGTGACCAAGTTCATGCTCCTTGCGTCATCGTATCCTTC; KASP-TaAPC11-R:GAAGCACATGCCAGCCG.

6. Use of the wheat grain weight-related gene TaAPC11 molecular marker according to any one of claims 3 and 4 in wheat assisted breeding, characterized in that The application is achieved by the following method: detecting the genotype at 845bp of the 3' non-coding region of the gene TaAPC11 in the wheat genome to be tested. If the genotype is CC, it is high TKW, KL and KW wheat; if the genotype is AA, it is low TKW, KL and KW wheat.

7. The use of the wheat grain weight-related gene TaAPC11 molecular marker in wheat assisted breeding according to claim 6, characterized in that The genotype of the 845 bp portion of the 3' non-coding region of the gene TaAPC11 in the wheat genome was detected by one of the following methods: (1) direct sequencing; (2) amplification of the wheat genomic DNA to be tested using KASP-TaAPC11 primers and genotyping of the amplified product.

8. Application of overexpressing wheat gene TaAPC11 to improve TKW, KL and KW of rice, characterized in that The TaAPC11 gene CDS is shown in the sequence listing SEQ No. 3.

Images