Wheat stripe rust protein PstCCC1 and application thereof

By genetic engineering, the vacuolar iron ion transporter gene PstCCC1 of wheat stripe rust was silenced, the sensitivity of wheat stripe rust to triadimefon was enhanced, the problem of wheat stripe rust resistance to triadimefon was solved, and better prevention and control effects and environmental protection effects were achieved.

CN120795099APending Publication Date: 2025-10-17NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510917136.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-03
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

In the existing technology, wheat stripe rust develops resistance to triadimefon, which reduces the control effect of triadimefon, increases the control cost and causes environmental pollution. There is an urgent need to clarify the molecular mechanism and develop new target drugs.

Method used

Through genetic engineering, the vacuolar iron ion transporter PstCCC1 of wheat stripe rust was screened out, the PstCCC1 gene was silenced, and the sensitivity of wheat stripe rust to triadimefon was enhanced. The PstCCC1 gene-silenced plants obtained by transient silencing technology improved the control effect of triadimefon.

Benefits of technology

It effectively improves the control effect of triadimefon on wheat stripe rust, reduces the emergence rate of drug-resistant strains, reduces prevention and control costs and reduces the risk of environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120795099A_ABST
    Figure CN120795099A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic engineering breeding, and discloses wheat stripe rust protein PstCCC1 and application thereof. The PstCCC1 protein has an amino acid sequence as shown in SEQ ID NO: 1, and is coded by a nucleotide sequence as shown in SEQ ID NO: 2. Through verification, after the PstCCC1 gene is silenced, the sensitivity of the wheat stripe rust to the triadimefon is obviously enhanced, the control effect of the triadimefon is improved, and stripe rust spore piles generated on wheat leaves are obviously reduced. The invention provides a theoretical basis for research and development of a treatment technology taking delaying of the development speed of the drug resistance of the puccinia striiformis as a core and a new target drug for preventing and treating the puccinia striiformis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering breeding, and particularly relates to a wheat stripe rust protein PstCCC1 and application thereof. BACKGROUND

[0002] Stripe rust caused by Puccinia striiformis f.sp.tritici is listed as a class of crop diseases, which seriously threatens the safety of wheat production and causes huge yield and economic losses. Applying chemical fungicides is an important measure for preventing and controlling stripe rust, and triadimefon (a triazole fungicide) is a main promoted fungicide for preventing and controlling stripe rust, which has been used in a large area and single use for more than 50 years, greatly increasing the selection pressure of the emergence of resistant strains, so that the chemical prevention and control of stripe rust is facing severe risks and challenges.

[0003] At present, about 6.79% of the wheat stripe rust strains in the main wheat production areas have developed resistance to triadimefon, and the resistant strains are mainly concentrated in the winter breeding area and the northwest summer area, but the resistance mechanism is not clear. The emergence of resistant strains reduces the prevention and control effect of triadimefon by about 12.35-23.87%, increases the prevention and control cost, and causes environmental pollution problems. Therefore, it is urgent to clarify the molecular mechanism of the resistance of wheat stripe rust to triadimefon, to provide a theoretical basis for the development of management technology for delaying the development speed of stripe rust resistance and new target drugs for the prevention and control of stripe rust. SUMMARY

[0004] In order to better play the prevention and control effect of triadimefon on wheat stripe rust, the application screens a wheat stripe rust vacuolar iron ion transporter PstCCC1 by genetic engineering means, and reveals the physiological function and molecular mechanism of PstCCC1 in the process of preventing and controlling wheat stripe rust by triadimefon through the expression characteristics of the PstCCC1 protein coding gene. In order to achieve this technical purpose, the application provides the following technical scheme.

[0005] In a first aspect, the application provides a wheat stripe rust vacuolar iron ion transporter PstCCC1, wherein the PstCCC1 protein has an amino acid sequence as shown in SEQ ID NO: 1.

[0006] In a second aspect, the application provides a PstCCC1 gene, wherein the PstCCC1 gene comprises a nucleotide sequence encoding the PstCCC1 protein.

[0007] Further, the CDS sequence of the PstCCC1 gene is shown in SEQ ID NO: 2.

[0008] Further, silencing the PstCCC1 gene enhances the sensitivity of wheat stripe rust to triadimefon or improves the prevention and control effect of triadimefon.

[0009] In a third aspect, the present application provides a vector for silencing the PstCCC1 gene.

[0010] Further, the blank viral vector after enzyme digestion is connected with the silencing sequence PstCCC1-S1 or the silencing sequence PstCCC1-S2;

[0011] The silencing sequence PstCCC1-S1 corresponds to the nucleotide sequence from 137th to 322nd nucleotide from the 5' end of the CDS sequence of the PstCCC1 gene; and the silencing sequence PstCCC1-S2 corresponds to the nucleotide sequence from 693rd to 889th nucleotide from the 5' end of the CDS sequence of the PstCCC1 gene.

[0012] Further, the primer pair for amplifying the silencing sequence PstCCC1-S1 is SEQ ID NO: 9 and SEQ ID NO: 10; and the primer pair for amplifying the silencing sequence PstCCC1-S2 is SEQ ID NO: 11 and SEQ ID NO: 12.

[0013] In a fourth aspect, the present application provides an expression vector for silencing the PstCCC1 gene.

[0014] In a fifth aspect, the present application claims the use of the PstCCC1 protein, the PstCCC1 gene, the vector or the expression vector in the wheat breeding.

[0015] Further, in the above use, the silencing of the PstCCC1 gene and / or the reduction of the concentration of the PstCCC1 protein, the sensitivity of the Puccinia striiformis to triadimefon is enhanced, or the control effect of triadimefon is improved.

[0016] In addition, those skilled in the art can easily mutate the nucleotide sequence encoding the PstCCC1 protein by using known methods, such as the methods of directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity with the PstCCC1 gene sequence obtained by the present application, as long as they encode the PstCCC1 protein and have the same function, are derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application.

[0017] The term "identity" as used herein refers to sequence similarity with a native nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with SEQ ID NO: 2. Identity can be assessed by eye or by computer software. Using computer software, identity between two or more sequences can be expressed as a percentage (%) which can be used to assess identity between related sequences.

[0018] The 75% or more identity described above can be 80%, 85%, 90% or 95% or more identity.

[0019] The expression cassette containing the nucleic acid molecule encoding PstCCC1 protein (PstCCC1 gene expression cassette) refers to DNA capable of expressing PstCCC1 protein in a host cell, which can include not only a promoter that initiates PstCCC1 transcription, but also a terminator that terminates PstCCC1 transcription. Further, the expression cassette can also include an enhancer sequence. The promoters that can be used in the present application include but are not limited to: constitutive promoters; tissue, organ and development specific promoters and inducible promoters. Suitable transcription terminators include but are not limited to: Agrobacterium nopaline synthase terminator (NOS terminator), Cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcSE9 terminator and nopaline and opine synthase terminator.

[0020] Compared with the prior art, the technical solutions provided by the present application have at least the following beneficial effects or advantages: the present application proves that PstCCC1 gene silenced plants obtained by using transient silencing technology can effectively improve the control effect of triadimefon on Puccinia striiformis, indicating that PstCCC1 protein of Puccinia striiformis has resistance to triadimefon. The PstCCC1 protein, PstCCC1 gene and application thereof provided by the present application provide a basis for scientific and efficient use of triadimefon, and will play an important role in wheat breeding and research and development of new control agents for Puccinia striiformis. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Figure 2 is a graph showing the expression pattern of PstCCC1 gene after Puccinia striiformis was treated with triadimefon. Figure 1 The standard deviation is shown by the error bars, "ns" means not statistically significant, "**" means p<0.01, highly significant compared with 0h; "***" means p<0.001, extremely highly significant compared with 0h; "****" means p<0.0001, extremely highly significant compared with 0h.

[0022] Figure 2Schematic diagram of the location of PstCCC1-S1 and PstCCC1-S2, the silencing sequences of PstCCC1 gene, on the gene.

[0023] Figure 3 Phenotype of normal wheat plants after inoculation with different recombinant virus vectors (left) and phenotype of test groups (BSMV: γ, BSMV: PstCCC1-S1, BSMV: PstCCC1-S2) further inoculated with Pst and treated with triazolone (right).

[0024] Figure 4 Statistical results of the relative expression of PstCCC1 gene of Pst of test group wheat plants (left) and the spore biomass of Pst (right). "**" indicates p < 0.01, highly significant.

[0025] Figure 5 Histological observation results of wheat leaves in which PstCCC1 gene is silenced. Among them, a is the Pst mycelium expansion of wheat leaves in which PstCCC1 gene is silenced under fluorescence microscope at 72h of triazolone treatment; b is the mycelium area of each infection point in wheat leaves at 72h of triazolone treatment. The numerical value represents the average value ± standard deviation of three independent samples (60 infection points / sample), and the error line shown in the figure is the standard deviation. "**" (p < 0.01) indicates significant difference, which is obtained by t-test analysis. DETAILED DESCRIPTION

[0026] In the following, the technical solutions of the present application are described in conjunction with examples, but the present application is not limited to the following examples.

[0027] In each of the following examples, the experimental methods and detection methods are conventional methods unless otherwise specified; the reagents and materials can be purchased on the market unless otherwise specified; and the index data are measured by conventional methods unless otherwise specified.

[0028] Example 1

[0029] This example provides the obtaining of PstCCC1 protein and its encoding gene.

[0030] Take the wheat Pst uredospores normally growing on wheat leaves for 14d, freeze them with liquid nitrogen, and store them at -80℃ for standby use.

[0031] Extract the total RNA of wheat Pst by Trizol method (TianGen), and synthesize the first strand cDNA by reverse transcriptase XL (AMV). Synthesize the cDNA by SMART method, and detect the PCR products by 1.0% agarose gel electrophoresis. The amplification primer is:

[0032] PstCCC1-F: 5'-TCATCAAATCTCATCAAAAAAATGA-3' (SEQ ID NO: 3);

[0033] PstCCC1-R: 5'-TGATTGGCTTGCCAGTTTCAACCAT-3' (SEQ ID NO: 4).

[0034] A 1239 bp PCR product was obtained. Sequencing showed that the PCR product has the nucleotide sequence shown as SEQ ID NO: 2, which is named as PstCCC1 gene, which encodes PstCCC1 protein, and the amino acid sequence of which is shown as SEQ ID NO: 1.

[0035] Example 2

[0036] This example provides qRT-PCR detection of the expression of Puccinia striiformis PstCCC1 gene under the treatment of triazolinone.

[0037] Fresh uredospores of Puccinia striiformis YQ324 strain were inoculated on "Mingxian 169" wheat seedlings at the two-leaf stage, and the moisture and culture conditions were referred to the literature "Discovery of Lovell 10 pathogenic new strain at room temperature [J]. Kang Zhen-sheng, Li Zhen-qi. Journal of Northwest A&F University (Natural Science Edition), 1984 (04): 18-28." After 3 days of inoculation, triazolinone with a concentration of 100 μg / mL was sprayed at a dosage of 10 mL per pot (15 plants per pot), and acetone was used as a control. Each treatment was set up in triplicate. After treatment, samples were taken at 0, 6, 12, 24, 48, 72, and 120 hours and immediately frozen in liquid nitrogen, and then stored in a -80°C refrigerator for later use. Total RNA was extracted from wheat leaves using the Trizol method (TianGen), and first-strand cDNA was synthesized using reverse transcriptase XL (AMV). cDNA was synthesized using the SMART method.

[0038] The elongation factor gene PstEF-1a was used as an internal reference gene, and specific qRT-PCR primers were designed according to the sequences of PstCCC1 gene and internal reference gene. The qRT-PCR primer sequences are as follows:

[0039] Q PstCCC1-F: 5'-GCGCGCCTGGATGTAATTTT-3' (SEQ ID NO: 5);

[0040] Q PstCCC1-R: 5'-GCACAGGGGTTTGGTGGATA-3' (SEQ ID NO: 6).

[0041] PstEF-1a-F: 5'-TTCGCCGTCCGTGATATGAGACAA-3' (SEQ ID NO: 7);

[0042] PstEF-1a-R: 5'-ATGCGTATCATGGTGGTGGAGTGA-3' (SEQ ID NO: 8).

[0043] qRT-PCR primers were tested for their specificity and amplification efficiency (≥ 90%) before use. Using AceQ Universal SYBR qPCR MasterMix (Vazyme, Nanjing, China) and Bio-Rad CFX Manager quantitative PCR instrument (Bio-rad, Hercules, California), according to the instructions, the cDNA of each sampling point was used as a template for qRT-PCR amplification. Each reaction was repeated at least three times, and the Ct value, average value and standard deviation of each repetition were generated by manual adjustment of the baseline by the quantitative PCR instrument. The comparative threshold method (2 –ΔΔCT ) was used to calculate the relative expression of PstCCC1 gene.

[0044] The relative expression of PstCCC1 gene at different time points after triazolone treatment is shown in Table 2. Figure 1 Compared with the control group (treated with acetone), the expression of PstCCC1 gene was significantly up-regulated at 12, 24, 48, 72 and 120h after triazolone treatment. Among them, "ns" means no statistical significance, "**" means p < 0.01, highly significant compared with 0h; "***" means p < 0.001, extremely high significant compared with 0h; "****" means p < 0.0001, extremely high significant compared with 0h. Figure 1 The results show that the expression of PstCCC1 gene is significantly increased by triazolone induction.

[0045] Example 3

[0046] This example provides the verification of the anti-triazolone function of PstCCC1 gene by using HIGS (host-induced gene silencing) technology.

[0047] 1. Construction of PstCCC1 gene silencing vector by barley stripe mosaic virus-induced gene silencing (BSMV-HIGS)

[0048] 1) Obtaining of silencing sequence

[0049] (1) Obtaining of silencing sequence PstCCC1-S1

[0050] Using the 1239 bp PstCCC1 gene fragment amplified in Example 1 as a template, PCR amplification was performed with the primer pair PstCCC1-S1F, PstCCC1-S1R to obtain a PCR amplification product of 186 bp in size (corresponding to the sequence of nucleotides 137 to 322 from the 5' end of SEQ ID NO: 2), which was designated as the silencing sequence PstCCC1-S1.

[0051] The nucleotide sequences of the primer pair PstCCC1-S1F and PstCCC1-S1R are as follows (the recognition sites of the restriction enzymes PacI and NotI are indicated by underlining):

[0052] PstCCC1-S1F: 5'- AGAAACAGAGGAAAGTATGGGATTA -3' (SEQ ID NO: 9);

[0053] PstCCC1-S1R: 5'- GACGGCTTTTCTTATCACATTTATT -3' (SEQ ID NO: 10).

[0054] (2) Obtaining of the silencing sequence PstCCC1-S2

[0055] Using the 1239 bp PstCCC1 gene fragment amplified in Example 1 as a template, PCR amplification was performed with the primer pair PstCCC1-S2F, PstCCC1-S2R to obtain a PCR amplification product of 197 bp in size (corresponding to the sequence of nucleotides 693 to 889 from the 5' end of SEQ ID NO: 2), which was designated as the silencing sequence PstCCC1-S2.

[0056] The nucleotide sequences of the primer pair PstCCC1-S2F and PstCCC1-S2R are as follows (the recognition sites of the restriction enzymes PacI and NotI are indicated by underlining):

[0057] PstCCC1-S2F: 5'- GACTTATTTGCTATCTTTTGAACAG -3' (SEQ ID NO: 11);

[0058] PstCCC1-S2R: 5'- ATTCATCTAATCCTATGGGCCCAAG -3' (SEQ ID NO: 12).

[0059] The positions of the silencing sequences PstCCC1-S1, PstCCC1-S2 on the PstCCC1 gene are schematically shown in Figure 2 .

[0060] 2) Construction of the silencing vector

[0061] (1) Construction of γ-PstCCC1-S1 silencing vector

[0062] The PstCCC1-S1 and BSMV viral vector γ obtained in step 1) were respectively digested by restriction enzymes PacI and NotI, and then the digested PstCCC1-S1 was ligated with the digested BSMV viral vector γ to obtain a recombinant vector γ-PstCCC1-S1.

[0063] The recombinant vector γ-PstCCC1-S1 can replace the fragment between the PacI and NotI digestion sites of the BSMV viral vector γ with PstCCC1-S1, and keep other sequences of the BSMV viral vector γ unchanged, wherein the PstCCC1-S1 is opposite to the sequence direction of the PstCCC1 gene.

[0064] The recombinant vector γ-PstCCC1-S1 was subjected to PCR amplification by using a primer pair γ-F and γ-R, and the sequences of the γ-F and γ-R primers were as follows:

[0065] γ-F: 5'-GTGAGGTTAACGCAATACG-3' (SEQ ID NO: 13);

[0066] γ-R: 5'-TCAGGCATCGTTTTCA-3' (SEQ ID NO: 14).

[0067] A positive clone was obtained by sequencing identification, which was a vector obtained by inserting the nucleotides 137-322 of SEQ ID NO: 2 from the 5' end into the PacI and NotI digestion sites of the γ chain of the BSMV viral vector γ, and keeping other sequences of the γ chain unchanged.

[0068] (2) Construction of γ-PstCCC1-S2 silencing vector

[0069] The PstCCC1-S2 and BSMV viral vector γ obtained in step 1) were respectively digested by restriction enzymes PacI and NotI, and then the digested PstCCC1-S2 was ligated with the digested BSMV viral vector γ to obtain a recombinant vector γ-PstCCC1-S2.

[0070] The recombinant vector γ-PstCCC1-S2 can replace the fragment between the PacI and NotI digestion sites of the BSMV viral vector γ with PstCCC1-S2, and keep other sequences of the BSMV viral vector γ unchanged, wherein the PstCCC1-S2 is opposite to the sequence direction of the PstCCC1 gene.

[0071] The positive clone is obtained by PCR amplification of the recombinant vector γ-PstCCC1-S2 with primer pair γ-F and γ-R, and is identified by sequencing. The positive clone is obtained by inserting SEQ ID NO: 2 from the 693th to 889th nucleotide at the 5' end into the PacI and NotI enzyme cutting sites of the BSMV viral vector γ chain, and keeping other sequences of the γ chain unchanged.

[0072] 3) Obtaining the vector system for silencing PstCCC1 gene

[0073] The BSMV vector system is composed of three genomic RNA chains (α, β, γ), wherein the γ chain is the core component for realizing the function of HIGS (host-induced gene silencing). In the present application, the α, β chains and the recombinant vector γ-PstCCC1-S1 together constitute the viral vector system BSMV:PstCCC1-S1 for silencing PstCCC1 gene. The α, β chains and the recombinant vector γ-PstCCC1-S2 together constitute the viral vector system BSMV:PstCCC1-S2 for silencing PstCCC1 gene.

[0074] The viral vector system constructed above reversely inserts the silencing fragments PstCCC1-S1 and PstCCC1-S2 between the enzyme cutting sites of NotI and PacI of the γ chain, so as to realize the silencing of PstCCC1 gene.

[0075] 2. Linearization of BSMV vector and in vitro transcription

[0076] 1) Linearization of the vector

[0077] The BSMV viral vector α and γ chains are respectively digested with MluI, the recombinant vectors γ-PstCCC1-S1 and γ-PstCCC1-S2 are digested with BssHII, and the BSMV viral vector β chain is digested with SpeI, so as to obtain linearized plasmids.

[0078] 2) In vitro transcription

[0079] The linearized plasmids obtained in step 1) are used as templates for in vitro transcription, so as to obtain the in vitro transcribed BSMV viral vectors α, β, γ, γ-PstCCC1-S1 and γ-PstCCC1-S2. The in vitro transcription reaction is performed according to the instructions of RiboMAX TM Large Scale RNA Production System-T7 (product of Promega Company, item number: P1300).

[0080] The above transcription reaction system and conditions are as follows: total reaction volume 20.0 μL, including: linearized plasmid 6.5 μL, 5×Transcription Buffer 4.0 μL, Cap 1.5 μL (Promega product, item number: P1718), rNTP PreMix 6.0 μL, Enzyme Mix 2.0 μL; 37°C reaction for 4 h, and the transcription product is stored at -80°C for standby.

[0081] 3. BSMV inoculation

[0082] Wheat "Water 11" is sowed in nutrient soil, and when it grows to the two-leaf stage, 10 μL of recombinant virus vector BSMV:TaPDS, BSMV:γ, BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2 solutions are taken respectively, and rubbed on the wheat leaves, and after 10 min, ddH2O is sprayed, the temperature is adjusted to 25°C, and the moisture is maintained for 24 h. Then, the temperature is adjusted to 25°C, and the normal condition culture is carried out, and wheat plants into which BSMV:TaPDS, BSMV:γ, BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2 are transferred are obtained respectively. In addition, mock inoculation plants are set, and 1×FES Buffer (MOCK) is applied.

[0083] In the above experiment, BSMV:TaPDS (phytoene desaturase) is used as a positive control, and if obvious light bleaching symptoms are observed on the wheat leaves, it indicates that the target gene has been effectively silenced. The plants into which BSMV:γ is transferred are used as a negative control, and the plants to which 1×FES Buffer is applied are blank control plants (MOCK). The plants into which BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2 are transferred are wheat plants in which the PstCCC1 gene is silenced.

[0084] The above BSMV:TaPDS recombinant virus vector solution is obtained by mixing equal amounts of in vitro transcribed BSMV virus vectors α, β and γ-PDS diluted 3 times with DEPC water, and then adding 6 times the volume of 1×FES Buffer. The above BSMV:γ recombinant virus vector solution is obtained by mixing equal amounts of in vitro transcribed BSMV virus vectors α, β and γ diluted 3 times with DEPC water, and then adding 6 times the volume of 1×FES Buffer. The above BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2 recombinant virus vector solutions are obtained by mixing equal amounts of in vitro transcribed BSMV virus vectors α, β and γ-PstCCC1-S1, γ-PstCCC1-S2 diluted 3 times with DEPC water, and then adding 6 times the volume of 1×FES Buffer.

[0085] After inoculation with different recombinant virus vectors, the phenotypic results of wheat leaves in each group are as follows Figure 3 As shown in the left figure, the wheat leaves in the MOCK group were normal, while the wheat leaves in the BSMV:TaPDS, BSMV:γ, BSMV:PstCCC1-S1, and BSMV:PstCCC1-S2 groups all showed striped chlorosis, indicating that the BSMV virus infection was successful.

[0086] 4. qRT-PCR Verification of PstCCC1 Gene Silencing in Wheat Inoculated with Stripe Rust

[0087] After culturing the wheat plants obtained in step 3 above under normal conditions for 10 days, the BSMV:γ, BSMV:PstCCC1-S1, and BSMV:PstCCC1-S2 groups were inoculated with stripe rust summer spores. Samples were taken at 0, 48, 72, and 120 hours after inoculation, and RNA was extracted and reverse transcribed to synthesize cDNA. Using the synthesized cDNA as a template, qRT-PCR was performed according to the method of Example 1 to detect the relative expression level of the PstCCC1 gene in each group. 72 hours after inoculation with stripe rust, triadimefon treatment was performed. After 10 days of triadimefon treatment, samples were taken, DNA was extracted, and the stripe rust spore biomass on the BSMV:γ control and PstCCC1 gene-silenced plants was measured.

[0088] The leaf phenotypes of the experimental groups (BSMV:γ, BSMV:PstCCC1-S1, BSMV:PstCCC1-S2) treated with triadimefon for 10 days were as follows Figure 3 As shown in the right figure, it can be seen that the stripe rust spores accumulated more obviously on the surface of wheat leaves in the BSMV:γ group. In comparison, the stripe rust spores on the wheat leaves in the BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2 groups were significantly less.

[0089] The results of the relative expression level of the PstCCC1 gene after inoculation with stripe rust are shown in Figure 2. Figure 4 As shown in the left figure, it can be seen that the expression level of the PstCCC1 gene in the BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2 groups is 41-59% of that in the BSMV:γ group, indicating that the expression of the PstCCC1 gene has been successfully reduced. The two selected silencing sequences PstCCC1-S1 and PstCCC1-S2 are both effective ("**" indicates p < 0.01, extremely significant). The results of the stripe rust spore biomass test after inoculation with stripe rust and treatment with triadimefon are shown in Figure 2. Figure 4 As shown in the right figure, it can be seen that after 10 days of triadimefon treatment, the spore biomass of the PstCCC1-S1 and PstCCC1-S2 silenced strains was significantly lower than that of the control leaves of the BSMV:γ group.

[0090] 5. Triadimefon sensitivity identification of Puccinia striiformis f. sp. tritici in PstCCC1 gene silenced plants

[0091] In addition, the plants (BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2) obtained in step 3 in which the PstCCC1 gene is effectively silenced, and the negative control plants (BSMV:γ) are inoculated with Puccinia striiformis urediniospores after the fourth leaf unfolds, and 10 mL of triadimefon at a concentration of 100 μg / mL is sprayed on each pot of wheat plants 72 h after inoculation. The following analysis is performed:

[0092] WGA (wheat germ agglutinin) staining is performed 72 h after spraying triadimefon, and WGA staining is used to characterize the spread of Puccinia striiformis mycelium in wheat leaves.

[0093] At 72 h after triadimefon treatment, the mycelial area of each infection point in the wheat leaf is counted, 60 infection points are counted for each sample, and three biological replicates are performed.

[0094] The WGA staining results of each group are shown in a of Figure 5 , and the mycelial area counting results are shown in b of Figure 5 . As can be seen from Figure 5 , the Puccinia striiformis infection area of the wheat plants in the BSMV:PstCCC1-S1 and BSMV:PstCCC1-S2 groups is lower than that of the control group.

[0095] The results of this example show that silencing the PstCCC1 gene improves the sensitivity of Puccinia striiformis to triadimefon.

[0096] In summary, PstCCC1 is an important triadimefon resistance-related gene in Puccinia striiformis, which can help Puccinia striiformis resist the toxicity of triadimefon when normally expressed. The present application comprehensively analyzes the physiological function of the gene in the process of using triadimefon to control Puccinia striiformis, and effectively improves the sensitivity of Puccinia striiformis to triadimefon by silencing the gene or inhibiting the expression of the gene, so as to better play the control effect of triadimefon.

[0097] The above examples can better illustrate the technical solutions of the present application, but only describe the preferred embodiments of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various changes and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the scope of protection of the present application.

Claims

1. PstCCC1 protein, characterized in that The amino acid sequence is shown in SEQ ID NO:

1.

2. PstCCC1 gene, characterized in that It comprises a nucleotide sequence encoding the PstCCC1 protein according to claim 1.

3. The PstCCC1 gene according to claim 2, characterized in that The CDS sequence of the PstCCC1 gene is shown in SEQ ID NO:

2.

4. The PstCCC1 gene according to claim 3, characterized in that By silencing the PstCCC1 gene, the sensitivity of wheat stripe rust to triadimefon is enhanced, or the control effect of triadimefon is improved.

5. A vector for silencing the PstCCC1 gene according to any one of claims 2 to 4.

6. The carrier according to claim 5, characterized in that It is composed of the silent sequence PstCCC1-S1 or the silent sequence PstCCC1-S2 connected to the blank viral vector after enzyme digestion; The silent sequence PstCCC1-S1 corresponds to the nucleotide sequence from position 137 to position 322 from the 5' end of the CDS sequence of the PstCCC1 gene; The silent sequence PstCCC1-S2 corresponds to the 693rd to 889th nucleotide sequence from the 5' end of the CDS sequence of the PstCCC1 gene.

7. The carrier according to claim 6, characterized in that: The primer pair used to amplify the silent sequence PstCCC1-S1 is SEQ ID NO: 9 and SEQ ID NO: 10; The primer pair used to amplify the silent sequence PstCCC1-S2 is SEQ ID NO: 11 and SEQ ID NO:

12.

8. An expression vector, characterized in that The expression vector is used to silence the PstCCC1 gene.

9. Use of the PstCCC1 protein according to claim 1, or the PstCCC1 gene according to any one of claims 2 to 4, or the vector according to claim 5, or the expression vector according to claim 8 in wheat breeding.