Medicine for reversing multidrug resistance of tumor

Abstract

The invention belongs to the technical field of medicine application, and particularly relates to a medicine for reversing tumor multidrug resistance. The AMPK signal channel serves as an energy sensing center, and the expression mode of the catalytic subunit PRKAA1 / 2 of the AMPK signal channel has dispute in TNBC. Previous researches show that the AMPK activity in primary breast cancer is generally reduced, and clinical data analysis shows that the AMPK expression of a patient with advanced TNBC is increased and is related to poor prognosis. The invention finds that the expression of PRKAA2 in primary TNBC tissue is reduced, but DOX treatment can induce the expression of PRKAA2, and the expression of PRKAA2 is obviously increased in drug-resistant TNBC cells and TBCSCs. Mechanism research shows that the dynamic expression regulation is derived from CTED2 dependent CBP / p300 mediated H3K27 acetylation modification. The result shows that the AMPK signal has space-time specificity in TNBC, and the function of the AMPK signal may depend on the tumor development stage and the cell subtype.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of drug application, and particularly relates to a drug for reversing tumor multidrug resistance. BACKGROUND

[0002] Breast cancer is a major threat to women's health, and its incidence and mortality rate are high worldwide. Triple-negative breast cancer (TNBC) accounts for about 20% of breast cancer cases due to its unique pathological characteristics. This type of cancer is not only known for its high invasiveness and poor prognosis, but also for its lack of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression, making endocrine therapy or targeted therapy based on these receptors ineffective. Chemotherapy is therefore the main treatment for TNBC. However, even though most patients initially respond well to chemotherapy, more than half of the cases eventually develop drug resistance, leading to tumor recurrence, metastasis, and even death, which undoubtedly poses a serious challenge to the medical community. Identifying the key regulatory factors and molecular mechanisms of TNBC chemotherapy resistance is of great significance for improving treatment outcomes.

[0003] In-depth research has found that the presence of tumor stem cells (CSCs), a special subpopulation of cells, may be one of the keys to unraveling the mystery of TNBC chemotherapy resistance. CSCs have the ability to self-renew and generate heterogeneity, and they exhibit natural resistance to DNA damage caused by chemotherapy drugs, even under strong therapeutic pressure. They can survive and continuously drive cancer cell proliferation and expansion, which is an important reason for the development of chemotherapy resistance in various malignant tumors, including TNBC. Studies have shown that the CSC or stem-like cell population in the TNBC microenvironment may be enriched during chemotherapy, and reducing the number of these cells can significantly improve the sensitivity of drug-resistant TNBC cells to first-line chemotherapy drugs such as doxorubicin (DOX), providing a potential path to overcome TNBC chemotherapy resistance. However, the specific molecular mechanisms of CSCs maintaining stemness still need further exploration.

[0004] In addition, AMP-activated protein kinase catalytic subunit alpha 2 (PRKAA2, also known as AMPKα2) as the core functional subunit of the energy sensor AMPK has also attracted the attention of scientists in this context. The role of the AMPK signaling pathway in tumors presents a dual nature: on the one hand, it can inhibit the development of tumors by depleting CSCs; on the other hand, there is evidence that activating AMPK can promote the survival of tumor cells. This means that the AMPK signaling pathway can play completely different roles in different environments, and how to precisely regulate the pathway to achieve the best anticancer effect, especially for such refractory cancers as TNBC, has become a problem worthy of in-depth discussion. With the continuous deepening of research, it is expected to uncover the complex mechanisms behind TNBC chemotherapy resistance and develop more effective treatment strategies to bring new hope for improving the quality of life and cure rate of patients. SUMMARY

[0005] The present application is directed to the above problems existing in the prior art, a drug for reversing tumor multidrug resistance is constructed, the expression of PRKAA2 can be inhibited by using exogenous LPEL polypeptide to destroy the CITED2 / CBP / p300 complex, the stemness characteristics of TBCSCs are weakened, and the sensitivity of adriamycin-resistant TBCSCs to adriamycin treatment is enhanced.

[0006] The object of the present application can be achieved by the following technical solutions: A drug for reversing tumor multidrug resistance, the drug for reversing tumor multidrug resistance comprising an LPEL polypeptide with a sequence as shown in SEQ ID NO: 1 and an anticancer drug.

[0007] In the above-mentioned drug for reversing tumor multidrug resistance, the LPEL polypeptide is connected with a penetrating sequence as shown in SEQ ID NO: 2, and the penetrating sequence is connected with a fluorescent group.

[0008] In the above-mentioned drug for reversing tumor multidrug resistance, the mass ratio of the LPEL polypeptide and the anticancer drug is 1: (5-15).

[0009] In the above-mentioned drug for reversing tumor multidrug resistance, the tumor is PRKAA2-high-expressing drug-resistant triple-negative breast cancer.

[0010] In the above-mentioned drug for reversing tumor multidrug resistance, the LPEL polypeptide inhibits the activity of PRKAA2.

[0011] As a preferred, the fluorescent group comprises at least one of FITC, FAM, AMC, and Cy series.

[0012] In the drug for reversing tumor multidrug resistance, the LPEL polypeptide effectively inhibits the expression of PRKAA2 by targeting and destroying CITED2 / CBP / p300, and overcomes the chemotherapeutic drug resistance of triple-negative breast cancer. The CITED2 activates the transcription of PRKAA2 by promoting the formation of a CITED2 / CBP / p300 complex and catalyzing the acetylation modification of H3K27 in the promoter region of PRKAA2.

[0013] In the drug for reversing tumor multidrug resistance, the anticancer drug comprises doxorubicin.

[0014] In the drug for reversing tumor multidrug resistance, the drug for reversing tumor multidrug resistance further comprises a carrier and / or an auxiliary agent.

[0015] Preferably, the carrier is at least one of lactose, starch, gelatin, sodium carboxymethyl cellulose, methyl cellulose, polyvinyl pyrrolidone and water.

[0016] Preferably, the auxiliary agent is at least one of a disintegrating agent, a lubricant and a solubilizing agent.

[0017] Further preferably, the disintegrating agent is microcrystalline cellulose, the lubricant is at least one of talc, colloidal silica, glyceryl stearate and calcium stearate, and the solubilizing agent is at least one of methanesulfonic acid, fumaric acid, mannitol and sorbitan monolaurate.

[0018] Further preferably, the dosage form of the drug is at least one of a tablet, a granule, a capsule, an oral liquid and an injection.

[0019] The application further provides a use of the drug for reversing tumor multidrug resistance in treating triple-negative breast cancer.

[0020] In the use, the LPEL polypeptide is used at a concentration of 3-8 mg / kg of body weight, and the anticancer drug is used at a concentration of 35-45 mg / kg of body weight.

[0021] Compared with the prior art, the application has the following beneficial effects: 1.AMPK signaling pathway as the central energy sensor, the expression pattern of its catalytic subunit PRKAA1 / 2 is controversial in TNBC. Previous studies showed that AMPK activity was generally decreased in primary breast cancer, while clinical data analysis showed that AMPK expression was increased in advanced TNBC patients and was associated with poor prognosis. The present application found that PRKAA2 expression was down-regulated in primary TNBC tissue, but DOX treatment could induce its expression, and was significantly increased in drug-resistant TNBC cells and TBCSCs. Mechanism studies showed that this dynamic expression regulation was due to CITED2-dependent CBP / p300-mediated H3K27 acetylation modification. This suggests that the AMPK signal has spatiotemporal specificity in TNBC, and its function may depend on the stage of tumor development and cell subtype.

[0022] 2.AMPK and PRKAA2 in tumor biological effects show significant complexity. On the one hand, UBE2O-mediated PRKAA2 degradation can promote breast cancer, while AMP analogs activated PRKAA2 can further increase E2F1-induced apoptosis of breast cancer cells; on the other hand, PRKAA2 activates autophagy by phosphorylating ULK1 to promote tumor cell survival under stress conditions, and is essential for TNBC chemotherapy resistance and lung metastasis. The present application further reveals that the up-regulation of PRKAA2 in TBCSCs promotes chemotherapy resistance by maintaining stemness characteristics and reducing drug sensitivity, suggesting that its pro-tumor effect is particularly prominent in tumor stem cells. This functional diversity may be due to the dynamic changes in tumor microenvironment differences, cell stress state and epigenetic regulatory networks.

[0023] 3.CBP / p300 as a classic histone acetyltransferase, its function often depends on the target recruitment mediated by cofactors. The present application found that CITED2 binds to p300 through the C-terminal LPEL domain, and then anchors the CBP / p300 complex to the PRKAA2 promoter region, driving H3K27 acetylation and gene transcription activation. Based on this, the exogenous LPEL peptide designed by the present application can competitively destroy the CITED2 / CBP / p300 interaction, significantly inhibit the stemness of TBCSCs and increase the efficacy of DOX. Notably, LPEL peptide combined with DOX showed a synergistic anti-tumor effect, which provides a potential therapeutic means for overcoming TNBC chemotherapy resistance in clinic. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1Figure 2 is a series of graphs showing PRKAA2 is highly expressed in DOX-resistant TNBC and TBCSCs; (A-B) PRKAA2 expression was elevated in doxorubicin-insensitive triple-negative breast cancer patient tissues as analyzed by Western blotting (A) and immunohistochemical staining (B). *p<0.05. (C) TCGA database data showed that PRKAA2 expression was significantly increased in insensitive patients compared with DOX-sensitive patients. (D) PRKAA2 levels were elevated in DOX-resistant 231R cells compared with parental MDA-MB-231 cells. *p<0.05, **p<0.01. (E) DOX treatment promoted PRKAA2 expression. *p<0.05. (F) PRKAA2 levels were detected by immunohistochemical staining in triple-negative breast cancer patient tissues after doxorubicin treatment. (G-H) PRKAA2 levels were elevated in 231CSCs (G) and P-CSCs (H). *p<0.05, **p<0.01. (I) PRKAA2 (green) and ALDH1A1 (red) co-expression was detected by immunofluorescence staining in MDA-MB-231 cell lines or TNBC patient-derived adherent cells and breast cancer stem cell microspheres.

[0026] Figure 2 Figure 3 is a series of graphs showing PRKAA2 promotes TBCSCs stemness characteristics; (A) Knockdown of PRKAA2 inhibited the cell proliferation of 231CSCs and P-CSCs. *p<0.05, **p<0.01. (B) Knockdown of PRKAA2 impaired the colony-forming ability of 231CSCs and P-CSCs. **p<0.01, ***p<0.001. (C) Silencing of PRKAA2 reduced the microsphere-forming ability of 231CSCs and P-CSCs. *p<0.05, **p<0.01. (D) Overexpression of PRKAA2 promoted the cell proliferation of 231CSCs and P-CSCs. *p<0.05. (E) Overexpression of PRKAA2 enhanced the colony-forming ability of 231CSCs and P-CSCs. *p<0.05, ***p<0.001. (F) Overexpression of PRKAA2 improved the microsphere-forming ability of 231CSCs and P-CSCs. *p<0.05. (G) Heterologous expression of PRKAA2 restored the levels of stem cell markers such as ALDH1A1 and NANOG. (H) Silencing of PRKAA2 inhibited the growth of xenograft tumors. (I) Silencing of PRKAA2 significantly reduced the volume of xenograft tumors. **p<0.01. (J) Silencing of PRKAA2 significantly reduced the weight of xenograft tumors. **p<0.01. (K) PRKAA2 knockdown led to a decrease in the tumorigenic frequency of xenograft tumors.

[0027] Figure 3Figures show that PRKAA2 deficiency enhances the sensitivity of TBCSCs to DOX. (A) Knockdown of PRKAA2 sensitizes DOX-resistant 231R cells to DOX treatment. **p<0.01. (B) Overexpression of PRKAA2 induces DOX resistance in MDA-MB-231 cells. **p<0.01. (C) Knockdown of PRKAA2 significantly reduces the half-maximal inhibitory concentration (IC50) of DOX treatment in 231CSCs and P-CSCs. *p<0.05. (D) Silencing of PRKAA2 reduces the frequency of xenograft tumor formation. (E) Silencing of PRKAA2 significantly inhibits the growth of xenograft tumors. **p<0.01. (F) Silencing of PRKAA2 significantly reduces xenograft tumor weight. ***p<0.001.

[0028] Figure 4 Figure 1: H3K27 acetylation drives high PRKAA2 expression in TBCSCs. (A) Stratified analysis using the UCSC genome database revealed enrichment of H3K27 acetylation in the PRKAA2 promoter region. (B-D) H3K27 acetylation levels in the PRKAA2 promoter region were significantly elevated in 231CSCs (B), P-CSCs (C), and 231R cells (D). *p<0.05, **p<0.01. (E) Treatment with the histone acetyltransferase inhibitor PU139 significantly reduced H3K27ac modification levels in the PRKAA2 promoter region. **p<0.01, ***p<0.001. (F-G) PU139 treatment reduced PRKAA2 mRNA expression (F) and protein expression (G). *p<0.05, **p<0.01. (H) Treatment with the histone deacetylase inhibitor trichostatin A combined with nicotinamide increases H3K27ac levels in the PRKAA2 promoter. T+N: Trichostatin A combined with nicotinamide treatment. *p < 0.05. (IJ) Trichostatin A combined with nicotinamide treatment increases PRKAA2 mRNA expression (I) and protein expression (J). *p < 0.05, ***p < 0.001.

[0029] Figure 5Figure 6. CBP / p300 is a key player in PRKAA2 epigenetic activation. (A-C) After 231 CSCs were infected with lentivirus carrying the indicated shRNA sequences for 48 hours: H3K27 acetylation level at PRKAA2 promoter region was detected by chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR) (A); PRKAA2 mRNA expression level was detected by real-time quantitative reverse transcription PCR (qRT-PCR) (B); PRKAA2 protein expression level was detected by Western blot (C). *p<0.05, **p<0.01. (D) Chromatin immunoprecipitation assay showed that PRKAA2 promoter region had higher enrichment level of CBP / p300 (but not GCN5, PCAF or Tip60) in 231 CSCs. *p<0.05. (E-G) Adding CBP / p300 inhibitor A-485 significantly reduced H3K27ac level (E), mRNA expression level (F) and protein expression level (G) at PRKAA2 promoter region. *p<0.05, **p<0.01. (H-J) Overexpression of CBP / p300 significantly increased H3K27ac level (H), mRNA expression level (I) and protein expression level (J) at PRKAA2 promoter region. *p<0.05, **p<0.01, ***p<0.001.

[0030] Figure 6Figure 6. CITED2 is a necessary bridge for CBP / p300-mediated PRKAA2 epigenetic activation. (A-C) CITED2 expression was significantly increased in DOX-resistant 231R cells (A), 231 CSCs (B), and P-CSCs (C). *p<0.05, **p<0.01. (D) TCGA database data showed that CITED2 expression was significantly positively correlated with PRKAA2 expression. (E) Silencing CITED2 reduced the level of H3K27ac modification in the PRKAA2 promoter region. **p<0.01. (F) Overexpression of CITED2 promoted H3K27ac modification in the PRKAA2 promoter region. *p<0.05. (G) Chromatin immunoprecipitation showed that CITED2 enrichment in the PRKAA2 promoter region was enhanced in 231 CSCs. *p<0.05. (H) Immunoprecipitation verified the existence of CITED2-CBP / p300 interaction in 231 CSCs. (I) The CITED2-CBP / p300 interaction system was detected in MDA-MB-231 parental cells and 231 CSCs. (J) Knocking down CITED2 disrupted the formation of the CITED2 / CBP / p300 protein complex. (K-L) Overexpression of p300 or CBP failed to reverse the decrease in the level of H3K27ac (K) and PRKAA2 expression (L) caused by CITED2 knockdown. **p<0.01, ***p<0.001.

[0031] Figure 7 Figure 7. The C-terminal LPEL domain of CITED2 is a key component of the complex. (A) Schematic diagram of the wild-type and truncated CITED2 protein structures. (B) Truncated bodies 3 and 4 can still form the CITED2 / CBP / p300 complex. (C) LPEL domain deletion type CITED2 cannot interact with CBP / p300. (D-F) LPEL domain deletion makes CITED2 lose the function of promoting H3K27ac modification (D), mRNA expression (E), and protein expression (F) in the PRKAA2 promoter region. *p<0.05, **p<0.01, ***p<0.001. (G) Schematic diagram of the design of FITC-labeled LPEL wild-type polypeptide (LPEL-WT) and mutant polypeptide (LPEL-Mut). (H) LPEL-WT and LPEL-Mut can both localize to the nucleus. (I) LPEL-WT competitively inhibits the formation of the CITED2 / CBP / p300 complex. (J-L) LPEL-WT polypeptide significantly reduces the level of H3K27ac (J), PRKAA2 mRNA expression (K), and PRKAA2 protein expression (L) in the PRKAA2 promoter region. *p<0.05, **p<0.01, ***p<0.001.

[0032] Figure 8 Figure 7. Exogenous LPEL peptide inhibits TBCSCs stemness and enhances DOX efficacy. (A) LPEL-WT polypeptide significantly inhibited 231 CSCs and P-CSCs spheroid formation ability. *p<0.05, **p<0.01. (B) LPEL-WT polypeptide effectively inhibited 231 CSCs and P-CSCs cell proliferation. *p<0.05. (C) LPEL-WT polypeptide reduced stem cell marker ALDH1A1 and NANOG expression levels. (D-E) Addition of LPEL-WT polypeptide significantly increased 231 CSCs, P-CSCs (D) and doxorubicin-resistant 231R cells (E) sensitivity to DOX. (F-H) In vivo tumorigenicity experiment: 231 CSCs were inoculated into the right axillary of NOD-SCID mice, and after 3 weeks of combined designated drug treatment, the photographs of the transplanted tumors were separated (F); transplanted tumor volume quantitative analysis (G); transplanted tumor weight determination (H).

[0033] Figure 9 Figure 8. PRKAA2 expression in DOX-sensitive TNBC tissues. (A-B) PRKAA2 expression was significantly down-regulated in DOX-sensitive TNBC patient tissues, as shown by Western blotting (A) and immunohistochemical staining (B). ***p<0.001.

[0034] Figure 10 Figure 9. PRKAA2 deletion reverses DOX treatment-induced TBCSCs enrichment. (A) DOX treatment enhanced the tumor spheroid formation ability of 231 CSCs, while knocking down PRKAA2 reversed this effect. *p<0.05. (B) Knocking down PRKAA2 inhibited DOX-induced up-regulation of stemness markers NANOG and ALDH1A1 expression.

[0035] Figure 11 Figure 10. CBP / p300 expression in DOX-resistant 231R cells and 231 CSCs compared to that in parental MDA-MB-231 cells. (A) Western blotting was used to detect CBP / p300 expression levels in 231R drug-resistant cells and MDA-MB-231 parental cells. (B) Differences in CBP / p300 expression between 231 CSC stem cell subgroups and MDA-MB-231 parental cells were detected. (C) Immunofluorescence staining was used to analyze CBP / p300 subcellular localization characteristics in 231R drug-resistant cells and MDA-MB-231 parental cells. DETAILED DESCRIPTION

[0036] The technical solutions of the present application are further described and explained below in conjunction with specific embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are only used to illustrate the present application and are not used to limit the scope of the present application. Moreover, the drawings used herein are only used to better illustrate the disclosed content of the present application and do not limit the scope of protection. Furthermore, it should be understood that after reading the content of the present application, those skilled in the art can make various modifications or changes to the present application, and these equivalent forms also fall within the scope of the appended claims of the present application.

[0037] The LPEL peptide comprises three parts, the N-terminal of which is the LPEL amino acid sequence, and the C-terminal of the LPEL amino acid sequence is connected with a penetrating sequence of 8 arginine sequences (R8) to facilitate the penetration of the LPEL peptide through the cell membrane and nuclear membrane. A FITC group is labeled at the C-terminal of the polypeptide for tracing.

[0038] The LPEL amino acid sequence is shown in SEQ ID NO: 1: IEMGLDRIKELPELWLGQ; The penetrating amino acid sequence is shown in SEQ ID NO: 1: RRRRRRRR. Embodiments

[0039] S1, clinical sample collection and cancer stem cell separation: with the approval of the Ethics Committee of the First Affiliated Hospital of Ningbo University (Approval No. KY20221201), 4 cases of adriamycin (DOX) sensitive and 4 cases of drug-resistant TNBC patient cancer tissue samples were collected. Isolation of TNBC stem cells (TBCSCs): after the TNBC tissue removed by surgery was mechanically broken into 1 mm³ tissue blocks, it was placed in DMEM / F12 culture medium (Gibco) containing 100 U / mL type IV collagenase, 150 U / mL hyaluronidase (Sigma-Aldrich), 100 U / mL penicillin and 100 μg / mL streptomycin (Gibco) for 18 hours of digestion. The cell precipitate was collected by centrifugation, and after 10 minutes of trypsin (Gibco) digestion, a single cell suspension was obtained by sieving. The cells were cultured in stem cell culture medium (DMEM / F12 culture medium containing 20 ng / mL human recombinant EGF, 20 ng / mL basic fibroblast growth factor (Procell), B-27 additive (Gibco) and insulin-transferrin-selenium complex (ITX-G, Gibco)), and the medium was replaced every 2 days.

[0040] S2, Cell culture and MDA-MB-231 stem cell isolation: MCF-10A normal mammary epithelial cells and MDA-MB-231 TNBC cells were purchased from the Chinese Academy of Sciences Cell Bank. MDA-MB-231 cells were routinely cultured in DMEM medium (Invitrogen) containing 10% fetal bovine serum (FBS), 50 U / mL penicillin and 50 μg / mL streptomycin (Invitrogen). The same culture system as the patient-derived TBCSCs was used for stem cell isolation. All cells were placed in a 37°C, 5% CO2 incubator.

[0041] S3, DOX-resistant MDA-MB-231 cell construction: The concentration gradient method was used to construct the drug-resistant strain: MDA-MB-231 cells were continuously exposed to DOX at a gradient concentration, and the resistance index (RI) was detected every month until it reached 5 times that of the parent cells, i.e., DOX-resistant MDA-MB-231 cells (231R) were obtained. The culture medium was maintained at 0.2 μM DOX, and the RI was retested every month to confirm the drug resistance.

[0042] RNA extraction and real-time quantitative PCR: Total RNA was extracted using RIZOL reagent (Invitrogen), and the NanoDrop One spectrophotometer was used for quantification. 1 μg of RNA was used to synthesize cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qRT-PCR was performed using the Power SYBR Green premix reagent, with β-actin as the internal reference, and the 2-ΔΔCt method was used to calculate the relative expression of genes. The primer sequences are as follows: PRKAA2-F: 5’- ATGCCAAGATAGCCGATTTCG -3’; PRKAA2-R: 5’- TGCTGCATAATTTGGAGATCCG -3’; β-actin-F: 5’- CCTGGACTTCGAGCAAGAGATGG -3’; β-actin-R: 5’- CAGGAAGGAAGGCTGGAAGAGTG -3’; S4, Protein extraction, co-immunoprecipitation (Co-IP) and Western blot: Cells were lysed with NP-40 lysis buffer (containing protease inhibitors, Beyotime), and the protein concentration was quantified by the BCA method (Beyotime).

[0043] Co-IP experiment: 1 mg protein lysate was pre-cleared with Protein A / G magnetic beads (Beyotime) and normal IgG (Proteintech) for 2 hours, and centrifuged to remove non-specific binding. Take 10% of the lysate as the input control, and the remaining sample was incubated with CITED2 antibody (Abcam) or Flag antibody (Proteintech) at 4°C overnight. After washing the magnetic beads, resuspend in SDS loading buffer, boil and perform Western blot.

[0044] Western blot: equal amount of protein was transferred to PVDF membrane (Merck Millipore) by SDS-PAGE electrophoresis, and blocked with 5% skim milk for 1 hour. The primary antibody (β-actin, PRKAA2, Flag, CITED2, CBP, p300, NANOG, ALDH1A1) was incubated at 4°C overnight, and then washed with TBST and incubated with HRP-labeled secondary antibody (ZSGB-BIO) at room temperature for 1 hour. After ECL development (NCM Biotech), the gray value of the band was quantified by ImageJ software.

[0045] S5, Immunohistochemistry: tumor tissue was fixed with 4% paraformaldehyde for 24 hours, and paraffin-embedded sections were cut. After permeabilization with PBST and inactivation of endogenous peroxidase with 0.3% H2O2, 5% goat serum was blocked, and PRKAA2 or CITED2 primary antibody was incubated at 4°C overnight. After incubation with biotin-labeled secondary antibody, DAB was developed (Proteintech), and hematoxylin was counterstained, gradient ethanol dehydrated, and xylene transparent. Images were collected by Leica DMiL LED microscope.

[0046] S6, Lentivirus infection and gene silencing: shRNA lentivirus targeting PRKAA2, CITED2 and control sequence was purchased from Shanghai Hanheng Biotechnology (shRNA sequence see Table S1). Cells were seeded in 6 cm culture dishes, and 4 μL of lentivirus was added after adhesion. Cells were collected 48 hours after infection for subsequent experiments. Western blot was used to verify the knockout efficiency.

[0047] Table 1: shRNA sequences used

[0048] S7, Chromatin immunoprecipitation (ChIP)-qPCR: 1% formaldehyde cross-linking MDA-MB-231, 231R, 231 CSCs or treatment group cells, and after ultrasonic crushing of chromatin, incubate with H3K27ac antibody or IgG control antibody (both coupled with magnetic beads) at 4°C overnight. After washing, DNA was extracted, and qPCR was used to detect the enrichment degree of PRKAA2 promoter region.

[0049] S8, CCK-8 cell proliferation assay: cells infected with control or PRKAA2 shRNA were seeded in 96-well plates, and CCK-8 reagent (Dojindo) was added at day 0, 2, 4, respectively. The absorbance was measured at 450 nm wavelength.

[0050] S9, Soft agar colony formation assay: 35 mm culture dishes were coated with 1% low-melt agarose (Invitrogen) mixed with stem cell medium 1:1. 5x103cells were mixed with 0.6% agarose and plated on top. After two weeks of culture, the number of colonies >50 pm was counted after 0.1% crystal violet staining.

[0051] S10, Tumor sphere formation assay: 1x103cells were seeded in ultra-low attachment 6-well plates (Corning) and cultured in stem cell medium for two weeks. The number of tumor spheres >50 pm in diameter was counted and the diameter was measured.

[0052] S11, LPEL peptide internalization assay: wild-type and mutant FITC-LPEL peptides as shown in SEQ ID NO: 1 (purity >98%, synthesized by Genscript) were incubated with 231CSC cells for 6 hours. After Hoechst 33342 staining of the nucleus, 4% paraformaldehyde fixation, and Leica DMiL LED microscope observation, the internalization efficiency was observed.

[0053] S12, In vivo animal experiments: The experimental protocol was approved by the Ningbo University Experimental Animal Ethics Committee (Approval No. 12261). Four to five-week-old female NOD-SCID mice (GemPharmatech) were adapted for one week in a SPF environment, and then injected with lentivirus-infected cells containing 50 mΐ of Matrigel (Corning) into the mammary fat pad. The tumor volume was measured weekly using a vernier caliper (0.5x length x width2), and the mice were sacrificed after 3 weeks, the tumor weight was measured, and subsequent analysis was performed.

[0054] S13, Statistical analysis: All experiments were independently repeated >3 times, and the data were expressed as mean ± standard deviation. SPSS 19.0 software was used for Student's t-test (two-group comparison) or ANOVA (multiple-group comparison and tumor growth curve analysis), and P<0.05 was considered statistically significant.

[0055] LPEL peptide cell experiments: Breast cancer stem cells derived from the breast cancer MDA-MB-231 cell line (231CSC cells) and patient-derived breast cancer stem cells (P-CSC cells) were plated on glass slides. 500 nM of LPEL peptide was added and incubated for 6 hours. Fluorescence microscopy was used to observe green fluorescence to determine that LPEL peptide can penetrate into the nucleus.

[0056] LPEL peptide (500 uM) was combined with different concentrations of doxorubicin (0, 0.05, 0.1, 0.2, 0.4 μM) to treat 231 CSC cells and P-CSC cells, and it was found that LPEL peptide could significantly enhance the killing effect of doxorubicin on 231 CSC cells and P-CSC cells.

[0057] LPEL peptide (500 uM) was combined with different concentrations of doxorubicin (0, 0.05, 0.1, 0.2, 0.4, 0.6 μM) to treat doxorubicin-resistant MDA-MB-231 cell-derived cells (231R cells), and it was found that LPEL peptide could significantly enhance the killing effect of doxorubicin on 231R cells.

[0058] LPEL peptide animal experiment: 2x10 6 NOD-SCID mice were inoculated with 231 CSC cells in the mammary fat pad. After 1 week of cell inoculation, LPEL peptide (5 mg / kg body weight) was injected in situ at the tumor implantation site every 2 days, and doxorubicin treatment (40 mg / kg body weight) was given by intraperitoneal injection at the same time. After 2 weeks of drug treatment, the mice were sacrificed, and the tumor volume and weight were measured.

[0059] Results analysis: 1. PRKAA2 is highly expressed in DOX-resistant TNBC and TBCSCs: To clarify the clinical significance of PRKAA2 in TNBC chemotherapy resistance, the correlation between its expression and DOX treatment response was first investigated. TNBC patients were divided into DOX-sensitive group (DOX-S, n=4) and DOX-insensitive group (DOX-I, n=4) according to the response to chemotherapy. Immunohistochemical results showed that PRKAA2 expression in the DOX-sensitive group was significantly lower than that in the adjacent tissues, while the DOX-insensitive group showed the opposite trend (Fig. 1A-B). Figure 9 A-B, Figure 1 A-B). TCGA database analysis further confirmed that PRKAA2 expression in DOX-insensitive patients was significantly higher than that in the sensitive group (Fig. 1C). Similar phenomena were verified in DOX-resistant MDA-MB-231 cells (231R): compared with parental cells and normal breast epithelial MCF-10A, 231R cells had significantly upregulated PRKAA2 expression (Fig. 1D). Notably, DOX treatment induced PRKAA2 expression (Fig. 1E-F). Figure 1 Figure 1 D). Notably, DOX treatment induced PRKAA2 expression (Fig. 1E-F). Figure 1

[0060] ​​Given that cancer stem cells (CSCs) are a key source of chemotherapy resistance and recurrence, this study further analyzed the expression characteristics of PRKAA2 in TBCSCs. By establishing two stem cell models, one derived from MDA-MB-231 (231CSCs) and the other derived from TNBC patient tissue (P-CSCs), it was found that compared with the parent cells cultured on the wall, the expression of PRKAA2 in the suspended spheres of 231CSCs was significantly increased ( Figure 1 G); Similar results were reproduced in P-CSCs ( Figure 1 H). Immunofluorescence staining confirmed the enhanced expression of PRKAA2 in 231CSCs ( Figure 1 I), and colocalized with the stemness marker ALDH1A1 ( Figure 1 I). The above results showed that PRKAA2 was specifically and highly expressed in DOX-resistant TNBC and TBCSCs.

[0061] 2. PRKAA2 promotes TBCSCs stemness: To understand the regulatory role of PRKAA2 on TBCSCs stemness, this study knocked down its expression by shRNA. The results showed that PRKAA2 silencing significantly inhibited the cell proliferation of 231CSCs and P-CSCs ( Figure 2 AB) and tumor sphere-forming ability ( Figure 2 C) and reduced the diameter of tumor spheres ( Figure 2 C); while PRKAA2 overexpression produced the opposite effect ( Figure 2 DF). Western blot analysis showed that PRKAA2 knockdown could downregulate the levels of ALDH1A1 and NANOG proteins in 231CSCs ( Figure 2 G), and this effect could be reversed by PRKAA2 overexpression plasmid ( Figure 2 G).

[0062] In vivo experiments further verified the above findings, and the volume and weight of transplanted tumors formed by 231CSCs with PRKAA2 knockdown were significantly reduced ( Figure 2 HJ). Limiting dilution experiments showed that the tumor formation rate of PRKAA2-deficient cells was significantly reduced under low inoculation conditions ( Figure 2 K). These data collectively confirm that PRKAA2 is a key factor in maintaining the stemness characteristics of TBCSCs.

[0063] 3. PRKAA2 deficiency enhances the sensitivity of TBCSCs to DOX: To explore the effect of PRKAA2 on the chemotherapy sensitivity of TBCSCs, this study found through functional restoration experiments that PRKAA2 silencing can restore the sensitivity of 231R cells to DOX ( Figure 3 A), while its overexpression confers DOX resistance to parental MDA-MB-231 cells ( Figure 3B). DOX treatment can significantly enhance the tumor sphere formation ability and stemness marker expression of TBCSCs ( Figure 10 AB), while PRKAA2 knockdown reversed this effect ( Figure 10 AB). Drug sensitivity experiments showed that the IC50 values ​​of PRKAA2-deficient 231CSCs and P-CSCs to DOX were significantly reduced ( Figure 3 C).

[0064] Further in vivo experiments found that under DOX treatment, wild-type 231CSCs successfully formed tumors in 6 nude mice ( Figure 3 D), while only 3 PRKAA2-deficient cells formed tumors ( Figure 3 E). PRKAA2 knockout significantly reduced the volume and weight of transplanted tumors ( Figure 3 F). The above results indicate that PRKAA2 deficiency can significantly enhance the sensitivity of TBCSCs to DOX treatment.

[0065] 4. H3K27 acetylation drives high expression of PRKAA2 in TBCSCs: To elucidate the molecular mechanism of PRKAA2 upregulation in TBCSCs, this study focused on epigenetic regulation. UCSC database analysis showed that H3K27 acetylation (H3K27ac) was enriched in the PRKAA2 promoter region ( Figure 4 A). ChIP-qPCR experiments confirmed that the H3K27ac level in the PRKAA2 promoter region in TBCSCs was significantly increased compared with that in adherent non-stem cells ( Figure 4 BC); Similar phenomena were also observed in DOX-resistant 231R cells ( Figure 4 D). Treatment with the broad-spectrum HAT inhibitor PU139 significantly reduced H3K27ac levels in TBCSCs ( Figure 4 E), and inhibited PRKAA2 expression ( Figure 4 FG). In contrast, treatment with HDAC inhibitors TSA and NAM enhanced H3K27 acetylation ( Figure 4 HI), thereby upregulating PRKAA2 expression ( Figure 4 J). These results suggest that H3K27 acetylation drives abnormally high expression of PRKAA2 in TBCSCs through an epigenetic mechanism.

[0066] 5. CBP / p300-mediated H3K27 acetylation in the PRKAA2 promoter is dependent on CITED2: To identify histone acetyltransferases (HATs) that regulate H3K27 acetylation, this study used shRNA screening and found that knockdown of CBP / p300 (but not GCN5, PCAF, or Tip60) significantly reduced H3K27ac levels in the PRKAA2 promoter and PRKAA2 expression in TBCSCs (Figure 5 A-C). ChIP-qPCR confirmed CBP / p300 preferentially enriched at PRKAA2 promoter region in 231 CSCs ( Figure 5 D). CBP / p300 inhibitor A-485 treatment mimicked knockdown effect ( Figure 5 E-G), while overexpression of CBP / p300 enhanced H3K27 acetylation and PRKAA2 expression ( Figure 5 H-J). These results indicated that CBP / p300 was a key player in PRKAA2 epigenetic activation.

[0067] As Figure 11 shown, CBP / p300 protein level did not differ significantly between drug-resistant and sensitive TNBCs, but its acetylation activity was specifically enhanced in drug-resistant cells. Bioinformatics analysis suggested that CBP / p300 co-factor CITED2 might be involved in this regulation. Experiments confirmed that CITED2 was significantly upregulated in drug-resistant TNBCs and TBCSCs ( Figure 6 A-C), and positively correlated with PRKAA2 ( Figure 6 D). Knockdown of CITED2 inhibited H3K27 acetylation at the PRKAA2 promoter region ( Figure 6 E), while overexpression enhanced this modification ( Figure 6 F). ChIP-qPCR showed that CITED2 was specifically enriched at the PRKAA2 promoter region in drug-resistant cells ( Figure 6 G). Co-immunoprecipitation confirmed the presence of CITED2 / CBP / p300 complex in 231 CSCs ( Figure 6 H), while this complex was almost absent in parental cells ( Figure 6 I). CITED2 knockout disrupted the promoter localization of CBP / p300 ( Figure 6 J), and overexpression of CBP / p300 could not rescue the H3K27 acetylation and PRKAA2 expression in CITED2-deficient cells ( Figure 6 K-L). These data revealed that CITED2 was a necessary bridge for CBP / p300-mediated PRKAA2 epigenetic activation.

[0068] 6. The C-terminal LPEL domain of CITED2 is critical for complex assembly: Screening of truncations revealed that amino acids 223-250 of CITED2 (containing the LPEL motif) were critical for CBP / p300 binding ( Figure 7 A-B). Construction of LPEL deletion mutant (CITED2-ALPEL) confirmed that deletion of this domain completely disrupted complex formation ( Figure 7 C), leading to decreased H3K27 acetylation ( Figure 7 D) and inhibited PRKAA2 expressionFigure 7 E-F). We further designed two FITC-labeled polypeptides (WT-LPEL and Mut-LPEL, Figure 7 G), and linked 8 arginines at the C-terminus of these two polypeptides to facilitate the polypeptides to penetrate the cell membrane and enter the nucleus. We found that WT-LPEL could competitively replace endogenous CITED2 (H) Figure 7 I), significantly inhibit H3K27 acetylation in the PRKAA2 promoter region (J) and its expression (K-L), while Mut-LPEL had no such effect. Figure 7 J) and its expression (K-L), while Mut-LPEL had no such effect. Figure 7 K-L), while Mut-LPEL had no such effect.

[0069] 7. Exogenous LPEL peptide inhibits TBCSCs stemness and enhances DOX efficacy: WT-LPEL treatment can significantly inhibit the tumor sphere-forming ability of 231CSCs and P-CSCs (A), reduce cell proliferation rate and stemness marker expression (B-C). Drug sensitivity experiments showed that WT-LPEL reduced the IC50 value of TBCSCs and drug-resistant 231R cells to DOX by 2.7-3.5 times (D-E). In vivo experiments further confirmed that WT-LPEL combined with DOX treatment can significantly inhibit the growth of transplanted tumors (volume reduced by 68.3%, weight reduced by 71.5%), and the effect is significantly better than that of single drug group (F-H). This effect is sequence-specific, and there is no significant change in Mut-LPEL treatment group. Figure 8 A), reduce cell proliferation rate and stemness marker expression (B-C). Drug sensitivity experiments showed that WT-LPEL reduced the IC50 value of TBCSCs and drug-resistant 231R cells to DOX by 2.7-3.5 times (D-E). In vivo experiments further confirmed that WT-LPEL combined with DOX treatment can significantly inhibit the growth of transplanted tumors (volume reduced by 68.3%, weight reduced by 71.5%), and the effect is significantly better than that of single drug group (F-H). This effect is sequence-specific, and there is no significant change in Mut-LPEL treatment group. Figure 8 B-C). Drug sensitivity experiments showed that WT-LPEL reduced the IC50 value of TBCSCs and drug-resistant 231R cells to DOX by 2.7-3.5 times (D-E). In vivo experiments further confirmed that WT-LPEL combined with DOX treatment can significantly inhibit the growth of transplanted tumors (volume reduced by 68.3%, weight reduced by 71.5%), and the effect is significantly better than that of single drug group (F-H). This effect is sequence-specific, and there is no significant change in Mut-LPEL treatment group. Figure 8 D-E). In vivo experiments further confirmed that WT-LPEL combined with DOX treatment can significantly inhibit the growth of transplanted tumors (volume reduced by 68.3%, weight reduced by 71.5%), and the effect is significantly better than that of single drug group (F-H). This effect is sequence-specific, and there is no significant change in Mut-LPEL treatment group. Figure 8 F-H). This effect is sequence-specific, and there is no significant change in Mut-LPEL treatment group.

[0070] The present application found that the abnormally high expression of PRKAA2 in TNBC stem cells (TBCSCs) mediates doxorubicin (DOX) resistance by enhancing stemness characteristics, and its molecular mechanism depends on CITED2 / CBP / p300 complex-driven H3K27 acetylation in the PRKAA2 promoter region. Exogenous LPEL peptide can effectively inhibit TBCSCs stemness and reverse chemotherapy resistance by disrupting the complex, providing a new strategy for TNBC treatment.

[0071] The expression pattern of catalytic subunit PRKAA1 / 2 of AMPK signaling pathway, as the central of energy sensing, is controversial in TNBC. Previous studies showed that AMPK activity was generally decreased in primary breast cancer, while clinical data analysis showed that AMPK expression was increased in advanced TNBC patients and was associated with poor prognosis. The present application found that the expression of PRKAA2 was down-regulated in primary TNBC tissue, but was induced by DOX treatment, and was significantly increased in drug-resistant TNBC cells and TBCSCs. Mechanism research showed that this dynamic expression regulation was derived from CITED2-dependent CBP / p300-mediated H3K27 acetylation modification. This suggests that the AMPK signal has spatiotemporal specificity in TNBC, and its function may depend on the stage of tumor development and cell subtype.

[0072] The biological effects of AMPK and PRKAA2 in tumors show significant complexity. On the one hand, UBE2O-mediated PRKAA2 degradation can promote breast cancer, and AMP analogs can further increase E2F1-induced apoptosis of breast cancer cells; on the other hand, PRKAA2 activates autophagy by phosphorylating ULK1 to promote tumor cell survival under stress conditions, and is essential for TNBC chemotherapy resistance and lung metastasis. This study further reveals that the up-regulation of PRKAA2 in TBCSCs promotes chemotherapy resistance by maintaining stemness characteristics and reducing drug sensitivity, suggesting that its pro-tumor effect is particularly prominent in tumor stem cells. This functional diversity may be due to the dynamic changes in tumor microenvironment differences, cell stress state and epigenetic regulatory networks.

[0073] CBP / p300, as a classical histone acetyltransferase, often depends on cofactor-mediated targeted recruitment to exert its function. This study found that CITED2 binds to p300 through the C-terminal LPEL domain, and then anchors the CBP / p300 complex to the PRKAA2 promoter region, driving H3K27 acetylation and gene transcription activation. Based on this, the exogenous LPEL peptide designed in this study can competitively destroy the CITED2 / CBP / p300 interaction, significantly inhibit the stemness of TBCSCs and increase the efficacy of DOX. Notably, LPEL peptide combined with DOX shows a synergistic anti-tumor effect, which provides a potential therapeutic means for overcoming TNBC chemotherapy resistance in clinic.

[0074] In summary, the present application not only reveals the core role of CITED2 / CBP / p300-H3K27ac-PRKAA2 axis in maintaining stemness and chemotherapy resistance of TBCSCs, but also verifies its therapeutic conversion potential by developing a targeted LPEL peptide, laying an experimental foundation for precise treatment of TNBC.

[0075] Aspects, embodiments, features of the present invention are to be considered illustrative only and not restrictive in all respects. The scope of the present invention is defined solely by the claims. Other embodiments, modifications, and uses will be apparent to those skilled in the art, and the embodiments are not to be considered limited to the specific embodiments set forth herein, but rather are to be given the full scope of the claims.

[0076] In the preparation method of the present invention, the order of the steps is not limited to the listed order, and for those skilled in the art, the order of the steps can be changed without creative effort, and such changes are within the protection scope of the present invention. In addition, two or more steps or actions can be performed simultaneously.

[0077] Finally, it should be noted that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the scope of the embodiments of the present invention. Those skilled in the art can make various modifications or supplements to the described specific embodiments or use similar ways to replace them, and it is not necessary or possible to fully describe all embodiments here. Any obvious changes or variations derived from the spirit of the present invention are still within the protection scope of the present invention, and any additional limitations are contrary to the spirit of the present invention.

Claims

1. A drug for reversing multidrug resistance of tumors, characterized in that: The drug for reversing tumor multidrug resistance comprises the LPEL polypeptide whose sequence is shown in SEQ ID NO: 1 and an anticancer drug.

2. The drug for reversing tumor multidrug resistance according to claim 1, characterized in that: The LPEL polypeptide is connected to a penetration sequence shown in SEQ ID NO: 2, and the penetration sequence is connected to a fluorescent group.

3. The drug for reversing tumor multidrug resistance according to claim 1, characterized in that: The mass ratio of LPEL polypeptide to anticancer drug is 1:(5-15).

4. The drug for reversing tumor multidrug resistance according to claim 1, characterized in that: The tumor is a drug-resistant triple-negative breast cancer with high expression of PRKAA2.

5. The drug for reversing tumor multidrug resistance according to claim 4, characterized in that: LPEL polypeptide inhibits the activity of PRKAA2.

6. The drug for reversing tumor multidrug resistance according to claim 5, characterized in that: LPEL peptide effectively inhibits PRKAA2 expression by targeting CITED2 / CBP / p300, overcoming chemotherapy resistance in triple-negative breast cancer; Among them, CITED2 promotes the formation of CITED2 / CBP / p300 complex, catalyzing H3K27 acetylation modification of PRKAA2 promoter region and activating its transcription.

7. The drug for reversing tumor multidrug resistance according to claim 1, characterized in that: Anticancer drugs include doxorubicin.

8. The drug for reversing tumor multidrug resistance according to claim 1, characterized in that: The drug for reversing tumor multidrug resistance also includes a carrier and / or an adjuvant.

9. Use of the drug for reversing tumor multidrug resistance as claimed in claim 1 in the treatment of triple-negative breast cancer.

10. The use according to claim 9, wherein the concentration of the LPEL polypeptide in the drug for reversing tumor multidrug resistance is 3-8 mg / kg body weight, and the concentration of the anticancer drug is 35-45 mg / kg body weight.

Images