Preparation method of selenium-enriched apple wine

Abstract

The invention provides a preparation method of selenium-enriched apple wine, which comprises the following steps: culturing non-saccharomyces kluyveri in a YPD liquid culture medium added with sodium selenite to obtain selenium-enriched yeast, inoculating the selenium-enriched yeast into apple juice, and fermenting to obtain the selenium-enriched apple wine. The Pichia kluyveri is non-saccharomyces cerevisiae suitable for cider fermentation, and the cider fermented by the Pichia kluyveri is excellent in aroma production performance, especially outstanding in ester aroma; the selenium-enriched cider wine is prepared through fermentation of the selenium-enriched yeast Pichia kluyveri, the total selenium content reaches 104.20 [mu] g / L, the content of esters, acids, aldehyde ketones, terpenes and other substances in the cider wine is further increased, and the flavor of the cider wine is enriched.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of fruit wine, and particularly relates to a preparation method of selenium-rich cider. BACKGROUND

[0002] Selenium has important physiological functions for the human body, and the human body mainly relies on food to intake selenium. Deficiency of selenium can lead to decline of immunity of the human body and may cause various diseases. According to the requirement of the World Health Organization, the minimum daily selenium requirement of the human body is 40 micrograms, but the daily diet of Chinese people still cannot reach the standard selenium supplement level of more than 40 micrograms per day per person. Selenium exists in the environment in various forms, mainly inorganic selenium and organic selenium. Inorganic selenium must be combined with organic ligands in the intestinal tract before it can be absorbed by human cells. However, various factors in the intestinal tract compete with Se for organic ligands, resulting in poor absorption rate and low bioavailability of inorganic selenium, and inorganic selenium that cannot be absorbed has serious toxicity to the human body. Inorganic selenium can be converted into organic selenium compounds through biological transformation, and finally absorbed by human proteins to exert its nutritional value. Common methods for supplementing selenium include plant transformation of selenium-rich, animal feeding of selenium-rich, and microbial transformation of selenium-rich. For example, selenium-rich tea, selenium-rich rice, selenium-rich garlic, and selenium-rich kiwi fruit products. Selenium in selenium-rich yeast mainly exists in the form of selenium amino acids and other forms, which is a good source of organic selenium and can be used as a nutritional supplement. Therefore, by using the selenium-rich and fermentation characteristics of yeast, selenium-rich yeast is often used as a microbial organic selenium carrier for research and development of selenium-rich products.

[0003] Cider is an alcoholic beverage made from fermented apples, and is the second largest fruit wine in the world after wine. It contains rich nutrients, including vitamins, minerals and amino acids. When consumed in moderation, cider has antioxidant properties and can help prevent chronic diseases, making it popular among consumers worldwide. Traditionally, Saccharomyces cerevisiae has been used for alcoholic fermentation in cider production. However, overuse of commercial strains of Saccharomyces cerevisiae can affect the formation of unique flavors derived from the fruit. Non-Saccharomyces cerevisiae has obvious advantages in the development of alcoholic beverages compared to Saccharomyces cerevisiae. Although non-Saccharomyces cerevisiae has weaker alcohol production capacity than Saccharomyces cerevisiae, it can enhance the taste and flavor of fermented products while meeting the alcohol content requirements of low-alcohol fruit wine. These yeast strains can also improve raw material utilization, hydrolyze more aroma precursors, and release various aromatic compounds, thereby increasing the complexity of fruit wine aroma. Currently, non-Saccharomyces cerevisiae strains commonly used to improve the flavor of wine and cider include Torulaspora delbrueckii, Metschnikowia pulcherrima, Wickerhamomyces anomalus, Hanseniaspora vineae and Pichia kluyveri.

[0004] In recent years, people pay more and more attention to selenium-rich food, and it is urgent to supplement selenium. However, there are few studies on the fermentation of apple wine by selenium-rich non-Saccharomyces cerevisiae, and there is no study on the regulation of fermentation aroma by selenium-rich yeast. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a preparation method of selenium-rich apple wine to solve the problems of the prior art.

[0006] To solve the above technical problems, the technical scheme adopted by the present application is as follows: a preparation method of selenium-rich apple wine, comprising the following steps:

[0007] S1, preparation of selenium-rich yeast

[0008] After the Pichia kluyveri is activated, a yeast seed solution is obtained, then inoculated in YPD liquid medium, sodium selenite is added, and shaken to obtain selenium-rich Pichia kluyveri bacterial solution;

[0009] S2, preparation of selenium-rich apple wine

[0010] The selenium-rich Pichia kluyveri bacterial solution obtained in S1 is inoculated in apple juice for pre-culture, and then the pre-cultured yeast bacterial solution is inoculated in apple juice, and fermented by standing until the soluble solid content no longer changes, to obtain selenium-rich apple wine.

[0011] Preferably, the Pichia kluyveri strain in S1 is X31-10, and the preservation number is CCTCC NO.M20232532.

[0012] Preferably, the activation method in S1 is as follows: take a cryopreserved tube containing Pichia kluyveri, melt at room temperature, pour into 100mL YPD liquid medium, cultivate at 28℃, 180rpm in a shaking bed for 24h, and continuously cultivate for two generations to obtain the activated yeast seed solution, and the yeast concentration is 1×10 8 ~5×10 8 CFU / mL.

[0013] Preferably, the volume of the yeast seed solution in S1 accounts for 1% of the volume of the YPD liquid medium.

[0014] Preferably, the addition amount of sodium selenite in S1 is 30-50μg / mL based on the volume of the YPD liquid medium.

[0015] Preferably, the temperature of the shaking culture in S1 is 28℃, the rotation speed is 180rpm, and the time is 48-72h.

[0016] Preferably, the apple juice in S2 is sterilized before inoculation by being sterilized at 105℃ for 15min.

[0017] Preferably, in the pre-culture in S2, the volume of the selenium-rich Kluyveromyces marxianus liquid obtained in S1 accounts for 1‰ of the volume of the apple juice to be inoculated, and the pre-culture conditions are: 28℃, 180rpm, 24h, and the yeast concentration in the yeast liquid after pre-culture is 5×10 7 ~1×10 8 CFU / mL.

[0018] Preferably, the volume of the pre-cultured yeast liquid in S2 accounts for 5-10% of the volume of the apple juice to be inoculated.

[0019] Preferably, the temperature of the fermentation in S2 is 18-24℃.

[0020] Compared with the prior art, the present application has the following significant technical effects:

[0021] 1. The present application provides a preparation method of selenium-rich apple wine, which is prepared by fermenting selenium-rich yeast Pichia kluyveri, a non-brewing yeast, to obtain selenium-rich yeast, and then fermenting the selenium-rich yeast to obtain selenium-rich apple wine. The method can not only regulate the ester aroma of apple wine, but also achieve the purpose of food selenium supplementation.

[0022] 2. Pichia kluyveri is a non-brewing yeast suitable for apple wine fermentation, and has excellent aroma-producing performance, especially ester aroma. The present application improves the content of esters, acids, aldehydes and ketones, and terpenes in apple wine by fermenting selenium-rich yeast Pichia kluyveri to prepare selenium-rich apple wine, thereby enriching the flavor of apple wine.

[0023] The present application will be further described in detail below in combination with the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 is a total selenium content test chart of selenium-rich yeast cultured at different selenium-rich concentrations and for different selenium-rich times in Examples 1-3 of the present application;

[0025] Figure 2 is a fingerprint chart of apple wine (Pk) and selenium-rich apple wine (Se-Pk) of the present application based on GC-IMS data;

[0026] Figure 3Cluster heat map of apple juice (AJ), cider (Pk) and Se-enriched cider (Se-Pk) of the present application based on GC-MS data;

[0027] Figure 4 Volatile compound class content results of apple juice (AJ), cider (Pk) and Se-enriched cider (Se-Pk) of the present application. DETAILED DESCRIPTION

[0028] The YPD liquid medium used in the present application has the following formulation: yeast extract powder 1% (w / v), peptone 2% (w / v), glucose 2% (w / v).

[0029] The Pichia kluyveri strain used in the present application was isolated from apple peel, and the isolation and identification process is as follows:

[0030] (1) Isolation and purification

[0031] Apple samples were collected in Qian County, Xianyang City, Shaanxi Province. Under sterile conditions, the apple samples were peeled. About 10 g of the peel sample was placed in a triangular flask containing 90 mL of sterile physiological saline, and shaken in a shaker at a speed of 120 rpm for 30 min to fully elute the microorganisms on the apple peel. Then, 100 μL of the eluate was serially diluted, and 100 μL of the diluted solution was spread on a YPD medium plate containing 100 mg / L chloramphenicol to inhibit bacterial growth. The plate was incubated in a 28°C incubator for 48-72 h, and ten single colonies were randomly selected for streak purification. The purified yeast strain was stored in a liquid medium containing 20% (v / v) glycerol and stored at -80°C for standby use.

[0032] (2) DNA extraction and 26S rDNA D1 / D2 region sequencing

[0033] The purified yeast strain was subjected to DNA extraction using a fungal genomic DNA extraction kit (Bioer Technology Co., Ltd.) combined with lysozyme. The extracted DNA was subjected to PCR amplification against the D1 / D2 region of the yeast genome 26S rDNA using the universal primers NL1 (SEQ ID NO. 1: 5'-GCATATCAATAAGCGGAGGAAAAG-3') and NL4 (SEQ ID NO. 2: 5'-GGTCCGTGTTTCAAGACGG-3'). The amplification product was detected by 1.5% agarose gel electrophoresis (110 V, 40 min), and the qualified PCR product was sequenced.

[0034] The sequence of the yeast strain obtained by sequencing is as follows:

[0035] AAAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCTCACCTAGTGTGCGAGTTGTAAATTGCAGGTTGGAGTCTCGGGTTAGACGTGTGTGCAAGTCCCTTGGAACAGGGTGCCACTGAGGGTGAGAGCCCCGTAKCGTGCATGTCGAYACCTGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCTCGACATGGGATTTACGCATCGTTGCCTCTCGTGGGCGGCGCTCTGGGTTTTTCCTGGGCCAGCATCGGTTTTCGTTGCAGGATAAGGACAATTGGAATGTGGCTCCTCGGAGTGTTATAGCCTTTTGTAGATGCTGCGTATGGGGACCGAGGGCTGCGGCGGACTCGTTTCGTCTCGGATGCTGGCACAACGGCGCAATACCGCCCGTCTTGAAACACGGACCCA (SEQ ID NO. 3).

[0036] The yeast strain is identified by sequence alignment through the NCBI database (http: / / www.ncbi.nlm.nih.gov / blast) as Pichia kluyveri, named Pichia kluyveri X31-10, preserved in the China Center for Type Culture Collection on December 11, 2023, with the preservation number CCTCC NO. M20232532 and the preservation address in Wuhan, China, Wuhan University.

[0037] Example 1

[0038] This example is the preparation of selenium-rich yeast, and the method is as follows:

[0039] The cryopreservation tube containing Pichia kluyveri X31-10 was thawed at room temperature and then poured into 100 mL of YPD liquid medium, and cultured at 28°C and 180 rpm for 24 h in a shaker. Two generations of continuous culture were performed to obtain the activated yeast seed liquid, and the yeast concentration was 1 x 10 8 ~ 5 x 10 8 CFU / mL. 1 mL of the yeast seed liquid was inoculated into 100 mL of YPD liquid medium, and then 30 μg / mL (based on the volume of the YPD liquid medium) of sodium selenite (Na2SeO3) was added. The culture was performed at 28°C and 180 rpm for 48 h, 60 h, and 72 h, respectively. After the culture, the bacteria were collected by centrifugation at 8000 rpm for 10 min, and the precipitate was washed with physiological saline for three times. After freeze-drying with a vacuum freeze-drying machine, the total selenium content of the yeast was determined.

[0040] Example 2

[0041] In this example, the preparation of selenium-rich yeast was performed, and the method was as follows:

[0042] The cryopreservation tube containing Pichia kluyveri X31-10 was thawed at room temperature and then poured into 100 mL of YPD liquid medium, and cultured at 28°C and 180 rpm for 24 h in a shaker. Two generations of continuous culture were performed to obtain the activated yeast seed liquid, and the yeast concentration was 1 x 10 8 ~ 5 x 10 8 CFU / mL. 1 mL of the yeast seed liquid was inoculated into 100 mL of YPD liquid medium, and then 40 μg / mL (based on the volume of the YPD liquid medium) of sodium selenite (Na2SeO3) was added. The culture was performed at 28°C and 180 rpm for 48 h, 60 h, and 72 h, respectively. After the culture, the bacteria were collected by centrifugation at 8000 rpm for 10 min, and the precipitate was washed with physiological saline for three times. After freeze-drying with a vacuum freeze-drying machine, the total selenium content of the yeast was determined.

[0043] Example 3

[0044] In this example, the preparation of selenium-rich yeast was performed, and the method was as follows:

[0045] The cryopreservation tube containing Pichia kluyveri X31-10 was thawed at room temperature and then poured into 100 mL of YPD liquid medium, and cultured at 28°C and 180 rpm for 24 h in a shaker. Two generations of continuous culture were performed to obtain the activated yeast seed liquid, and the yeast concentration was 1 x 10 8 ~ 5 x 10 8CFU / mL: 1 mL of yeast seed solution was inoculated into 100 mL of YPD liquid medium. Then, 50 μg / mL (based on the volume of the YPD liquid medium) of sodium selenite (Na2SeO3) was added. The cells were incubated at 28°C and 180 rpm in a shaker for 48, 60, and 72 hours. After incubation, the cells were centrifuged at 8000 rpm for 10 minutes, and the precipitate was collected. The precipitate was washed three times with physiological saline and freeze-dried in a vacuum freeze dryer. The total selenium content of the yeast was then determined.

[0046] Figure 1 The total selenium content test results of selenium-enriched yeast cultured at different selenium-enriched concentrations and selenium-enriched time in Examples 1 to 3 are shown. Figure 1 As shown, Pichia kluyveri reached the national standard GB1903.21-2016 requirement of 1000-2500 μg / g at 40 μg / mL for 72 hours (1318.40 μg / g), 50 μg / mL for 60 hours (1471.78 μg / g), and 50 μg / mL for 72 hours (1479.55 μg / g). Based on comprehensive considerations, 40 μg / mL for 72 hours was selected as the optimal selenium-enrichment concentration and time.

[0047] Example 4

[0048] This example is a preparation of selenium-enriched apple wine, and the method is as follows:

[0049] S1. Preparation of selenium-enriched yeast

[0050] Take the cryopreserved tube containing Pichia kluyveri X31-10, thaw it at room temperature, pour it into 100mL YPD liquid medium, and culture it in a shaker at 28°C and 180 rpm for 24 hours. Culture it for two generations continuously to obtain the activated yeast seed liquid with a yeast concentration of 1×10 8 ~5×10 8 CFU / mL; 1 mL of yeast seed liquid was inoculated into 100 mL of YPD liquid medium, and then 40 μg / mL (based on the volume of YPD liquid medium) of sodium selenite (Na2SeO3) was added. The culture was shaken at 28°C and 180 rpm for 72 h to obtain a selenium-enriched Pichia kluyveri culture liquid;

[0051] S2. Preparation of selenium-enriched apple wine

[0052] 100 μL of selenium-enriched Pichia kluyveri culture obtained by S1 was inoculated into 100 mL of sterilized apple juice and pre-cultured at 28 °C and 180 rpm for 24 h to obtain a pre-cultured yeast culture with a yeast concentration of 5 × 10 7 ~1×10 8CFU / mL; then the pre-cultured yeast liquid was inoculated into the sterilized apple juice at 5-10% (based on the volume of apple juice to be inoculated), and fermented at 18-24°C, the soluble solids content was measured every day until the soluble solids content no longer changed, which was the fermentation endpoint, after fermentation, centrifuged at 7000 rpm for 10 min, and the supernatant was obtained to obtain Se-enriched cider (Se-Pk), which was stored at -20°C. The sterilization method of apple juice was as follows: sterilized at 105°C for 15 min.

[0053] The selenium content of the fermented cider of this example was determined, and the total selenium content of the Se-enriched cider (Se-Pk) was 104.20 μg / L, which reached the minimum selenium content requirement of Se-enriched wine (reference DB61 / T556-2018).

[0054] Comparative Example 1

[0055] The Pichia kluyveri was not enriched with selenium, and the cider was directly fermented, the method was as follows:

[0056] The cryopreserved tube containing Pichia kluyveri X31-10 was thawed at room temperature and poured into 100 mL of YPD liquid medium, cultured at 28°C, 180 rpm for 24 h, and continuously cultured for two generations to obtain the activated yeast seed liquid, and the yeast concentration was 1×10 8 ~ 5×10 8 CFU / mL; 100 μL of the yeast seed liquid was inoculated into 100 mL of sterilized apple juice, and pre-cultured at 28°C, 180 rpm for 24 h to obtain the pre-cultured yeast liquid, and the yeast concentration reached 1×10 8 ~ 5×10 8 CFU / mL; then the pre-cultured yeast liquid was inoculated into the sterilized apple juice at 5-10% (based on the volume of apple juice to be inoculated), and fermented at 18-24°C, the soluble solids content was measured every day until the soluble solids content no longer changed, which was the fermentation endpoint, after fermentation, centrifuged at 7000 rpm for 10 min, and the supernatant was obtained to obtain Se-enriched cider (Se-Pk), which was stored at -20°C. The sterilization method of apple juice was as follows: sterilized at 105°C for 15 min.

[0057] Three parallel experiments were set for Example 4 and Comparative Example 1.

[0058] 1. Non-volatile compounds of apple juice (AJ), cider prepared in Comparative Example 1 (Pk) and Se-enriched cider prepared in Example 4 (Se-Pk) were determined, as follows:

[0059] Soluble solids (SSC) were determined with a hand refractometer; pH was determined with a pH meter; total acid content was determined by acid-base titration with 0.1 mol / L NaOH solution, and total acid content was calculated as malic acid; total phenol content was determined by Folin-Ciocalteu method, and total phenol content was expressed as gallic acid in mg / L. Ethanol content was determined by gas chromatography (GC) method. The distilled sample was diluted 10 times with 1 mL, and 0.5 mL of n-propanol (internal standard) was added. The GC conditions were as follows: initial column temperature 40 °C for 4 min, 10 °C / min to 200 °C for 2 min. Organic acids were determined by HPLC-2040 with a GL Sciences C18 column. The sample was filtered with 0.22 μm before determination. The chromatographic conditions were as follows: mobile phase 0.01 mol / L ammonium phosphate (pH 2.7 adjusted with phosphoric acid); flow rate 0.7 mL / min; column oven temperature 40 °C; detection wavelength 210 nm. The results are shown in Table 1.

[0060] Table 1. Non-volatile compounds content of apple juice (AJ), apple wine (Pk) and Se-enriched apple wine (Se-Pk)

[0061]

[0062]

[0063] Note: These values represent the mean ± standard deviation. Duncan's new multiple range test (p < 0.05) was used for significance testing. Different letters after the mean values indicate significant differences between the different means in the same row. - means that no difference was detected.

[0064] As shown in Table 1, in terms of non-volatile components, the soluble solids of Se-enriched apple wine were lower than those of non-Se-enriched apple wine. Ethanol is the main end product of sugar metabolism in yeast and plays an important role in the flavor profile of apple wine, especially in promoting its characteristic taste and aroma. The decrease in soluble solids means an increase in ethanol, but the alcohol degree did not change significantly. There was no significant change in pH and acidity before and after Se enrichment. Total phenols in apple wine are important bioactive compounds with antioxidant effects, and the higher the content, the stronger the antioxidant effect of apple wine. There was no significant change in total phenols before and after Se enrichment.

[0065] The results of the determination of organic acids showed that malic acid was the main organic acid in apple juice. Overall, the contents of quinic acid, shikimic acid, lactic acid, acetic acid, fumaric acid and succinic acid increased significantly after fermentation. There was no significant change in fumaric acid and succinic acid before and after Se enrichment. Lactic acid was only produced during fermentation, and the addition of Se may have affected the production of lactic acid. For quinic acid and acetic acid, Se enrichment may have increased the content of these two organic acids. The decrease in pH after fermentation may be related to the increase in the content of organic acids such as acetic acid.

[0066] 2. Volatile compounds determination of apple juice (AJ), apple wine (Pk) prepared in Comparative Example 1 and selenium-enriched apple wine (Se-Pk) prepared in Example 4, respectively, was carried out as follows:

[0067] (1) GC-IMS determination

[0068] 1 mL sample was placed in a 20 mL headspace detection bottle, and after incubation at 60 °C for 10 min at a speed of 500 r / min, sample injection was started.

[0069] GC-IMS analysis conditions: chromatographic column type MXT-WAX (30 m x 0.53 mm, 1 μm), IMS temperature 45 °C, chromatographic column temperature 60 °C, sample needle temperature 85 °C, carrier gas / drift gas N2, analysis time 30 min, automatic sample injection volume 500 μL.

[0070] Gas chromatography conditions: 0-2 min: drift gas 150 mL / min; 2-10 min: drift gas 150 mL / min, carrier gas from 2 mL / min to 10 mL / min; 10-20 min: drift gas 150 mL / min, carrier gas from 10 mL / min to 100 mL / min; 20-30 min: drift gas 150 mL / min, carrier gas 100 mL / min.

[0071] The VOCal software provided with the instrument and the NIST and IMS databases integrated in the application software were used to analyze the volatile substances in the sample.

[0072] The results showed that 75 compounds were detected by GC-IMS technology in terms of volatile compounds, including 22 esters, 12 alcohols, 25 aldehydes and ketones, and 16 other compounds. The fingerprint chart was drawn according to the GC-IMS results ( Figure 2 ), and the darker the color, the higher the concentration of the substance. It can be seen from Figure 2 that the concentration of volatile compounds in the selenium-enriched apple wine is higher, which indicates that selenium enrichment is beneficial to improve the flavor of apple wine. Figure 2Region A represents the substances that have no significant change before and after selenium enrichment, mainly including isoamyl alcohol, isoamyl acetate-D, 2-methyl-1-propanol, etc.; Region B represents the volatile compounds with lower content after fermentation of selenium-enriched, including butyl acetate, ethyl butyrate, butanol and 2-methyl-1-butanol, etc.; and Region C represents the volatile compounds with higher content after selenium treatment, mainly ester substances, such as isobutyl acetate, ethyl propionate, propyl acetate, methyl acetate, butyl acetate, ethyl isobutyrate, hexyl acetate, ethyl acrylate, ethyl isoamyl acetate, ethyl acetate. It can be seen that the addition of selenium is beneficial to the production of ester substances in the fermentation process of cider.

[0073] (2) Gas chromatography-mass spectrometry (GC-MS) determination

[0074] The headspace solid-phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) method was used to determine the volatile substances in the sample. 5 mL of sample, 20 μL of internal standard (final concentration of 4-methyl-1-pentanol 654.2 μg / L) and 0.75 g of sodium chloride were added to a 20 mL headspace bottle.

[0075] Instrument parameters: incubation at 45°C for 30 min, extraction for 50 min. The chromatographic conditions are as follows: oven temperature 40°C (maintained for 5 min), 3°C / min to 100°C, 5°C / min to 240°C (maintained at 240°C for 2 min), carrier gas is helium (1 mL / min, no split injection).

[0076] The volatile compounds were identified by comparison with NIST14 using the software provided by GC-MS. The content of volatile compounds was semi-quantified using 4-methyl-1-pentanol (internal standard). The odor activity value (OAV) of volatile substances was calculated to evaluate their contribution to the aroma of cider.

[0077] The results showed that GC-MS detected 24 esters, 11 alcohols, 8 acids, 8 aldehydes and ketones, 4 terpenes and 10 other compounds, a total of 65 compounds, as shown in Table 2.

[0078] Table 2 Volatile substance content (μg / L) in apple juice (AJ), cider (Pk) and selenium-enriched cider (Se-Pk)

[0079]

[0080]

[0081]

[0082]

[0083] Note: These values ​​represent mean ± standard deviation. Duncan's new multiple range method was used for significance test (p < 0.05). Different letters after the mean indicate significant differences between different means in the same row. - means not detected.

[0084] A cluster heat map was made based on the GC-MS results, such as Figure 3 As shown, the ester concentrations were higher after selenium enrichment, following the same trend as the GC-IMS results. Semi-quantification of internal standards and calculation of compound aroma activity values ​​(OAVs) indicate that an OAV value > 1 indicates a significant contribution to the overall aroma. Volatile compounds with an OAV of 0.1 ≤ < 1 are considered to play a significant role in modulating the aroma of the sample. As shown in Table 2, a total of 18 volatile compounds with an OAV > 1 were identified, including 7 esters. Esters are an important chemical family in cider, contributing positively to the overall quality of cider and primarily contributing to its fruity and floral sensory properties.

[0085] Figure 4 The concentration statistics of volatile compounds in apple juice (AJ), apple wine (Pk) and selenium-enriched apple wine (Se-Pk) are shown in Table 2 and Table 3. Figure 4 As can be seen from the results, the addition of selenium significantly increased the ester content in cider. Ethyl acetate, isoamyl acetate, phenylethyl acetate, ethyl octanoate, and ethyl decanoate were the main esters in cider, and their content was higher after selenium-enriched fermentation. Regarding alcohols, 2,3-butanediol and benzyl alcohol were found at higher levels in selenium-enriched cider, while 3-methylmercaptopropanol was found at higher levels in non-selenium-enriched cider. Other alcohols (such as isoamyl alcohol and phenylethyl alcohol) showed no statistically significant differences. Acids, aldehydes, ketones, and terpenes were all found at higher levels in selenium-enriched samples. Overall, selenium enrichment enriched the flavor of cider.

[0086] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent variation made to the above embodiment based on the essence of the invention technology shall still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A method for preparing selenium-enriched apple wine, characterized in that: The following steps are involved: S1. Preparation of selenium-enriched yeast The yeast seed liquid was obtained after activating Pichia kluyveri, and then inoculated into YPD liquid medium, sodium selenite was added, and the culture was shaken to obtain selenium-enriched Pichia kluyveri liquid; S2. Preparation of selenium-enriched apple wine The selenium-enriched Pichia kluyveri yeast liquid obtained in S1 was inoculated into apple juice for pre-culture, and then the pre-cultured yeast liquid was inoculated into apple juice and allowed to ferment until the soluble solid content no longer changed, thereby obtaining selenium-enriched apple wine.

2. The method according to claim 1, characterized in that The Pichia kluyveri strain described in S1 is X31-10, and its deposit number is CCTCC NO.M20232532.

3. The method according to claim 1, characterized in that The activation method described in S1 is as follows: a cryopreserved tube containing Pichia kluyveri was taken, thawed at room temperature, and poured into 100 mL of YPD liquid medium. The culture was continued in a shaker at 28°C and 180 rpm for 24 h, and two generations were cultured continuously to obtain an activated yeast seed solution with a yeast concentration of 1 × 10 8 ~5×10 8 CFU / mL.

4. The method according to claim 1, wherein The volume of the yeast seed liquid in S1 accounts for 1% of the volume of the YPD liquid medium.

5. The method according to claim 1, wherein The amount of sodium selenite added in S1 is 30-50 μg / mL based on the volume of YPD liquid culture medium.

6. The method according to claim 1, characterized in that The shaking culture in S1 is carried out at a temperature of 28° C., a rotation speed of 180 rpm, and a time of 48 to 72 h.

7. The method according to claim 1, characterized in that The apple juice in S2 was sterilized before inoculation by sterilizing at 105° C. for 15 min.

8. The method according to claim 1, characterized in that During the pre-culture in S2, the volume of the selenium-enriched Pichia kluyveri yeast solution obtained in S1 accounted for 1‰ of the volume of the apple juice to be inoculated. The pre-culture conditions were: 28°C, 180 rpm, 24 h. The yeast concentration in the yeast solution after pre-culture was 5×10 7 ~1×10 8 CFU / mL.

9. The method according to claim 1, characterized in that The volume of the pre-cultured yeast liquid in S2 accounts for 5-10% of the volume of the apple juice to be inoculated.

10. The method according to claim 1, characterized in that The fermentation temperature in S2 is 18°C ​​to 24°C.

Images