Application of nilaparvata lugens NlGRP protein in prevention and treatment of nilaparvata lugens

Abstract

The invention discloses application of nilaparvata lugens NlGRP protein in prevention and treatment of nilaparvata lugens, and belongs to the technical field of prevention and treatment of nilaparvata lugens. By inhibiting the expression of the coding gene of the NlGRP protein in the brown planthopper, the growth and development of the brown planthopper can be obviously inhibited. Wide application prospects are realized; the method has great application value for reducing pesticide use, maintaining ecological balance and realizing sustainable development.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of brown planthopper control, and particularly relates to application of NlGRP protein of brown planthopper in control of brown planthopper. BACKGROUND

[0002] Brown planthopper, belonging to Homoptera and Delphacidae, is one of the main pests on rice. Brown planthopper is a monophagous pest, and its piercing-sucking mouthpart can pierce into the plant body to suck phloem sap, causing reduction of panicle number and grain number. When rice is seriously damaged by brown planthopper, large areas of rice will die, and the phenomenon of "planthopper fire" will occur, so that there will be no harvest. Brown planthopper causes about 1 to 1.5 billion kilograms of rice yield reduction per year, which is equivalent to tens of billions of economic losses.

[0003] At present, insecticides are generally used to control brown planthopper, but the large-scale and long-term use of insecticides has led to the development of drug resistance of brown planthopper. The method of spraying pesticides is not only harmful to humans and animals, but also causes serious environmental pollution. Therefore, actively developing research and application of biological control technology of brown planthopper has important significance for scientific and effective control of brown planthopper, and protection of food safety and environmental safety.

[0004] RNA interference (RNAi) refers to a phenomenon that double-stranded RNA induces efficient and specific degradation of homologous mRNA. Since the mechanism of RNA interference was discovered, the related technology has been rapidly developed and applied, and has become an effective tool for gene function research, and is currently widely used in insect gene research.

[0005] Microinjection method is a method of using a microinjection instrument to inject in vitro synthesized dsRNA into a specific site of an insect. The injection amount of the method can be accurately controlled, and the influence of the decrease of expression amount of a specific gene on the survival state of the insect can be observed, so the method is one of the most commonly used introduction methods. It is of great significance to use genetic engineering technology to improve the resistance of rice to brown planthopper for the breeding and cultivation of new varieties of rice for controlling brown planthopper. SUMMARY

[0006] The present application provides application of NlGRP protein of brown planthopper in control of brown planthopper. The present application first discovers the important role of NlGRP protein of brown planthopper in inhibiting the growth of brown planthopper, and the survival ability of brown planthopper can be effectively reduced by inhibiting the expression of NlGRP gene in brown planthopper. The present application is realized by the following technologies.

[0007] The first aspect of the present application provides application of a Nilaparvata lugens NlGRP protein in preventing and treating Nilaparvata lugens, growth of the Nilaparvata lugens is inhibited by inhibiting expression of a coding gene of the NlGRP protein; the amino acid sequence of the NlGRP protein is shown as SEQ ID NO. 1.

[0008] Further, the coding gene sequence of the NlGRP protein is shown as SEQ ID NO. 3.

[0009] Further, expression of the coding gene of the NlGRP protein is inhibited by using dsRNA; the amino acid sequence of the NlGRP protein is shown as SEQ ID NO. 1.

[0010] The second aspect of the present application provides application of an inhibiting factor in inhibiting growth of Nilaparvata lugens, the inhibiting factor is dsRNA for inhibiting expression of a coding gene of NlGRP protein.

[0011] Further, the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 2.

[0012] The third aspect of the present application provides a method for inhibiting growth of Nilaparvata lugens, growth of the Nilaparvata lugens is inhibited by inhibiting expression of a coding gene of NlGRP protein of the Nilaparvata lugens; the amino acid sequence of the NlGRP protein is shown as SEQ ID NO. 1.

[0013] Further, expression of the coding gene of the NlGRP protein of the Nilaparvata lugens is inhibited by using dsRNA.

[0014] Further, the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 2.

[0015] The fourth aspect of the present application provides a biological material for inhibiting expression of a coding gene of NlGRP protein of Nilaparvata lugens, the biological material is dsRNA, or an expression cassette, a vector or an engineering cell for preparing the dsRNA.

[0016] Further, the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 2.

[0017] Compared with the prior art, the present application has the advantages that the present application first discovers that the coding gene of NlGRP protein of Nilaparvata lugens has significant correlation with growth and development of the Nilaparvata lugens; by inhibiting expression of the coding gene of the NlGRP protein in the Nilaparvata lugens, for example, by using RNAi technology to silence the NlGRP coding gene of the Nilaparvata lugens, growth and development of the Nilaparvata lugens can be significantly inhibited; for example, lethal effect can be caused to the Nilaparvata lugens, and survival rate, weight gain and excretion of honeydew of the Nilaparvata lugens are significantly reduced with time.

[0018] Based on the above finding, inhibiting the expression of the Nilaparvata lugens NlGRP coding gene plays a very important role in inhibiting the growth and development of the Nilaparvata lugens, and has great application value and broad application prospect in reducing the use of pesticides, maintaining ecological balance and sustainable development. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 The cloning result of the NlGRP coding gene provided for Example 1 is shown in the figure, wherein the first lane is Marker, and the second lane is NlGRP ORF.

[0020] Figure 2 The agarose gel electrophoresis figure of dsGFP and dsNlGRP provided for Example 2 is shown in the figure.

[0021] Figure 3 The relative expression amount analysis result of the NlGRP coding gene after microinjection provided for Example 3 is shown in the figure. The CK is the group of Nilaparvata lugens without injection, the dsGFP is the group of Nilaparvata lugens injected with dsGFP, and the dsGLY-24h and dsGLY-48h are the groups of Nilaparvata lugens injected with NlGRP for 24 h and 48 h respectively.

[0022] Figure 4 The survival rate and weight gain analysis result of Nilaparvata lugens after microinjection provided for Example 4 is shown in the figure. Figure 4 A is the result of counting the survival rate of Nilaparvata lugens every day after microinjection and placing the Nilaparvata lugens on rice; Figure 4 B is the weight gain result of female insects within two days after the Nilaparvata lugens group is injected and waits for the insects to be adult insects; Figure 4 C is the result of counting the amount of honeydew excreted by female insects within two days after the Nilaparvata lugens group is injected and waits for the insects to be adult insects. DETAILED DESCRIPTION

[0023] The technical solutions of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0024] Example 1: Cloning of Nilaparvata lugens NlGRP coding gene

[0025] The cloning process of the Nilaparvata lugens NlGRP coding gene is as follows.

[0026] 1. Take 20 Nilaparvata lugens of biological type 1 (the group of Nilaparvata lugens without any resistance gene is biological type 1), extract total RNA, and reverse to cDNA.

[0027] 2. The 5' end and 3' end sequences of the candidate gene were obtained by designing primers based on the cDNA sequence, using the 5' and 3' RACE kit from Takara, and the transcription start site and termination site of the candidate gene were determined, and the full-length cDNA sequence of the gene was spliced.

[0028] 3. The primers NlGRP-F and NlGRP-R were resynthesized based on the full-length cDNA sequence, and the full-length cDNA of NlGRP was obtained by amplification. The sequence of the gene encoding NlGRP protein (i.e. cDNA) is shown in SEQ ID NO. 3.

[0029] The nucleotide sequence of the forward primer NlGRP-F is 5'-atgaggacaatcgctttgtg-3', as shown in SEQ ID NO. 4.

[0030] The nucleotide sequence of the reverse primer NlGRP-R is 5'-ctagaagggcactccgtaag-3', as shown in SEQ ID NO. 5.

[0031] The gel electrophoresis result of the amplification product cDNA is shown in Figure 1 . Figure 1 In the figure, the first lane is Marker, and the second lane is NlGRP ORF, and the nucleotide sequence is shown in SEQ ID NO. 3.

[0032] Example 2: Preparation of dsRNA (dsNlGRP) for silencing the NlGRP encoding gene of the brown planthopper, and dsRNA (dsGFP) for the control green fluorescent protein GFP encoding gene

[0033] The test method is as follows.

[0034] 1. The cDNA obtained in Example 1 was used as a template, and the following primers dsNlGRP-F and dsNlGRP-R were used for PCR amplification to obtain the PCR amplification product.

[0035] The nucleotide sequence of the forward primer dsNlGRP-F is 5'-taatacgactcactatagggagaatgaggacaatcgcttt-3', as shown in SEQ ID NO. 6.

[0036] The nucleotide sequence of the reverse primer dsNlGRP-R is 5'-taatacgactcactatagggagaccgtaagatccggatgg-3', as shown in SEQ ID NO. 7.

[0037] The sequence "taatacgactcactatagggaga" in the forward primer dsNlGRP-F is a T7 RNA polymerase promoter sequence.

[0038] 2. The PCR amplification product was obtained by using the following primers dsGFP-F and dsGFP-R with the pCXUN plasmid containing GFP as a template.

[0039] The nucleotide sequence of the forward primer dsGFP-F is 5'-taatacgactcactatagggcggact-3', as shown in SEQ ID NO. 8.

[0040] The nucleotide sequence of the reverse primer dsGFP-R is 5'-taatacgactcactatagggcgatgc-3', as shown in SEQ ID NO. 9.

[0041] The sequence "taatacgactcactataggg" is a T7 RNA polymerase promoter sequence.

[0042] 3. The two amplification products of the above steps 1 and 2 were recovered, A was added, and were respectively connected to the pMD18-T (TAKARA) vector. The positive clones were sequenced, and the correct cloned plasmid was screened.

[0043] The cloned plasmid was used as a template, and the above primers dsNlGRP-F and dsNlGRP-R, and dsGFP-F and dsGFP-R were used for amplification, respectively. The amplification products were purified, concentrated, and the concentration was 1 μg / μL. The two amplification products obtained were templates for synthesizing dsRNA (i.e., dsNlGRP and dsGFP).

[0044] 4. The reagent system in Table 1 below was added into a 200 μL centrifuge tube in proportion; it was mixed by flicking and was centrifuged instantaneously. It was placed in a PCR instrument for amplification. The amplification procedure was 37℃, 4 h; 75℃, 5 min; 16℃ preservation. 1 μL was aspirated, and gel electrophoresis detection was performed. After the target band was detected, the next step was continued.

[0045] Table 1

[0046]

[0047] 5. The reagents shown in Table 2 below were added to the above centrifuge tube to remove DNA and ssRNA.

[0048] Table 2

[0049]

[0050] Mix well, centrifuge, put into PCR instrument at 37℃ for 30 min. Take out the amplification product, add EDTA (Fementas company) 1 μL, continue to put back into the PCR instrument at 65℃ for 5 min to terminate the reaction. Absorb 1 μL, dilute 10 times, take 2 μL for gel electrophoresis detection, take 2 μL for NANOdrop ultraviolet spectrophotometer detection.

[0051] If the detection band is a very single bright band, as shown in Figure 2 OD 260 / 280 between 1.8-2.0, it indicates that the dsRNA quality is good, and the next step can be carried out. The nucleotide sequence of the dsRNA (dsNlGRP) for silencing the NlGRP coding gene of the brown planthopper is shown in SEQ ID NO. 2.

[0052] 6, carry out conventional phenol chloroform extraction, remove protein, according to the concentration, adjust the dsRNA (dsNlGRP and dsGFP) to 5 μg / μL, 10 μL per tube, and store at -80℃.

[0053] Example 3: Microinjection of dsNlGRP and dsGFP and effect detection

[0054] The microinjection and detection method is as follows.

[0055] 1, brown planthopper preparation: take 30 female insects and 10 male insects in a cup with TN1 (Taichung 1) seedlings, 24 h later, take out the adult insects; after hatching, 20 d later, use the fourth instar nymphs for injection.

[0056] 2, plate preparation: weigh 1.5 g of agar powder into 100 ml of water, boil, pour into a glass plate, and use after solidification.

[0057] 3, injection: take 5-8 insects with similar growth potential in a test tube, anesthetize with CO2 for 20 s; then pour the insects on a 1.5% agar powder plate with the abdomen upwards; use Nanoliter 2010 microinjection instrument according to the instruction manual to perform injection. The injection position is between the prothorax and the mesothorax; the injection amount is 46 nL (5 μg / μL).

[0058] 4, after the brown planthopper is injected with dsNlGRP (dsRNA), sampling is started from the first day after injection, three insects are sampled every day, and sampling is carried out for ten days; at the same time, brown planthoppers without injection and injected with dsGFP are taken as controls.

[0059] 5. Verify the change in gene expression by qRT-PCR. Specifically, after sampling, extract RNA, and use TAKARA's PrimeScript RT reagent Kit with gDNA Eraser (catalog number RR047A) to reverse transcribe according to the instructions, to obtain the reverse transcription product (cDNA).

[0060] Take 5 μL of the reverse-transcribed cDNA, dilute it 10 times with TE, and perform real-time quantitative PCR according to the following operations. The primers for the internal reference gene actin and the NlGRP quantitative primers used in the quantitative PCR are also shown below. The primers for the internal reference gene actin are used to standardize the gene expression amount, to eliminate the difference in RNA amount between samples, and the NlGRP quantitative primers are used to detect the expression level of the NlGRP gene.

[0061] The PCR reaction is performed on a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad) instrument, following the reaction system shown in Table 3 below.

[0062] Table 3

[0063]

[0064] Reaction conditions: 95°C pre-denaturation for 2 min; 95°C denaturation for 5-10 s, TM (55-65°C) annealing and extension for 30 s, repeat these two steps for 40 cycles; finally, 65°C-95°C, increase by 0.5°C for each step, 5 s for melting curve to determine the specificity of the amplification product. Each sample is repeated 3 times, and the amplification efficiency of each plate PCR is determined.

[0065] The results are analyzed using quantitative PCR data analysis software. First, analyze the melting curve, QC (quality control), etc., remove unqualified data, and use the Gene Study function of the software for gene expression analysis (1+E) -ΔΔCt algorithm analysis.

[0066] Internal reference gene actin primers:

[0067] The nucleotide sequence of Actin-F is: 5'-gacaggatgcagaaggaaatca-3', as shown in SEQ ID NO. 10.

[0068] The nucleotide sequence of Actin-R is: 5'-gactcgtcgtactcctgctttg-3', as shown in SEQ ID NO. 11.

[0069] NlGRP quantitative primers:

[0070] The nucleotide sequence of NlGRP-1F is 5'-gaggtggtgggggttatagc-3', as shown in SEQ ID NO. 12.

[0071] The nucleotide sequence of NlGRP-1R is 5'-gacctgttcgagaagtgcac-3', as shown in SEQ ID NO. 13.

[0072] The results are shown in the following table. Figure 3 It can be seen that, compared with the un-injected brown planthopper (CK group) and the dsGFP-injected control group (dsGFP group), the relative expression amount of the gene NlGRP in the brown planthopper injected with dsNlGRP significantly decreased 24 h and 48 h after injection, and there was a significant difference compared with the control. This indicates that the RNAi effect of the salivary gland secretion gene NlGRP in the brown planthopper can be caused by microinjection of dsNlGRP, resulting in a significant decrease in gene expression.

[0073] Example 4: Phenotype detection of brown planthopper after microinjection

[0074] 1. Brown planthopper survival rate test

[0075] The brown planthoppers (short-winged female brown planthoppers) were divided into three groups, namely "un-injected", "dsGFP-injected" and "dsNlGRP-injected" groups; after injection, they were allowed to recover and were placed back on rice. Ten insects were used each time, and the test was repeated 5 times.

[0076] The test results are shown in the following table. Figure 4 It can be seen that, after injection of dsNlGRP, the survival rate of the brown planthopper was significantly lower than that of the brown planthopper injected with dsGFP and the un-injected brown planthopper from the third day after injection.

[0077] 2. Brown planthopper weight gain test

[0078] The above three groups of brown planthoppers were placed back on rice after injection, and were allowed to emerge; the first day of emergence of the brown planthoppers was weighed individually; then they were placed in a wax bag tied to a rice seedling; after two days, the surviving brown planthoppers were taken out and weighed again; the difference between the two weights was recorded as the weight gain of the insects. Ten insects were used each time, and the test was repeated 5 times.

[0079] The weight gain of the newly emerged brown planthoppers within 48 h was analyzed, and the test results are shown in the following table. Figure 4 It can be seen that, after injection of dsNlGRP, the weight gain of the brown planthopper decreased. This indicates that, after injection of dsNlGRP, the expression of the gene decreased, affecting the feeding of the brown planthopper, and further affecting the survival rate of the brown planthopper.

[0080] 3. Brown planthopper honeydew determination test

[0081] Honeydew is the excretion of the Nilaparvata lugens during feeding, and can be used to measure the feeding amount of the Nilaparvata lugens. The color and area of the honeydew on the filter paper can reflect the feeding activity of the Nilaparvata lugens. The honeydew of the Nilaparvata lugens in the two groups of different treatments of injecting dsGFP and dsNlGRP was treated, and the results are shown in Table 2. Figure 4 As shown in Table 2, it can be seen that the amount of honeydew excreted by the Nilaparvata lugens after injecting dsNlGRP is reduced, and the difference is extremely significant. This shows that after the gene NlGRP is silenced, the feeding amount of the Nilaparvata lugens is significantly reduced.

[0082] The above specific embodiments describe the implementation of the present application in detail, but the present application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the present application, various simple modifications and changes can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. An application of a brown planthopper NIGRP protein in controlling brown planthopper, characterized in that: The growth of brown planthopper is inhibited by inhibiting the expression of the gene encoding the NIGRP protein of the brown planthopper; the amino acid sequence of the NIGRP protein is shown in SEQ ID NO.

1.

2. The use of the brown planthopper NIGRP protein in controlling brown planthopper according to claim 1, characterized in that: The coding gene sequence of the N1GRP protein is shown in SEQ ID NO.

3.

3. The use of the brown planthopper NIGRP protein in controlling brown planthopper according to claim 2, characterized in that: The expression of the gene encoding the N1GRP protein was inhibited by using dsRNA.

4. An application of an inhibitory factor in inhibiting the growth of brown planthopper, characterized in that: The inhibitory factor is a dsRNA that inhibits the expression of the gene encoding the NlGRP protein; the amino acid sequence of the NlGRP protein is shown in SEQ ID NO.

1.

5. Use of the inhibitory factor according to claim 4 in inhibiting the growth of brown planthopper, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

6. A method for inhibiting the growth of brown planthopper, characterized in that: The growth of brown planthopper is inhibited by inhibiting the expression of the gene encoding the NIGRP protein of brown planthopper; the amino acid sequence of the NIGRP protein is shown in SEQ ID NO.

1.

7. The method for inhibiting the growth of brown planthopper according to claim 6, characterized in that: dsRNA was used to inhibit the expression of the gene encoding the NIGRP protein of the brown planthopper.

8. The method for inhibiting the growth of brown planthopper according to claim 7, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

9. A biological material for inhibiting the expression of a gene encoding NIGRP protein of brown planthopper, characterized in that: The biological material is dsRNA, or an expression box, vector or engineered cell for preparing dsRNA.

10. The biological material for inhibiting the expression of the gene encoding the NIGRP protein of brown planthopper according to claim 9, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

Images