Environment-friendly gene editing system capable of automatically realizing non-transgenic element and application of environment-friendly gene editing system

By introducing the Barnase gene driven by a specific promoter into the male and female gametes of plants, gametes containing transgenic elements are killed, the problem of transgenic pollen escape is solved, and the autonomous selection of non-transgenic plants and environmentally friendly gene editing are achieved.

CN120796337AActive Publication Date: 2025-10-17WUHAN UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202411525858.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-10-30
Publication Date
2025-10-17
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively prevent environmental pollution caused by the escape of transgenic pollen, especially in polyploid plants. Traditional methods are unable to completely remove transgenic elements, resulting in exogenous genes polluting the environment.

Method used

The transgenic gamete self-clearance system (pTGAC system) is used to introduce a specific promoter-driven toxic gene Barnase into the male and female gametes of the plant to kill the gametes containing transgenic elements, thereby ensuring the production of transgenic-free plants.

Benefits of technology

It realizes the independent selection and production of non-GMO plants, avoids the contamination of exogenous genes caused by pollen escape, is particularly suitable for polyploid plants and perennial fruit trees, and the system is automated and environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796337A_ABST
    Figure CN120796337A_ABST
Patent Text Reader

Abstract

The invention discloses an environment-friendly gene editing system capable of automatically realizing no transgenic element and application of the environment-friendly gene editing system, and belongs to the technical field of gene engineering. The gene editing system is a gene editing carrier containing a transgenic male gamete poisoning element and a transgenic female gamete poisoning element, wherein the transgenic male gamete poisoning element comprises an AtDUO1 promoter and a modified Barnase gene; and the transgenic female gamete poisoning element comprises an AtDD22 promoter and a modified Barnase gene. When the gene editing system is transfected into a plant, transgenic male gametes and transgenic female gametes can be killed, so that non-transgenic male gametes and non-transgenic female gametes survive and participate in fertilization, and non-transgenic plants are obtained. The gene editing system provided by the invention automatically selects non-transgenic gametes, does not have the problems of pollen escape and environmental pollution caused by exogenous genes, and is an environment-friendly gene editing system.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering technology, in particular to an environment-friendly automatic gene editing system without transgenic elements and application thereof. BACKGROUND

[0002] So far, gene editing technology has been widely used in the modification of animal and plant genomes. In most countries in the world, transgenic plants are still not allowed to be used in agricultural production, and the environmental pollution problem caused by transgenic pollen escape has become one of the main problems of environmental destruction caused by human activities in the twenty-first century. Therefore, the demand for obtaining transgene-free gene editing plants for scientific research and agricultural production is increasingly urgent. At present, the method of obtaining transgene-free plants by selfing multiple generations to separate transgenic elements is time-consuming and laborious, especially when some polyploid plants contain multiple transgenic elements, it is extremely difficult to separate. Professor Zhao Yunde's team of Huazhong Agricultural University tried to solve this problem. His team used 35S-driven pollen sterility gene MGL to prevent transgenic pollen from participating in pollination (HE Y, ZHU M, WANG L, et al., 2018. Programmed Self-Elimination of the CRISPR / Cas9 Construct Greatly Accelerates the Isolation of Edited and Transgene-Free Rice Plants. Mol Plant [J], 11: 1210-1213.), and from the results of his team, 35S-driven pollen sterility gene MGL cannot completely eliminate transgenic pollen. His team later improved their method using OsGEX2 / OsACTIN1 two promoters to drive MGL to eliminate pollen, but from the results, transgenic pollen can still be transmitted to offspring, and the phenomenon of environmental pollution caused by pollen escape may occur (YUBING H, MIN Z, LIHAO W, et al. 2019. Improvements of TKC Technology Accelerate Isolation of Transgene-Free CRISPR / Cas9-Edited Rice Plants. Rice Science [J], 26: 2-17.). Therefore, although Professor Zhao's team has reduced the ratio of transgenic pollen in total pollen, the problem of environmental pollution caused by transgenic pollen escape has not been fundamentally solved.

[0003] Therefore, it is still a long way to go to develop a gene editing method that can achieve gene editing and autonomous separation of transgenic elements, and transgenic pollen is completely sterile without polluting the environment. SUMMARY

[0004] The present application aims to provide a new gene editing system and its application in obtaining transgene-free genetically edited plants. The system can autonomously select transgene-free elements to participate in fertilization, and achieve that the first generation of transgenic plants are all non-transgenic plants without transgenic elements. At the same time, the transgenic first generation plants containing the system are all sterile, so there is no environmental pollution caused by pollen escape.

[0005] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0006] In the first aspect of the present application, an environmentally friendly gene editing system that automatically realizes transgene-free elements is provided, also known as a transgenic gamete self-cleaning (Transgenic Gametes Auto-Clean) system, referred to as pTGAC system. The system is a gene editing vector containing a transgenic gamete self-cleaning expression cassette (pTGAC). Figure 1 The transgenic gamete self-cleaning expression cassette contains a transgenic male gamete (sperm cell) killing element and a transgenic female gamete (central cell) killing element. The transgenic male gamete killing element contains a plant male gamete-specific promoter and a gene capable of killing plant cells; the transgenic female gamete killing element contains a plant female gamete-specific promoter and a gene capable of killing plant cells; the expression of the gene capable of killing plant cells is controlled by the specific promoter; the transgenic male gamete killing element and the transgenic female gamete killing element are transfected into plants, which can kill transgenic male gametes and transgenic female gametes, so that transgenic male gametes and transgenic female gametes survive and participate in fertilization, and transgene-free plants are obtained.

[0007] In some embodiments, the plant male gamete-specific promoter is AtDUO1, and its nucleotide sequence is preferably as shown in SEQ ID NO. 2.

[0008] In some embodiments, the plant female gamete-specific promoter is AtDD22, and its nucleotide sequence is preferably as shown in SEQ ID NO. 3.

[0009] In some embodiments, the gene capable of killing plant cells is a ribozyme Barnase gene. In order to enable the Barnase gene to replicate in E. coli and be available in plant cells, an intron is inserted into the Barnase coding sequence; further, an intron is inserted at the 169th nucleotide of the Barnase coding sequence, and the intron is preferably the second intron of the Arabidopsis AtGCS1 gene. The Barnase with the inserted intron is named mBarnase, and the nucleotide sequence thereof is shown in SEQ ID NO. 1.

[0010] In some embodiments, the gene editing vector includes a gene editing vector based on CRISPR-Cas9, CRISPR-Cas12, ZFN, TALEN, etc. gene editing technology. Further, the gene editing vector is pHEE401E.

[0011] In the second aspect of the present application, the above-mentioned environment-friendly automatic gene editing system without transgenic elements is applied to obtain a transgenic-free gene editing plant.

[0012] In the third aspect of the present application, a method for obtaining a transgenic-free gene editing plant is provided, which comprises the following steps: using the above-mentioned environment-friendly automatic gene editing system without transgenic elements to construct a target gene editing vector, transforming the constructed target gene editing vector into Agrobacterium, and then transfecting the plant with the Agrobacterium to obtain a transgenic-free gene editing plant. Figure 1 B).

[0013] In the fourth aspect of the present application, a selection element for autonomously selecting transgenic-free male gametes is provided, which is the above-mentioned transgenic male gamete (sperm cell) killing element.

[0014] In the fifth aspect of the present application, a selection element for autonomously selecting transgenic-free female gametes is provided, which is the above-mentioned transgenic female gamete (central cell) killing element.

[0015] In the sixth aspect of the present application, the above-mentioned selection element for autonomously selecting transgenic-free male gametes and / or the selection element for autonomously selecting transgenic-free female gametes are applied to prepare a gene editing system without transgenic elements or obtain a transgenic-free gene editing plant.

[0016] Advantages and beneficial effects of the present application: the pTGAC system of the present application is automatically selected for transgenic gametes without human intervention; in particular, it has greater advantages for gene editing of polyploid plants and perennial fruit trees. In addition, the transgenic plant pollen obtained by using the pTGAC system does not contain transgenic elements, and there is no problem of pollen escape and environmental pollution by foreign genes, so the pTGAC system is an environment-friendly gene editing system. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Figure A shows the transgenic gamete self-clearing system and gene editing related elements: DD45::Cas9-E9 ter is the gene editing element, 35S::HgyR is the resistance selection marker, U6::Target-sgRNA is the guide sequence, DUO1::mBar is the transgenic male gamete (sperm cell) killing element, DD22::mBar is the transgenic female gamete (central cell) killing element. Figure B shows the process of obtaining a gene edited plant without transgenic elements: first, expand Agrobacterium containing pTGAC, i.e., the transgenic gamete self-clearing system plasmid, Agrobacterium transfect wild type flowers, culture the seeds obtained in the previous step in hygromycin medium to obtain transgenic positive seedlings, half of the male gametes (i.e., sperm cells containing transgenic elements) and half of the female gametes (i.e., central cells containing transgenic elements) in the flowers of the transgenic positive seedlings die, non-transgenic gametes are fertilized to produce transgenic seeds.

[0018] Figure 2 Figure A: natural state Barnase nucleotide sequence, Figure B: mBarnase sequence after modification and insertion into an intron. Figure C: wild type plant cells, genes are normally transcribed into RNA, RNA guides protein synthesis and functions to maintain cell survival; Figure D: in transgenic plants containing mBarnase, all genes are normally transcribed into RNA, but the Barnase protein degrades RNA, leading to a lack of proteins necessary for cell survival and thus killing the plant cells.

[0019] Figure 3 Figure A: the AtDUO1 promoter starts to have transcriptional activity in the reproductive cells of bicellular pollen, and as the pollen matures, the transcriptional activity of AtDUO1 in sperm cells increases; AtDUO1 is not expressed in the embryo sac, embryo, leaf, stem, and root. Figure B: the AtDD22 promoter has transcriptional activity in the central cell (developed into endosperm after fertilization) and early endosperm; AtDD22 is not expressed in the embryo sac, embryo, leaf, stem, and root.

[0020] Figure 4Figure for autonomous elimination of gametes containing transgenic elements of the present application. Figure A: pollen abortion of transgenic element pAtDUOl :mBarnase; Figure B: statistical analysis of 5 independent transgenic lines all proved that pollen containing transgenic element pAtDUOl :mBarnase were all aborted. Figure C: female gamete abortion of transgenic element pAtDD22:mBarnase; Figure D: statistical analysis of 5 independent transgenic lines all proved that female gamete containing transgenic element pAtDD22:mBarnase were all aborted.

[0021] Figure 5 Structure diagram of pTGAC system for obtaining gene edited plants without transgenic elements, which comprises: gene editing element DD45::Cas9-E9 ter, 35S::HgyR as resistance screening marker, guide sequence element U6::Target-sgRNA, transgenic male gamete (sperm cell) killing element DUOl :mBar, transgenic female gamete (central cell) killing element DD22:mBar.

[0022] Figure 6 Figure for the example of obtaining gene edited plants without pollen contamination and transgenic elements by editing the epidermal hair development regulatory gene GL1 (GL1 mutant, plant surface smooth without epidermal hair). Figure A shows the structure of GL1 gene and the gene editing target. Figure B: five independent lines of different editing methods. Figure C: shows the structure of GL1 protein and its five mutant proteins. Figure D: shows wild type and 5 mutant seedlings. Figure E: five mutants do not contain transgenic elements and thus do not have hygromycin resistance. DETAILED DESCRIPTION

[0023] The following examples further illustrate the present application but should not be construed as limiting the application. Modifications or variations of the method, steps or conditions of the application can be made by those skilled in the art without departing from the spirit and scope of the application

[0024] If not specifically indicated, the technical means used in the examples are conventional means well known to those skilled in the art.

[0025] Example 1: Modification and cloning of mBarnase CDS

[0026] Barnase is a ribonuclease encoded by Bacillus amyloliquefaciens, which has the function of degrading RNA and thus has cytotoxicity. E. coli does not have Barnase resistance, so it is necessary to modify Barnase. In this embodiment, the second intron of Arabidopsis AtGCS1 gene is inserted into the CDS of Barnase at 169bp. The modified Barnase is named mBarnase, and its nucleotide sequence is shown as SEQ ID NO. 1. The structural schematic diagram of Barnase and mBarnase is shown as A, B. Figure 2 E. coli cannot remove introns, so mBarnase cannot be removed by intron in E. coli, and thus has no toxicity and can be correctly cloned in E. coli (Table 1). The intron in mBarnase mRNA can be normally spliced in plant cells and encode Barnase protein to degrade intracellular RNA and thus kill plant cells Figure 2 C, D).

[0027] Table 1: Cloning efficiency of Barnase and modified mBarnase in prokaryotic cells

[0028] Gene sequence Prokaryotic cloning success rate Barnase 0 / 33 mBarnase 41 / 41

[0029] The specific process of Barnase and mBarnase clone verification is as follows: before connecting Barnase and mBarnase, the original pART27 vector is modified, and three restriction endonuclease enzyme cutting sites of Kpn I, Hind III and EcoRI and a transcription termination sequence NOS are sequentially added at the pART27 multiple cloning site to obtain a pART27 vector containing multiple enzyme cutting sites. Under the same conditions, Barnase and mBarnase are cloned by PCR using a forward primer AACGCGTTGGGAGCTCGGTACCATGGCACAGGTTATCAACACGTTTGA and a reverse primer GTGCGGCCGCCTCGAGTCTAGATTATCTGATTTTTGTAAAGGTCTGATAAT, with Barnase and mBarnase synthesized fragments as templates, respectively; after recovering and purifying Barnase and mBarnase, Kpn I is used to connect the PART27 vector by recombination, and Escherichia coli DH5α is transformed and cultured at 37°C for 16 hours; colony PCR detection is performed on Barnase and mBarnase transformants using cloning primers, 33 positive clones are found in 264 Barnase colonies detected, and the 33 positive bacterial plaques are expanded, plasmids are extracted, Sanger sequences are obtained, and sequence comparison shows that the 33 Barnase clones are all core site mutation clones. In the 64 colonies detected, 41 are positive, and the 41 positive bacterial plaques are expanded, plasmids are extracted, Sanger sequences are obtained, and sequence comparison shows that the 41 mBarnase clones are all correct clones.

[0030] Example 2: Cloning and activity identification of AtDUO1 promoter

[0031] AtDUO1 is a plant male reproductive system cell-specific promoter screened in the present application, and has a length of 1232 bp, and the nucleotide sequence is shown as SEQ ID NO. 2.

[0032] The pAtDUOl::AtDUOl-RFP transgenic plant is observed, and it is confirmed that the AtDUOl promoter only has transcriptional activity in the plant male reproductive system cells, and the specific process is as follows: before the AtDUOl promoter is connected, the original pART27 vector is modified, Kpn I, Hind III, EcoRI three restriction endonuclease enzyme cutting sites, and the reporter gene red fluorescent protein RFP coding sequence and the transcription termination sequence NOS are sequentially added at the pART27 multiple cloning site to obtain the pART27 vector containing RFP. The AtDUOl is cloned by PCR using the high-fidelity enzyme Phanta with the Arabidopsis genome as a template, using the forward primer NNNNGGTACCTCCCTCTTGGTAGTAAACTAATGA and the reverse primer NNNNAAGCTTAGGACTTGGGATTGGATCAACCTGATCA; after the AtDUOl fragment is recovered and cut by the restriction endonucleases Kpn I and Hind III, the fragment is connected with the pART27 vector containing RFP which is cut by the same endonucleases, transformed into Escherichia coli DH5a to construct the pAtDUOl::AtDUOl-RFP recombinant plasmid (the AtDUOl promoter of the pAtDUOl::AtDUOl-RFP plasmid specifically drives the expression of the reporter gene RFP in the male gamete (male reproductive cell line)); the plasmid with correct sequencing is transformed into Agrobacterium; the Agrobacterium is cultured and expanded, and the Arabidopsis flower is transfected to obtain the pAtDUOl::AtDUOl-RFP transgenic positive plant. The red fluorescent signal in the roots, stems, leaves, pollen, female gametes and embryos of the pAtDUOl::AtDUOl-RFP plant is observed by laser confocal microscopy, and finally it is confirmed that the AtDUOl is a male gamete-specific promoter (A) that only specifically expresses in the male gamete, that is, the AtDUOl is a plant male reproductive system cell-specific promoter with strong transcriptional activity. Figure 3 A), that is, the AtDUOl is a plant male reproductive system cell-specific promoter with strong transcriptional activity.

[0033] Example 3: Cloning and identification of the AtDD22 promoter

[0034] The AtDD22 is a plant female reproductive system cell-specific promoter screened in the application, and has a length of 968 bp, and the nucleotide sequence is shown as SEQ ID NO. 3.

[0035] The pAtDD22::H2B-GFP transgenic plants were observed to confirm that the AtDD22 promoter only has transcriptional activity in the central cell of the plant female gametophyte. The specific process is as follows: before being connected to the promoter AtDD22, the original pART27 vector was modified, and Kpn I, Hind III, EcoRI three restriction endonuclease enzyme cutting sites and nuclear localization signal H2B coding sequence, reporter gene green fluorescent protein GFP coding sequence and transcription termination sequence NOS were sequentially added at the pART27 multiple cloning site to obtain the pART27 vector with GFP. AtDD22 was cloned by PCR using high-fidelity enzyme Phanta with Arabidopsis genome as template by using forward primer NNNNGGTACCTGTTATTAATGTTCTCGAGAAAAT and reverse primer NNNNAAGCTTACTTTCACGTTTTCTTTTAAACTTTTCT; after the AtDD22 fragment was recovered and digested with restriction endonucleases Kpn I and Hind III, it was ligated with the pART27 vector containing GFP digested with the same endonucleases, transformed into E. coli DH5α to construct the pAtDD22::H2B-GFP recombinant plasmid (the AtDD22 promoter of the pAtDD22::H2B-GF plasmid specifically drives GFP expression in the central cell nucleus of the female gametophyte); the plasmid with correct sequence was transformed into Agrobacterium; the Agrobacterium was cultured and used to transfect Arabidopsis flowers to obtain pAtDD22::H2B-GFP transgenic positive plants. The green fluorescent signal in the roots, stems, leaves, pollen, female gametes and embryos of the pAtDD22::H2B-GFP plants was observed by laser confocal microscopy to finally confirm that AtDD22 is a female gamete-specific promoter (B) that only expresses in the female gamete, i.e. AtDD22 is a plant female gamete-specific promoter with strong transcriptional activity. Figure 3 B), i.e. AtDD22 is a plant female gamete-specific promoter with strong transcriptional activity.

[0036] Example 4: Functional analysis of pAtDUO1::mBarnase

[0037] The present embodiment constructs a transgenic plant pAtDUOl ::mBarnase driven by AtDUOl promoter and mBarnase. The specific process is as follows: before being connected with mBarnase, the original pART27 vector is modified, and three restriction enzyme cleavage sites of Kpnl, Xbal and Hindlll and a transcription termination sequence NOS are sequentially added at the multiple cloning site of pART27. The mBarnase fragment is cloned by PCR with high-fidelity enzyme Phanta and mBarnase as a synthetic fragment, and the mBarnase fragment is recovered and connected to the modified pART27 vector by recombination with the restriction enzyme Kpnl, to form the intermediate vector pART27-mBarnase. The AtDUOl promoter is cloned by PCR with high-fidelity enzyme Phanta and Arabidopsis thaliana genome as a template, using forward primer ACGCGTTGGGAGCTCGGTACCTCCCTCTTGGTAGTAAACTAATGAG and reverse primer TCAAACGTGTTGATAACCTGTGCCATCGCTAATCGATCTCTCTCTCGATTTTG. The AtDUOl gene fragment is recovered and connected to the pART27-mBarnase vector by recombination with the restriction enzyme Kpnl. The plasmid with correct sequencing is transformed into Agrobacterium. The Agrobacterium is expanded and transfected into Arabidopsis thaliana florets, to obtain pAtDUOl ::mBarnase transgenic positive plants. The observation results of pollen of the pAtDUOl ::mBarnase plants show that half of the transgenic pollen in all the five independent transgenic lines (L8, L11, L13, L14 and L19) counted collapses and dies, and FDA staining proves that half of the pollen and male gametes completely lose activity. It is confirmed that pAtDUOl ::mBarnase can effectively clean the male gametes containing the transgenic element, that is, the transgenic male gametes cannot be transmitted to the offspring embryos. Figure 4 A, B). Therefore, the transgenic plants containing the pAtDUOl ::mBarnase transgenic element no longer have pollen escape and gene pollution problems.

[0038] The male gamete lethality rate of the pAtDUOl ::mBarnase transgenic element in the present application is 100%, which is superior to other reports in the prior art.

[0039] Example 5: Functional analysis of pAtDD22::mBarnase

[0040] The present embodiment constructs a transgenic plant pAtDD22::mBarnase driven by AtDD22 promoter. The specific process is as follows: the AtDD22 promoter is cloned by using high-fidelity enzyme Phanta with the forward primer CGCGTTGGGAGCTCGGTACCTGTTATTAATGTTCTCGAGAA and the reverse primer TCAAACGTGTTGATAACCTGTGCCATACTTTCACGTTTTCTTTTAAACTT, and the template being the Arabidopsis genome; after the AtDD22 gene fragment is recovered, the restriction enzyme Kpn I is used to connect the pART27-mBarnase vector by recombination; the plasmid with correct sequencing is transformed into Agrobacterium; the Agrobacterium is cultured and expanded, and the Arabidopsis flower clusters are transfected to obtain the pAtDD22::mBarnase transgenic positive plant. By observing the pAtDD22::mBarnase plant egg cell, the applicant finds that half of the egg cells in all strains of five independent transgenic strains (L3, L7, L12, L14 and L15) are dead and cannot participate in fertilization to develop into seeds. It is confirmed that pAtDD22::mBarnase can effectively clean the egg cells containing the transgenic element Figure 4 C, D), and the offspring embryos are all from embryos not containing the transgenic element.

[0041] The present application first removes the egg cell containing the transgenic element in the form of killing the central cell, and the egg cell containing the pAtDD22::mBarnase transgenic element has a 100% lethality rate. The pAtDD22::mBarnase transgenic element of the present application can be used not only for Arabidopsis and the like to obtain gene editing and plants not containing transgenic elements by flower soaking method, but also for plants obtained by tissue culture method.

[0042] Example 6: Integration of pAtDUO1::mBarnase and pAtDD22::mBarnase with Cas9 system to realize pollen contamination-free and autonomous separation of transgenic elements

[0043] The pTGAC system was constructed in this embodiment, which fused pAtDUOl :mBarnase and pAtDD22:mBarnase elements to achieve no pollen contamination and autonomous segregation of transgenic elements. The construction process of the pTGAC system was as follows: the AtDUOl-mBarnase element was cloned by PCR with the forward primer CCGATGAGATAAACCAATACCATGGTCCCTCTTGGTAGTAAACTAAT, the reverse primer AATGCTTTTATTCACTAGTATAATTATCTGATTTTTGTAAAGGTCTGATAATGG, and high-fidelity Phanta enzyme, with the pAtDUOl :mBarnase plasmid as a template, and then connected into pHEE401E by restriction endonuclease Nco I by recombination to form a new pHEE401E-AtDUOl-mBarnase plasmid, which was reserved after sequencing; the AtDD22-mBarnase-NOS element was cloned by PCR with the forward primer AAACCAAACGCAAATGCTTTTATTCACTAGTATAATGTTATTAATGTTCTCGA, the reverse primer CAGACCTTTACAAAAATCAGATAACCTAGGGATCGTTCAAACATTTGGCAATAA, and high-fidelity Phanta enzyme, with the pAtDD22:mBarnase plasmid as a template, and then connected into pHEE401E-AtDUOl-mBarnase by Spe I to form a new plasmid pHEE401E-AtDUOl-mBarnase-NOS-mBarnase-AtDD22, which was reserved after sequencing, and the new plasmid was named pTGAC. Figure 5

[0044] ​In order to verify whether the pTGAC system can normally perform gene editing function and verify the separation efficiency of the transgenic element, the AtGL1 gene is selected in the embodiment. GL1 regulates the occurrence of plant epidermal hair, and when GL1 is mutated, the plant surface is smooth without epidermal hair. The target point GGAAAAGTTGTAGACTGAGATGG is selected according to the sequence of the target gene; the guide sequence containing the target point is cloned by designing primers according to the target point, the high-fidelity enzyme Phanta and the pCBC-DT1T2 as a template to PCR clone the guide sequence fragment containing the target point; the guide sequence fragment is connected to pTGAC by BsaI single enzyme digestion, and the new plasmid is named as pTGAC-GL1. pTGAC-GL1 is transformed into Agrobacterium by electroporation, and then the Agrobacterium is transfected into Arabidopsis flower clusters. After obtaining T0 seeds, the T0 seeds are cultured on a hygromycin-containing medium, and the GL1 gene of the positive transgenic seedlings is identified. The editing efficiency of the positive seedlings is 31.9% (30 / 94). The specific operation is as follows: primers are designed at both ends of the GL1 target sequence, wherein the forward primer is GL1-F: AGAATACAAGAAAGGTTTATGGACAG, and the reverse primer is GL1-R: AAGTTATGTACCTATTGCCGAGGA. The DNA fragment containing the target point is amplified by PCR using the positive seedling genome as a template; the fragment is sequenced by Sanger, and the transgenic sequence and the wild type sequence are compared; and the editing efficiency of GL1 using the pTGAC system is 31.9% (30 / 94). The seeds of 5 edited plants are cultured on a hygromycin-containing medium, and it is found that all the offspring do not have hygromycin resistance, i.e., do not contain the transgenic element. Figure 6

[0045] The above embodiments are only used to help illustrate the present application, and the embodiments of the present application are not limited by the above embodiments. Any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement modes, and all shall be included in the protection scope of the present application.​

Claims

1. A gene editing system that automatically achieves the absence of transgenic elements, characterized by: The system is a gene editing vector comprising a transgenic gamete self-clearing expression cassette; The transgenic gamete self-clearing expression cassette comprises a transgenic male gamete-killing element and a transgenic female gamete-killing element; The transgenic male gamete-killing element comprises a plant male gamete-specific promoter and a plant cell-killing gene; the plant male gamete-specific promoter is AtDUO1; the nucleotide sequence of AtDUO1 is preferably as shown in SEQ ID NO.2; The transgenic female gamete-killing element comprises a plant female gamete-specific promoter and a gene that kills plant cells; the plant female gamete-specific promoter is AtDD22; the nucleotide sequence of AtDD22 is preferably as shown in SEQ ID NO.

3.

2. The automatic gene editing system without transgenic elements according to claim 1, characterized in that: The gene that kills plant cells is a ribonuclease Barnase gene.

3. The automatic gene editing system without transgenic elements according to claim 2, characterized in that: An intron is inserted into the coding sequence of the Barnase gene.

4. The automatic gene editing system without transgenic elements according to claim 3, characterized in that: The nucleotide sequence of the Barnase gene with the intron inserted is shown in SEQ ID NO.

1.

5. The automatic gene editing system without transgenic elements according to claim 1, characterized in that: The gene editing vectors include gene editing vectors based on CRISPR-Cas9, CRISPR-Cas12, ZFN, and TALEN gene editing technologies.

6. Use of the gene editing system according to any one of claims 1 to 5 in obtaining gene-edited plants without genetically modified organisms.

7. A method for obtaining a non-transgenic gene-edited plant, characterized in that: include: The gene editing system according to any one of claims 1 to 5 is used to construct a target gene editing vector, the constructed target gene editing vector is transferred into Agrobacterium, and the Agrobacterium is then transfected into plants to obtain gene-edited plants without genetic modification.

8. A selection element for autonomously selecting male gametes free of transgenic genes, characterized by: The transgenic male gamete-killing element according to any one of claims 1 to 4.

9. A selection element for autonomously selecting female gametes free of transgenic genes, characterized in that: The transgenic female gametotoxic element according to any one of claims 1 to 4.

10. Use of the selection element according to claim 8 and / or claim 9 in preparing a gene editing system without transgenic elements or obtaining gene-edited plants without transgenic elements.

Citation Information

Patent Citations

  • Method for obtaining seed-free plant by utilizing genetic engineering technology and application thereof

    CN102352372A

  • Self-reproducing hybrid plants

    CN103597080A

  • Methods And Compositions For Modulating Expression Or Activity Of A Rkd Polypeptide In A Plant

    CN104039818A

  • Method and application for rapidly and efficiently obtaining non-transgenic targeted gene mutation plant

    CN109593776A

  • Plant programmed pollen self-cleaning CRISPR / Cas gene editing method

    CN116926109A