LAMP (Loop-Mediated Isothermal Amplification) detection method
Through LAMP technology and optimization of specific primer groups, the problem of rapid and accurate detection of cocoa gall pathogens in port quarantine was solved, and high sensitivity and high specificity detection effects were achieved. It is suitable for port and field monitoring to ensure agricultural safety.
Patent Information
- Application Number
- CN202510994976.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-10-14
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify cocoa gall pathogens during port quarantine, and traditional molecular identification methods rely on professional equipment and complex operations, making it difficult to meet on-site testing needs.
LAMP technology was used, with EF-1α and Tub gene sequences as target sequences, specific primer sets were designed, and the reaction temperature was optimized. A visual rapid detection method was established, including LAMP primer sets and detection steps. A real-time turbidimeter and fluorescent dye method were used to judge the results.
It achieves rapid and accurate detection within 1 hour at a constant temperature of 65°C, and has high sensitivity and specificity for the detection of cocoa gall pathogens. It is suitable for port quarantine and field monitoring to ensure agricultural safety.
Smart Images
Figure CN120776036A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of pathogenic fungi detection, relates to a cocoa flower gall pathogen, and particularly relates to a LAMP detection method for the cocoa flower gall pathogen. Background Art
[0002] Cocoa flower gall pathogen (Albonectria rigidiuscula (Berk. & Broome) Rossman & Samuels) is a quarantine plant pathogen whose asexual stage is Fusarium decemcellulare (Brick). This pathogen has a wide host range and can harm a variety of economic crops and ornamental plants, including cocoa, mango, coffee, sugar apple, podocarpus, corn, and legumes. It causes root rot, vascular blockage, and the formation of cancerous tumors on branches, resulting in wilting and deformity, affecting plant growth and, in severe cases, even total crop failure. The pathogen is spread through soil and propagation materials (seeds and vegetative propagation materials) and can survive for several years in diseased tissue or soil. Given the severity of this pathogen and the difficulty of prevention and control, strengthening port quarantine plays a key role in preventing its cross-border spread and ensuring domestic ecological security.
[0003] Currently, port quarantine identification of the pathogen causing cocoa gall is based on the testing standard SN / T 3284-2012, which primarily relies on morphological identification and suffers from technical limitations such as long culture cycles and difficulty distinguishing similar species. While domestic research has utilized rDNA gene sequence analysis and real-time fluorescence PCR for molecular identification, these methods rely on specialized PCR equipment, are complex to operate, and require high levels of technical expertise, making them difficult to meet the practical needs of rapid port testing and field monitoring. Loop-mediated isothermal amplification (LAMP), a mature nucleic acid amplification technique, offers advantages such as ease of use, high sensitivity, and visual results, making it particularly suitable for on-site testing.
[0004] Duan Weijun et al. (2014) compared and analyzed the rDNA ITS, 28S, EF-1α, and Tub gene sequences of the cocoa flower gall pathogen and its related species, finding that the ITS and 28S sequences differed little, making them difficult to distinguish effectively. However, the EF-1α and Tub sequences were able to further effectively classify the pathogen. Therefore, the present invention uses EF-1α and Tub gene sequences as target sequences. Through primer design and screening, reaction temperature optimization, specificity and sensitivity testing, and application to sample testing, a visual rapid detection method for the cocoa flower gall pathogen was established. This provides a new technical means for port quarantine and field monitoring, and is of great significance for preventing the invasion of foreign pests and ensuring the safety of agricultural production in my country. Summary of the Invention
[0005] The present invention aims to provide a LAMP detection method for cocoa flower gall pathogen. Using EF-1α and Tub gene sequences as target sequences, a set of Tub gene-specific primer pairs was selected through primer design and screening. After optimizing the reaction temperature, testing their specificity and sensitivity, and applying them to sample detection, a visual and rapid detection method for cocoa flower gall pathogen was established, providing a new technical means for port quarantine and field monitoring.
[0006] In order to achieve the above object, the technical solution of the present invention is as follows:
[0007] The present invention provides a LAMP primer set for detecting cocoa flower gall pathogens, wherein the LAMP primer set consists of one pair of outer primers, one pair of inner primers, and a pair of loop primers LF / LB.
[0008] The outer primers are Tub2-F3 / Tub2-B3, and the inner primers are Tub2-FIP / Tub2-BIP;
[0009] The outer primer Tub2-F3: 5′-GCGCATGAGTGTCTACTTCA-3′,
[0010] The outer primer Tub2-B3: 5′-GACTGGCCGAAGACGAAG-3′;
[0011] The inner primer Tub2-FIP:
[0012] 5′-TACTTGTTGCCGGAGGCCTG-GTATGTATCGCGCCGTTTGT-3′,
[0013] The inner primer Tub2-BIP:
[0014] 5′-GTCCTCGTCGATCTTGAGCCTG-GAGCTGGCCAAATGGACC-3′;
[0015] The loop primer LF: 5′-ATGGTGTGAGCTGCGTTTCA-3′,
[0016] The loop primer LB: 5′-TACCATGGACGCCGTCCGT-3′.
[0017] The present invention also provides a LAMP detection method for cocoa gall pathogens, the specific steps of the LAMP detection method comprising:
[0018] (1) Extraction of sample DNA;
[0019] (2) using the sample DNA as a template to be tested, and using the above-mentioned LAMP primer set to amplify the sample DNA under LAMP amplification reaction conditions;
[0020] (3) Result judgment: The absorbance of the real-time turbidity meter is plotted into a curve to judge whether the reaction is positive or negative; the reaction tube is observed with the naked eye using the fluorescent dye method. When the amplification product is green, the result is judged to be positive; when the amplification product is orange-yellow, the result is judged to be negative.
[0021] 9. Preferably, the 25 μL reaction system of the LAMP amplification reaction comprises: 12.5 μL of 2×Reaction Mix reaction solution, 1 μL each of 5 μmol / L upstream outer primer and 5 μmol / L downstream outer primer, 1 μL each of 40 μmol / L upstream inner primer and 40 μmol / L downstream inner primer, 1 μL each of 20 μmol / L upstream loop primer and 20 μmol / L downstream loop primer, 1 μL each of Bst DNA polymerase, 2 μL of DNA template, 1 μL of fluorescent dye, and deionized water to 25 μL.
[0022] Preferably, the reaction conditions of the LAMP amplification reaction are: constant temperature reaction at 63-67° C. for 60 min; inactivation at 80° C. for 5 min to terminate the reaction.
[0023] Preferably, the reaction conditions of the LAMP amplification reaction are: constant temperature reaction at 65° C. for 60 min; inactivation at 80° C. for 5 min to terminate the reaction.
[0024] The present invention also provides an application of a LAMP primer set in detecting cocoa gall pathogens.
[0025] The present invention also provides an application of a LAMP detection method in detecting cocoa gall pathogens.
[0026] The present invention also provides a kit for rapidly detecting cocoa gall pathogens, comprising the above-mentioned LAMP primers.
[0027] The present invention also provides an application of a kit for rapidly detecting cocoa flower gall pathogens in detecting cocoa flower gall pathogens.
[0028] Beneficial effects of the present invention:
[0029] The present invention uses EF-1α and Tub gene sequences as target sequences, and through primer design and screening, a set of Tub gene-specific primers is selected. After optimizing the reaction temperature, testing its specificity and sensitivity, and applying it to sample detection, a visual rapid detection method for cocoa gall pathogen is established. This provides a new technical means for port quarantine and field monitoring, and is of great significance for preventing the invasion of foreign pests and ensuring the safety of agricultural production in my country. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 The optimal primer set screening results of the LAMP detection method for cocoa flower gall pathogens in the present invention are as follows (A is the turbidimeter detection result of the primer set screening; B is the color reaction result of the primer set screening; C is the detection result based on the turbidimeter detection of the optimal primer set and the addition of loop primers);
[0031] Figure 2 The temperature optimization results of the LAMP detection method for cocoa flower gall pathogens in the present invention are shown in Figure 2 (A is the temperature-optimized turbidimeter detection result; B is the temperature-optimized color development reaction result);
[0032] Figure 3 is the specific detection result of the LAMP detection method for cocoa flower gall pathogen in the present invention (A is the specific turbidity instrument detection result; B is the specific color reaction result; 1 to 23 are the strain DNA in Table 1, and CK is H2O);
[0033] Figure 4 The sensitivity test results of the LAMP detection method for cocoa flower gall pathogen in the present invention are as follows (A is the sensitivity turbidimeter test result; B is the sensitivity color reaction result, where 1 to 7 are DNA mass concentrations of 21.84 ng / μL, 21.84×10 -1 ng / μL、21.84×10 -2 ng / μL、21.84×10 -3 ng / μL、21.84×10 -4 ng / μL、21.84×10 -5 ng / μL、21.84×10 -6 ng / μL, CK is H2O);
[0034] Figure 5 This is a sample test of the LAMP detection method for cocoa flower gall pathogens in the present invention (A is the turbidity meter detection result of the sample detection; B is the color reaction result of the sample detection, wherein 1 is a positive control (strain 2268-2-2-3), 2 is sugar apple fruit inoculated with strain 2268-2-2-3, 3 is sugar apple fruit inoculated with strain 2311756-1, 4 is sugar apple fruit inoculated with strain Ke③-2-3, 5 is sugar apple branch from Taiwan Province, 6 is sugar apple fruit from Taiwan Province, 7 is sugar apple fruit imported from Cambodia, 8 is mango, 9 is passion fruit, 10 is a negative control (strain BLY1), and CK is H2O.). DETAILED DESCRIPTION
[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0036] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0037] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0038] Example 1 Primer design, screening, and optimization
[0039] 1 Experimental Materials
[0040] Materials, reagents, and instruments
[0041] 1.1 Test strains
[0042] A total of 23 strains were tested in the present invention, including 4 cocoa flower gall pathogens, 2 of which were isolated and identified from sugar apples purchased by our laboratory (Li Min et al., 2022), and 2 were isolated and identified from sugar apples imported from Vietnam by the Plant Inspection Laboratory of Chongqing Customs Technical Center; 11 plant fungi of the genus Fusarium and 8 plant fungi of other genera isolated from sugar apples (see Table 1 for details).
[0043] Table 1 Types of tested strains
[0044]
[0045] 1.2 Culture medium
[0046] Potato dextrose agar (PDA) medium.
[0047] 1.3 Reagents
[0048] DNA amplification kit (Rongyan Biotechnology (China) Co., Ltd.); fluorescence visual detection kit (Rongyan Biotechnology (China) Co., Ltd.); plant genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).
[0049] 1.4 Instruments
[0050] LA-500 real-time turbidity amplification system (Eiken Co., Ltd., Japan); SW22 constant temperature oscillating water bath (Ulabor (Beijing) Co., Ltd.); N60 ultramicro-spectrophotometer (Implen, Germany); Veriti96-Well gradient PCR instrument (Applied Biosystems, USA).
[0051] 2 Experimental methods
[0052] 2.1 Strain DNA extraction and verification
[0053] The test strains were cultured in the dark on PDA medium at 25°C for 1 week, and then the mycelia were scraped and DNA was extracted using a plant genomic DNA extraction kit. The specific operation was referred to the kit. The extracted DNA was detected by ultra-micro spectrophotometer and then frozen in a -20°C refrigerator for use.
[0054] The universal primers ITS1 / ITS4 were used to amplify the ITS sequence (White et al., 1990), the primers EF1-728F / EF1-986R were used to amplify the EF-1α sequence (Carbone & Kohn, 1990), and the primers T1 / Bt2b were used to amplify the Tub sequence (Glass & Donaldson, 1995). PCR amplification products were sent to Shanghai Sangon Biotechnology Co., Ltd. for bidirectional sequencing. Sequencing results were compared using the BLAST program on the NCBI website (https: / / www.nlm.nih.gov) to verify the strain.
[0055] After comparison, the test strain was determined to be the cocoa flower gall pathogen.
[0056] 2.2 Design of LAMP reaction primers
[0057] The EF-1α and Tub gene sequences were used as target sequences, and sequences from other Fusarium species and related species available at NCBI were analyzed. MEGA 5.0 software was used for alignment, and regions with low homology between the pathogen and other pathogens were screened. Primer Exploer V5 (http: / / primerexplorer.jp / lampv5e / index.html) was used to design LAMP primers for the pathogen. A total of six primer sets were generated (Table 2). Primer synthesis was performed by Sangon Biotech (Shanghai) Co., Ltd.
[0058] Table 2 Primer set information for LAMP assay design of cocoa gall pathogen
[0059]
[0060] 2.3 Screening of LAMP primer sets
[0061] Using genomic DNA from the pathogen of cocoa flower gall as a template, six primer sets were designed and configured according to the DNA amplification kit manual. Amplification was performed on the test DNA under constant temperature. A 25 μL LAMP reaction system consisted of: 12.5 μL of 2× Reaction Mix (RM), 1 μL each of outer primers F3 and B3 (5 μmol / L), 1 μL each of inner primers FIP and BIP (40 μmol / L), 1 μL of Bst DNA polymerase, 2 μL of DNA template, 1 μL of fluorescent dye, and deionized water to 25 μL. Based on the amplification efficiency of the selected primer set, the design of loop primers LF and LB was considered. If 1 μL each of LF and LB (20 μmol / L) was added to the system, the deionized water volume was reduced by 2 μL.
[0062] The LAMP amplification reaction conditions were as follows: constant temperature reaction at 65°C for 60 min; inactivation at 80°C for 5 min to terminate the reaction.
[0063] The LAMP reaction produces pyrophosphate, which reacts chemically with divalent magnesium ions in the reaction solution to produce a white precipitate of magnesium pyrophosphate. (1) Use a real-time turbidimeter to measure the absorbance of the reaction tube every 6 seconds and plot a curve to determine whether the reaction is positive or negative. (2) Visually observe the reaction tube. If the amplified product is green, the result is positive; if the amplified product is orange-yellow, the result is negative.
[0064] 2.4 Temperature optimization of LAMP detection method
[0065] Using genomic DNA from the pathogen of cocoa gall as a template and sterile water as a blank control, the optimal primer combination was used to screen for the optimal temperature. The reaction mixture was amplified at 63°C, 64°C, 65°C, 66°C, and 67°C for 60 minutes. The temperature optimization results were determined by observing the absorbance curve using a real-time turbidimeter and the color development using a fluorescent dye.
[0066] 3 Experimental results
[0067] 3.1 Screening of the optimal primer set for LAMP detection
[0068] Using the genomic DNA of strain 2268-2-2-3 as a template and sterile water as a blank control, the six primer sets designed for the LAMP detection system for cocoa gall pathogens (Table 1) were used for LAMP amplification at 65°C. The real-time detection results of the turbidity meter showed that both primer sets Tub-2 and Tub-3 showed positive amplification ( Figure 1 A), and the Tub-2 primer group first undergoes LAMP reaction. Observe the reaction tube with naked eyes ( Figure 1B), the solutions in the reaction tubes of the two primer sets Tub-2 and Tub-3 were green (positive), while the solutions in the other reaction tubes were orange (negative), consistent with the results of the real-time turbidity meter. Therefore, the Tub-2 primer set was determined to be the optimal primer set for the LAMP detection system for the cocoa flower gall pathogen. To increase the amplification efficiency of the Tub-2 primer set, the loop primers LF (ATGGTGTGAGCTGCGTTTCA) and LB (TACCATGGACGCCGTCCG) of the Tub-2 primer set for the cocoa flower gall pathogen were designed using the online software Primer Exploer V5 (http: / / primerexplorer.jp / lampv5e / index.html). After adding the loop primers, the reaction speed of strain 2268-2-2-3 was accelerated, and the reaction time was shortened from 38 minutes and 42 seconds to 19 minutes and 30 seconds ( Figure 1 C). In summary, the optimal primer set for the LAMP detection system of cocoa gall pathogen was determined (Table 3).
[0069] Table 3 Information on the optimal primer sets for the LAMP method for cocoa gall pathogens
[0070]
[0071] 3.2 Temperature optimization of LAMP detection method
[0072] The primer set for LAMP detection of cocoa gall pathogen was used, and the reaction temperatures were set at 63℃, 64℃, 65℃, 66℃, and 67℃, respectively. The genomic DNA of strain 2268-2-2-3 was used as the template for LAMP reaction. The results showed that ( Figure 2 ), the cocoa gall pathogen showed positive amplification at 63-67℃, among which the amplification started earliest at 65℃ and the amplification efficiency was the highest, thus determining that the optimal reaction temperature was 65℃.
[0073] Example 2 LAMP method verification
[0074] 1 Experimental methods
[0075] 1.1 Specificity test of LAMP detection method
[0076] According to the test strain DNA in Table 1 of Example 1 as a template and sterile water as a blank control, LAMP amplification was performed using the optimal primer combination and the optimal reaction temperature. The absorbance curve of the real-time turbidimeter and the color development result were observed by naked eye using the fluorescent dye method to determine whether the reaction was effective.
[0077] 1.2 Sensitivity test of LAMP detection method
[0078] The DNA concentration of the cocoa gall pathogen strain 2268-2-2-3 was measured using an N60 ultramicro-spectrophotometer. Seven 10-fold dilutions were prepared using sterile water. 2 μL of each of the original solution and the dilutions were used as DNA templates. Using the optimized LAMP assay system, the sensitivity of the reaction was determined by observing the absorbance curve using a real-time turbidimeter and the color development using a fluorescent dye.
[0079] 1.3 Application of LAMP detection method
[0080] Healthy sugar apple fruits were selected for inoculation experiments, following the method of Li Min et al. (2022). A 4 mm incision was made in the sugar apple fruit using a sterilized knife. A 10-day-old mycelial mass of strain 2268-2-2-3 was selected and inoculated onto the cut surface of the sugar apple fruit. The mycelial mass was then covered with moistened sterile cotton wool and placed in a sealed bag. Three fruits were inoculated and incubated in a 25°C incubator. After two weeks, DNA was extracted from diseased tissues of the three inoculated fruits. In addition, healthy host samples, including one sugar apple branch (Taiwan Province, China), one sugar apple fruit (Taiwan Province, China), one sugar apple fruit (imported from Cambodia), one mango (Hainan Province, China), and one passion fruit (Fujian Province, China), were selected for DNA extraction. Strain 2268-2-2-3 was used as a positive control, strain BLY1 as a negative control, and sterile water as a blank control, were used. According to the optimized LAMP detection system, the effectiveness of the reaction was determined by observing the absorbance curve of the real-time turbidimeter and the color development results with the naked eye using the fluorescent dye method.
[0081] 2 Experimental results
[0082] 2.1 Specificity results of LAMP detection method
[0083] The DNA of the 23 test strains in Table 1 of Example 1 was used as template, sterile water was used as blank control, and the optimal primer set was used for amplification at 65°C for 60 minutes. The results showed that ( Figure 3 ), 4 strains of cocoa gall pathogens were positively amplified; the solution in the LAMP reaction tube changed from orange to green, and no amplification was observed for the other 19 pathogens. This indicates that the LAMP detection method of the present invention has good specificity.
[0084] 2.2 Sensitivity analysis of LAMP detection method
[0085] The DNA concentration of the cocoa gall pathogen strain 2268-2-2-3 was 21.84 ng / μL as measured by N60 ultra-micro spectrophotometer. The DNA concentration of the samples was diluted to 21.84×10 -1 ng / μL、21.84×10 -2 ng / μL、21.84×10 -3ng / μL、21.84×10 -4 ng / μL、21.84×10 -5 ng / μL、21.84×10 -6 ng / μL and then LAMP reaction was performed. The results showed that when the DNA concentration of the cocoa gall pathogen strain was diluted to 21.84×10 -4 ng / μL, all showed positive amplification, and the corresponding LAMP reaction tube was green ( Figure 4 The results showed that the LAMP detection method established by the present invention has high sensitivity.
[0086] 2.3 Application of LAMP detection method
[0087] LAMP reaction was performed on the DNA of the inoculated samples and healthy host samples. The results showed that all three inoculated samples and the positive control 2268-2-2-3 were positively amplified, and the corresponding LAMP reaction tubes were green ( Figure 5 ), while no amplification curves were observed in the healthy host sample, the negative control BLY1, and the blank control H2O. The above test results indicate that the LAMP detection method established in the present invention can quickly and accurately detect the cocoa flower gall pathogen.
[0088] In summary, the present invention can complete detection within 1 hour under a constant temperature of 65°C, showing high specificity and high sensitivity, breaking through the technical limitations of traditional methods. It is suitable for occasions with limited detection conditions, such as port quarantine, field monitoring and grassroots laboratories, and provides reliable technical support for rapid port quarantine, epidemic monitoring and field prevention and control. It has important application value in preventing the invasion of foreign pests and ensuring the ecological security of my country's agriculture.
[0089] The above-described embodiments merely represent preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the spirit of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.
Claims
1. A LAMP primer set for detecting cocoa gall pathogens, characterized in that: The LAMP primer set consists of one pair of outer primers, one pair of inner primers, and a pair of loop primers LF / LB. The outer primers are Tub2-F3 / Tub2-B3, and the inner primers are Tub2-FIP / Tub2-BIP. The outer primer Tub2-F3: 5′-GCGCATGAGTGTCTACTTCA-3′, The outer primer Tub2-B3: 5′-GACTGGCCGAAGACGAAG-3′; The inner primer Tub2-FIP: 5′-TACTTGTTGCCGGAGGCCTG-GTATGTATCGCGCCGTTTGT-3′, The inner primer Tub2-BIP: 5′-GTCCTCGTCGATCTTGAGCCTG-GAGCTGGCCAAATGGACC-3′; The loop primer LF: 5′-ATGGTGTGAGCTGCGTTTCA-3′, The loop primer LB: 5′-TACCATGGACGCCGTCCGT-3′.
2. A LAMP detection method for cocoa gall pathogens, characterized in that: The specific steps of the LAMP detection method include: (1) Extraction of sample DNA; (2) using the sample DNA as a template to be tested, using the LAMP primer set according to claim 1, and amplifying the sample DNA under LAMP amplification reaction conditions; (3) Result judgment: The absorbance of the real-time turbidity meter is plotted into a curve to judge whether the reaction is positive or negative; the reaction tube is observed with the naked eye using the fluorescent dye method. When the amplification product is green, the result is judged to be positive; when the amplification product is orange-yellow, the result is judged to be negative.
3. The LAMP detection method for cocoa gall pathogen according to claim 2, characterized in that: The 25 μL reaction system of the LAMP amplification reaction includes: 12.5 μL of 2×Reaction Mix reaction solution, 1 μL each of 5 μmol / L upstream outer primer and 5 μmol / L downstream outer primer, 1 μL each of 40 μmol / L upstream inner primer and 40 μmol / L downstream inner primer, 1 μL each of 20 μmol / L upstream loop primer and 20 μmol / L downstream loop primer, 1 μL each of Bst DNA polymerase, 2 μL of DNA template, 1 μL of fluorescent dye, and deionized water to 25 μL.
4. The LAMP detection method for cocoa gall pathogen according to claim 2 or 3, characterized in that: The reaction conditions of the LAMP amplification reaction are: constant temperature reaction at 63-67° C. for 60 min; inactivation at 80° C. for 5 min to terminate the reaction.
5. The LAMP detection method for cocoa gall pathogen according to claim 4, characterized in that: The reaction conditions of the LAMP amplification reaction are: constant temperature reaction at 65° C. for 60 min; inactivation at 80° C. for 5 min to terminate the reaction.
6. Use of the LAMP primer set according to claim 1 or the LAMP detection method according to any one of claims 2 to 5 in detecting cocoa gall pathogens.
7. A kit for rapid detection of cocoa gall pathogens, characterized in that: The method comprises the LAMP primer set according to claim 1.
8. Use of the kit according to claim 7 in detecting cocoa gall pathogens.