SNP (Single Nucleotide Polymorphism) marker related to color of root tuber and anthocyanin content of sweet potato and application of SNP marker
By developing a SNP marker at position 25658800 of sweet potato chromosome 10a and using KASP technology to rapidly detect sweet potato root tuber color and anthocyanin content, the problem of lack of linkage markers for anthocyanin content in sweet potato breeding was solved, and efficient breeding-assisted selection was achieved.
Patent Information
- Application Number
- CN202511127229.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-12
- Publication Date
- 2025-10-14
AI Technical Summary
In the existing technology, the sweet potato genetic background is highly heterozygous and the hybrid self-incompatibility phenomenon is serious, resulting in a lack of research and development of linked molecular markers for anthocyanin content in sweet potato tubers, which limits the in-depth application of breeding practice and research.
A SNP marker associated with sweet potato root tuber color and anthocyanin content was developed using KASP technology. The marker is located at position 25658800 on chromosome 10a of sweet potato. Genotyping was performed using competitive allele-specific PCR. The SNP-KASP marker, corresponding primer sets, and kits are provided to enable rapid and accurate detection of sweet potato root tuber color and anthocyanin content.
It has achieved rapid and accurate detection of sweet potato root tuber color and anthocyanin content, shortened the breeding cycle, improved breeding efficiency, and met the needs of large-scale molecular marker-assisted selection. The detection efficiency reached 100% for identifying purple sweet potatoes and 85.04% for identifying non-purple sweet potatoes.
Smart Images

Figure CN120776044A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the sweet potato breeding technical field, especially to a SNP marker related to the color and anthocyanin content of sweet potato tuber and application thereof. BACKGROUND
[0002] Anthocyanins is a kind of flavonoids, which is the most effective antioxidant found today, and is the most powerful free radical scavenger, with anti-mutation function. Because it meets people's demand for natural, safe and healthy, products rich in anthocyanins are sought after by people. The synthesis pathway of anthocyanins in plants is co-regulated by structural genes and regulatory genes. The regulatory genes involved in anthocyanin synthesis are mainly MYB transcription factors, bHLH transcription factors and WD40 repeat proteins, which usually form an MBW complex to regulate the expression of anthocyanin pathway structural genes, thereby regulating the synthesis of anthocyanins in plants. Sweet potato not only has a comprehensive and balanced nutritional value, but also has significant health functions. Its tuber contains a variety of nutrients, among which the content of anthocyanins is particularly outstanding. Those sweet potatoes with purple flesh are unique because of the rich content of this component.
[0003] In the prior art, sweet potato is cultivated as a hexaploid species, which not only has a highly hybrid genetic background, but also has a wide range of cross and self-incompatibility. These physiological characteristics greatly hinder the construction of sweet potato genetic population, resulting in a limited number of genetic loci obtained through linkage analysis, which seriously limits its application in in-depth research and breeding practice.
[0004] As a new generation of polymorphic genetic markers after restriction enzyme digestion fragment length polymorphism, variable number of repeat sequences and microsatellite polymorphism, SNP has significant advantages, but as of now, the development of molecular markers linked to the anthocyanin content of sweet potato tuber is still relatively scarce. Based on the above status, there is an urgent need in the field for a method that can effectively obtain the related loci of the anthocyanin content of sweet potato tuber. SUMMARY
[0005] The purpose of the present application is to provide a SNP marker related to the color and anthocyanin content of sweet potato tuber and application thereof. The SNP genotyping is obtained by KASP technology (competitive allele-specific PCR), which can accurately and efficiently identify the color and anthocyanin content of sweet potato tuber. The color and anthocyanin content level of sweet potato tuber can be known with high probability through molecular detection at the seedling stage of sweet potato, which shortens the breeding cycle of sweet potato and is used for molecular marker-assisted selection breeding of sweet potato, which will provide new breeding auxiliary markers for breeders.
[0006] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:
[0007] The application provides a SNP marker related to sweet potato tuber color and anthocyanin content, wherein the SNP marker is located at position 25658800 of the 10a chromosome of the sweet potato, and the base polymorphism is A / T.
[0008] Preferably, the base polymorphism is A / T, and there are two genotypes of AT and TT.
[0009] The AT genotype is a heterozygous type of the SNP site AT, and the sweet potato tuber flesh is purple and has high anthocyanin content.
[0010] The TT genotype is a homozygous type of the SNP site T, and the sweet potato tuber flesh is 85.04% non-purple and has low anthocyanin content.
[0011] The application also provides a SNP-KASP marker containing the SNP marker, and the nucleotide sequence of the SNP-KASP marker is shown in SEQ ID NO. 1.
[0012] The application also provides a primer set for detecting the SNP-KASP marker, and the primer set comprises a forward primer F1, a forward primer F2 and a reverse primer R.
[0013] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO. 2.
[0014] The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO. 3.
[0015] The nucleotide sequence of the reverse primer R is shown in SEQ ID NO. 4.
[0016] The application also provides a kit for detecting the SNP-KASP marker, and the kit comprises the primer set.
[0017] The application also provides a method for detecting the color or anthocyanin content of sweet potato tuber, comprising the following steps:
[0018] The genomic DNA of the sweet potato to be detected is used as a template, the primer set or the kit is used for KASP PCR amplification, and genotyping is performed by using the amplification result.
[0019] Preferably, the reaction system of the KASP PCR amplification is as follows: DNA 0.8-1.2 μL, HiGeno2xProbeMixA 3-7 μL, mixed primer 0.1-0.2 μL, and water is added to 10 μL.
[0020] The preparation method of the mixed primer is as follows: firstly, the forward primer F1, the forward primer F2 and the reverse primer R are respectively dissolved in water to 80-120 muM, then 10-14 muL of the forward primer F1, 10-14 muL of the forward primer F2, 25-35 muL of the reverse primer and 40-50 muL of water are mixed, and the mixed primer is obtained.
[0021] As preferred, the reaction procedure of the KASP PCR amplification is as follows: 95 DEG C pre-denaturation for 10 min; 95 DEG C denaturation for 20 s, 55 DEG C-61 DEG C annealing / extension for 40 s, 10 cycles; 95 DEG C denaturation for 20 s, 55 DEG C annealing / extension for 40 s, 30-34 cycles.
[0022] The application further provides application of the SNP-KASP marker, the primer set, the kit or the method in detection of sweet potato varieties or sweet potato tuber color or anthocyanin content.
[0023] The application further provides a breeding method for improving anthocyanin content of sweet potato, comprising the following steps: genotype detection is performed on the SNP marker located at the position of 25658800 bp of the 10a chromosome in a sweet potato sample, and the sweet potato sample with the genotype A / T is selected for breeding.
[0024] Genome-wide association study (GWAS) is a method for gene positioning based on linkage disequilibrium principle, which does not need to construct a genetic population, has high positioning accuracy, short cycle, and can discover a wide variety of variations, and has been widely applied in gene positioning of animals and plants, and a plurality of genes with significant application value have been cloned, and GWAS is a powerful means for gene mining. GWAS has high resolution, can be accurate to a single single nucleotide polymorphism (SNP) variation site, and can directly find a causal mutation. Therefore, the GWAS method has been widely applied in key gene mining of important agronomic traits of different crops, can greatly shorten the gene positioning time and reduce the labor intensity, provides a new idea for genetic and molecular mechanism research of important agronomic traits of sweet potato, and promotes the transformation of traditional breeding of sweet potato to efficient and accurate molecular breeding.
[0025] SNP is a new generation of polymorphic genetic markers after restriction enzyme digestion fragment length polymorphism, variable number of repeat sequence and microsatellite polymorphism, and KASP technology is one of the mainstream methods for SNP typing, which can accurately determine the double alleles of SNPs. This technology is based on the specific matching of primer end base to SNP typing. KASP technology is used for large-scale detection of SNP marker genotyping, shortens the verification time of markers, reduces the detection cost of markers, and is an important way for current plant molecular marker positioning and large population scanning. KASP genotyping technology is based on its unique PCR principle, which can finally use universal fluorescent primer amplification for all site detection, which greatly reduces the reagent cost of KASP, is accurate as a gold standard, and reduces the use cost, so KASP has very good application prospect in agricultural detection.
[0026] The beneficial effects of the present application are:
[0027] The present application provides a SNP marker related to sweet potato tuber color and anthocyanin content and its application, including predicting, identifying or assisting in identifying sweet potato tuber color and anthocyanin content. The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, which is located at the 25658800th base of the 10a chromosome of sweet potato, and the molecular marker presents an encryption linkage marker feature with the sweet potato tuber color and anthocyanin content. When the SNP genotype of the sample to be tested is A / T, the anthocyanin content of the tuber is high, and the tuber is purple, and when the SNP genotype is T / T, the anthocyanin content of the tuber is low, and the probability of non-purple is high. The detection method and kit provided by the present application can verify the efficiency of the developed SNP marker for identifying purple sweet potato to reach 100%, and the efficiency of identifying non-purple sweet potato to reach 85.04%, which can quickly and accurately detect the high and low of the tuber color and anthocyanin content of sweet potato, has the advantages of simple operation, low cost and the like, and can meet the needs of large-scale molecular marker assisted selection. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 SNP discovery process;
[0029] Figure 2 SNP marker genotyping results in sweet potato germplasm resources;
[0030] Figure 3 Correlation between SNP and flesh color;
[0031] Figure 4 Correlation between SNP and anthocyanin content of sweet potato flesh. DETAILED DESCRIPTION
[0032] The invention provides a SNP marker related to the color and anthocyanin content of sweet potato tubers. The SNP marker is located at position 25658800 of chromosome 10a of sweet potato, and the base polymorphism is A / T.
[0033] In the present invention, the base polymorphism is A / T, and there are two genotypes: AT and TT;
[0034] The AT genotype is a heterozygous type of the SNP site AT, and the sweet potato tuber flesh is purple and has a high anthocyanin content;
[0035] The TT genotype is a homozygous type in which the SNP site is T, and 85.04% of the sweet potato tuber flesh is non-purple and has a low anthocyanin content.
[0036] The present invention also provides a SNP-KASP marker containing the SNP marker, wherein the nucleotide sequence of the SNP-KASP marker is preferably as shown in SEQ ID NO.1;
[0037] The nucleotide sequence of SEQ ID NO.1 is preferably:
[0038] TTGTGTTATCTTTGGGACACAGGGACTTCACGAGGGCTTGTTTCCAATT
[0039] TCTATACTCATGCGCCAACTATATATTCTTTACCAAAAAGGCCAAACATA C [A / T] CCATTGGACTAGCTAGCTAGATTGCAACTTAGCTACATAGCTTGT TTGGTTCATTTCACTACCCCTTATTAATCCTCTCCAACCCCTTTCTACATT CTTG.
[0040] The present invention also provides a primer set for detecting the SNP-KASP marker, wherein the primer set comprises a forward primer F1, a forward primer F2 and a reverse primer R;
[0041] The nucleotide sequence of the forward primer F1 is preferably as shown in SEQ ID NO.2;
[0042] The nucleotide sequence of SEQ ID NO.2 is preferably (the underlined portion is the FAM tag sequence):
[0043] GAAGGTGACCAAGTTCATGCT AATCTAGCTAGCTAGTCCAATGGA;
[0044] The nucleotide sequence of the forward primer F2 is preferably as shown in SEQ ID NO.3;
[0045] The nucleotide sequence of SEQ ID NO. 3 is preferably (the underlined part is the HEX tag sequence):
[0046] GAAGGTCGGAGTCAACGGATT AATCTAGCTAGCTAGTCCAATGGT;
[0047] The nucleotide sequence of the reverse primer R is preferably as shown in SEQ ID NO. 4;
[0048] The nucleotide sequence of SEQ ID NO. 4 is preferably:
[0049] CATGCGCCAACTATATATTCTTTA.
[0050] The application also provides a kit for detecting the SNP-KASP marker, which comprises the primer set.
[0051] The application also provides a method for detecting the color or anthocyanin content of sweet potato tubers, comprising the following steps:
[0052] The genomic DNA of the sweet potato to be tested is used as a template, and the primer set or the kit is used for KASP PCR amplification, and genotyping is performed using the amplification results.
[0053] In the application, the reaction system of the KASP PCR amplification is preferably: DNA 0.8-1.2 μL, HiGeno 2x Probe MixA 3-7 μL, mixed primer 0.1-0.2 μL, water to 10 μL; further preferably: DNA 1 μL, HiGeno 2x Probe MixA 5 μL, mixed primer 0.14 μL, sterile water to 10 μL;
[0054] The preparation method of the mixed primer is preferably: first, dissolve the forward primer F1, the forward primer F2 and the reverse primer R in water to 80-120 μM, then mix 10-14 μL of the forward primer F1, 10-14 μL of the forward primer F2, 25-35 μL of the reverse primer and 40-50 μL of water, and the mixture is the mixed primer; further preferably: first, dissolve the forward primer F1, the forward primer F2 and the reverse primer R in sterile water to 100 μM, then mix 12 μL of the forward primer F1, 12 μL of the forward primer F2, 30 μL of the reverse primer and 46 μL of water, and the mixture is 100 μL of the mixed primer.
[0055] In the present application, the reaction procedure of the KASP PCR amplification is preferably: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 55-61℃ annealing / extension for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing / extension for 40 s, 30-34 cycles; further preferably: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 58℃ annealing / extension for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing / extension for 40 s, 32 cycles.
[0056] The present application also provides the application of the SNP-KASP marker, the primer set, the kit or the method in detecting sweet potato varieties or sweet potato tuber color or anthocyanin content.
[0057] The present application also provides a breeding method for improving the anthocyanin content of sweet potato, comprising the following steps: detecting the genotype of the SNP marker located at the position of 25658800 bp of chromosome 10a in the sweet potato sample, and selecting the sweet potato sample with the genotype of A / T for breeding.
[0058] The SNP discovery process of the present application is shown in Figure 1 Through genome-wide association analysis, a SNP group significantly associated with sweet potato flesh color and anthocyanin content is detected on chromosome 10a.
[0059] The technical solutions provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.
[0060] Example 1: Positioning of SNP sites related to sweet potato tuber color and anthocyanin content by whole genome association analysis
[0061] Sequencing was performed on 314 sweet potato germplasm resources collected from all over the world by using resequencing technology. A set of subgenomes of the reference genome was used as a reference, and the short sequences obtained by sequencing were compared to the reference genome. After quality control and further screening, variation information covering the whole genome of sweet potato was obtained, including 4,599,509 SNPs. Genome-wide association analysis (GWAS) was performed in combination with tuber anthocyanin content-related phenotype data, and SNP sites related thereto were obtained, i.e. the SNP at the position of 25658800 bp of chromosome 10a (P = 1.17 x 10 -28 ) Reference genome version XUSHU18-IBA_r1.0.
[0062] Example 2: KASP technology for detecting genotyping of sweet potato germplasm resources
[0063] The application according to the above SNP site calls the SNP-KASP marker of the nucleotide sequence of 100 bp upstream and downstream of the reference genome, the nucleotide sequence of the SNP-KASP marker is shown as SEQ ID NO. 1, a primer set for amplifying the SNP-KASP marker is designed, the primer set includes a forward primer F1, a forward primer F2 and a reverse primer R; different detection linker sequences are connected to the 5' ends of the two forward primers respectively;
[0064] The nucleotide sequence of SEQ ID NO. 1 is preferably (the SNP site is underlined and bolded): TTGTGTTATCTTTGGGACACAGGGACTTCACGAGGGCTTGTTTCCAATT TCTATACTCATGCGCCAACTATATATTCTTTACCAAAAAGGCCAAACATA C [A / T] CCATTGGACTAGCTAGCTAGATTGCAACTTAGCTACATAGCTTGT TTGGTTCATTTCACTACCCCTTATTAATCCTCTCCAACCCCTTTCTACATT CTTG;
[0065] The nucleotide sequence of the forward primer F1 is shown as SEQ ID NO. 2 (the FAM label sequence is underlined):
[0066] GAAGGTGACCAAGTTCATGCT AATCTAGCTAGCTAGTCCAATGGA;
[0067] The nucleotide sequence of the forward primer F2 is shown as SEQ ID NO. 3 (the HEX label sequence is underlined):
[0068] GAAGGTCGGAGTCAACGGATT AATCTAGCTAGCTAGTCCAATGGT;
[0069] The nucleotide sequence of the reverse primer R is shown as SEQ ID NO. 4:
[0070] CATGCGCCAACTATATATTCTTTA.
[0071] The KASP PCR amplification reaction system is specifically: DNA (1 μL, 30 ng), HiGeno 2xProbe Mix A (5 μL), mixed primer (0.14) μL, sterile water 3.86 μL, total reaction system 10 μL.
[0072] KASP PCR amplification reaction procedure: 95°C pre-denaturation 10 min; 95°C denaturation 20 s, 55°C annealing / extension 40 s, 10 cycles; 95°C denaturation 20 s, 55°C annealing / extension 40 s, 34 cycles.
[0073] After PCR is completed, the QuantStudio Real Time PCR is used to read and analyze the fluorescence signal to obtain a clear and intuitive typing chart. Samples of the same genotype will present the same color and gather together, such as Figure 2 , the position close to the X axis (red dot FAM) is the homozygous A / A genotype, and the type of variation is not found in this test, the position close to the Y axis (blue dot HEX) is the homozygous T / T genotype, and the green one is the heterozygous A / T genotype.
[0074] Verification of the correlation between the above KASP marker and the flesh color and anthocyanin content of sweet potato
[0075] Randomly select 161 sweet potato germplasm resources, and genotype based on the above SNP. And plant the above germplasm resources in Xuzhou, Jiangsu, and investigate the flesh color at the harvest period. The test results are shown in Figures 2 to 4 and Table 1.
[0076] Figure 2 The results show that: based on KASP technology, 161 sweet potato germplasm resources selected are genotyped based on the SNP located at 25658800 bp of chromosome 10a, and it is found that the above samples can be clearly divided into two types, 34 germplasm resources are A / T type, green dot in the figure, and 127 germplasm resources are T / T type, blue dot in the figure. The chart shows that the SNP based on KASP technology has good typing effect on sweet potato.
[0077] Figure 3 The results show that: further, the flesh color of the above 161 sweet potato germplasm resources is investigated, and the results show that the flesh of 34 A / T type germplasm resources is purple, with a probability of 100%; among the 127 T / T type germplasm resources, 108 are non-purple, and 19 are purple, and the probability of successfully identifying non-purple sweet potato is 85.04%.
[0078] Figure 4 The results show that: further, the anthocyanin content of the flesh of 56 samples is investigated, and it is found that the anthocyanin content of the flesh of the A / T type sample is significantly higher than that of the T / T type sample.
[0079] The results of Table 1 show that: all 34 A / T type germplasm resources have purple flesh, the probability is 100%; 108 of 127 T / T type germplasm resources are non-purple, 19 are purple, the probability of successfully identifying non-purple sweet potato is 85.04%. That is, the A / T type variation is a sufficient and necessary condition for the purple flesh of sweet potato. Further, the anthocyanin content of the flesh of 56 samples was detected, and it was found that the anthocyanin content of the dry powder of the flesh of 27 samples of A / T type was the lowest at 15.43 mg / 100 g, the highest at 230.82 mg / 100 g, and the average was 88.66 mg / 100 g. The anthocyanin content of the dry powder of the flesh of 29 samples of T / T type was the lowest at 0.39 mg / 100 g, the highest at 177.19 mg / 100 g, and the average was 31.23 mg / 100 g. That is, the anthocyanin content of the flesh of the A / T type sweet potato sample is significantly higher than that of the T / T type sample.
[0080] Table 1 KASP typing, flesh color and anthocyanin content (mg / 100 g dry weight) of 56 sweet potato germplasm resources
[0081]
[0082]
[0083]
[0084]
[0085] From the above examples, the present application provides a SNP marker related to the color and anthocyanin content of sweet potato tubers and its application, the SNP marker is located at position 25658800 of the 10a chromosome of sweet potato, and the base polymorphism is A / T. When the SNP genotype of the sample to be tested is A / T, the anthocyanin content of the tuber is high, and the color is purple; when the SNP genotype is T / T, the anthocyanin content of the tuber is low, and the probability of being non-purple is high. The detection method and kit provided by the present application can identify the phenotype of the natural population of sweet potato, and the efficiency of the developed SNP marker for identifying purple sweet potato reaches 100%, and the efficiency of identifying non-purple sweet potato reaches 85.04%. The present application can quickly and accurately detect the color and anthocyanin content of sweet potato tubers, has the advantages of simple operation and low cost, and can meet the needs of large-scale molecular marker assisted selection.
[0086] The above only describes the preferred embodiments of the present application, and it should be noted that for ordinary skilled persons in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. A SNP marker associated with sweet potato root color and anthocyanin content, characterized in that: The SNP marker is located at position 25658800 of chromosome 10a of sweet potato, and the base polymorphism is A / T.
2. The SNP marker according to claim 1, wherein The base polymorphism is A / T, and there are two genotypes: AT and TT; The AT genotype is a heterozygous type of the SNP site AT, and the sweet potato tuber flesh is purple and has a high anthocyanin content; The TT genotype is a homozygous type in which the SNP site is T, and 85.04% of the sweet potato tuber flesh is non-purple and has a low anthocyanin content.
3. A SNP-KASP marker comprising the SNP marker according to claim 1 or 2, characterized in that: The nucleotide sequence of the SNP-KASP marker is shown in SEQ ID NO.
1.
4. A primer set for detecting the SNP-KASP marker according to claim 3, characterized in that: The primer set includes a forward primer F1, a forward primer F2 and a reverse primer R; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; The nucleotide sequence of the forward primer F2 is shown in SEQ ID NO.3; The nucleotide sequence of the reverse primer R is shown in SEQ ID NO.
4.
5. A kit for detecting the SNP-KASP marker according to claim 3, characterized in that: The kit comprises the primer set according to claim 4.
6. A method for detecting the color or anthocyanin content of sweet potato tubers, characterized in that: The following steps are involved: The genomic DNA of the sweet potato to be tested is used as a template, and KASP PCR amplification is performed using the primer set of claim 4 or the kit of claim 5, and genotyping is performed using the amplification results.
7. The method according to claim 6, characterized in that The reaction system for the KASP PCR amplification is as follows: 0.8-1.2 μL DNA, 3-7 μL HiGeno 2×Probe Mix A, 0.1-0.2 μL mixed primers, and water to 10 μL. The preparation method of the mixed primer is as follows: first dissolve the forward primer F1, forward primer F2 and reverse primer R in water to 80-120 μM respectively, and then mix 10-14 μL of forward primer F1, 10-14 μL of forward primer F2, 25-35 μL of reverse primer and 40-50 μL of water to obtain the mixed primer.
8. The method according to claim 7, characterized in that The reaction procedure of the KASP PCR amplification was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing / extension at 55°C to 61°C for 40 s, 10 cycles; denaturation at 95°C for 20 s, annealing / extension at 55°C to 40 s, 30 to 34 cycles.
9. Use of the SNP-KASP marker according to claim 3, the primer set according to claim 4, the kit according to claim 5, or the method according to any one of claims 6 to 8 in detecting sweet potato varieties or sweet potato root tuber color or anthocyanin content.
10. A breeding method for increasing the anthocyanin content of sweet potatoes, characterized in that: The method comprises the following steps: performing genotype detection on a SNP marker located at the 25658800bp position of chromosome 10a in a sweet potato sample, and selecting a sweet potato sample with an A / T genotype for breeding.
Citation Information
Cited By
QTL fine positioning method based on homohexaploid sweet potatoes
CN121320610A
SNP molecular marker closely linked with purple leaf character of sweet potato and KASP primer
CN121496097A
SNP molecular marker and KASP primer closely linked to sweet potato purple leaf trait
CN121496097B