Non-tissue culture hairy root induction method suitable for Chinese cabbages with different ploidy and application
By using Agrobacterium rhizogenes to infect Chinese cabbage seedlings through a non-tissue culture method, the operation process was simplified, the efficiency of hairy root induction was improved, the problem of immature genetic transformation system of Chinese cabbage was solved, and gene function analysis and metabolite synthesis were promoted.
Patent Information
- Application Number
- CN202510951479.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-10
- Publication Date
- 2025-10-17
AI Technical Summary
The genetic transformation system for Chinese cabbage is not mature enough, research on tetraploid Chinese cabbage is slow, and existing tissue culture techniques are complicated, which limits the progress of gene function analysis and metabolite synthesis.
A non-tissue culture method was used, in which Agrobacterium rhizogenes K599 transformed with the target vector was used to infect Chinese cabbage seedlings, and transgenic hairy roots were obtained by culturing in the substrate. This simplified the operation process and is applicable to diploid and tetraploid Chinese cabbage.
It reduces operating costs and difficulty, improves the efficiency of hairy root induction, and provides simple and efficient technical support for gene function analysis and metabolite synthesis in Chinese cabbage.
Smart Images

Figure CN120796346A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering technology, and particularly relates to a non-tissue culture hairy root induction method suitable for different ploidy Brassica rapa and application. BACKGROUND
[0002] Brassica rapa L.ssp.pekinensis belongs to Brassica of Cruciferae, has rich vitamins and antioxidant substances, and is an important leaf vegetable. Brassica rapa is usually diploid, and the establishment of polyploid breeding method makes some tetraploid germplasm created. Compared with diploid materials, tetraploid Brassica rapa has low crude fiber content, good palatability and excellent disease resistance, and has good popularization prospect and research value. However, the genetic transformation system of Brassica rapa is not mature enough, and tetraploid Brassica rapa is rarely studied, and the progress of related gene mining and analysis is slow, which hinders the process and development of Brassica rapa biological breeding.
[0003] After Agrobacterium rhizogenes infects the wound site of the plant, the T-DNA fragment in the Ri plasmid of Agrobacterium rhizogenes is inserted into the plant genome, and at the same time, it promotes the accumulation of plant hormones and further produces hair-like adventitious roots with target genes at the wound site, which is an excellent means for functional analysis of target genes in roots. This technology has been widely used in many plants, however, the conventional plant tissue culture technology requires sterile environment and corresponding skill requirements for the operator, which limits the popularization of related technical means to some extent. Therefore, it is of great significance to develop a non-tissue culture hairy root induction method suitable for different ploidy Brassica rapa and application.
[0004] In view of this, the present application is proposed. SUMMARY
[0005] To solve the above technical problems, the present application provides a non-tissue culture hairy root induction method suitable for different ploidy Brassica rapa and application, which can more simply and efficiently analyze the function of target genes in diploid and tetraploid Brassica rapa under non-tissue culture conditions, not only provides a technical means for biological breeding, but also provides a reference for biosynthesis and preparation of anthocyanins and other metabolites.
[0006] Specifically, the technical scheme of the present application is as follows:
[0007] In a first aspect, the present application provides a non-tissue culture hairy root induction method for Brassica rapa, which uses Agrobacterium rhizogenes transformed by a target vector to infect rootless seedlings, continues to culture, and obtains transgenic hairy roots; the Agrobacterium rhizogenes is selected from K599 strain; the infection time is 8-20 min; the rootless seedlings are selected from obliquely cut Brassica rapa seedlings, and the oblique cutting position is located at 1-1.5 cm below the growth point.
[0008] Preferably, the Chinese cabbage seedlings are diploid and / or tetraploid.
[0009] Preferably, the Chinese cabbage seedlings are obtained by sowing full Chinese cabbage seeds in a substrate; the substrate comprises 1-3 parts of grass carbon and 1 part of vermiculite by mass.
[0010] Preferably, the sowing and cultivation conditions in the substrate comprise: 16±1h of day, 23±2℃ of temperature, 12000±1000lx of light intensity; 8±1h of night, 18±℃ of temperature.
[0011] Preferably, the Chinese cabbage seedlings are 7-8 days old, with two fully expanded cotyledons and a hypocotyl length of 2.5-3cm.
[0012] Preferably, the target vector contains a BrPAP2 gene.
[0013] Preferably, the rootless seedlings are infected with the infection solution, and the preparation method of the infection solution comprises: picking positive Agrobacterium rhizogenes transformed with the target vector into LB liquid medium containing corresponding resistance, and culturing at 28±2℃ with 180±20rpm shaking for 16±4h; centrifuging and resuspending, and culturing at 28±2℃ with 180±20rpm shaking for 3±1h; and the OD600 of the infection solution is 1.20±0.01.
[0014] Preferably, after the rootless seedlings are infected with the Agrobacterium rhizogenes transformed with the target vector, the rootless seedlings are inserted into the substrate, 3-4 drops of the infection solution are dropped to the substrate near the insertion, and the cultivation is continued.
[0015] Preferably, after the insertion of the rootless seedlings, the transparent cover is used to cover and keep the moisture, and the dark culture is carried out at a temperature of 23±2℃.
[0016] In the second aspect, the application provides an application of the Chinese cabbage non-tissue culture hairy root induction method in the genetic transformation system research or construction of Chinese cabbage.
[0017] Beneficial effects:
[0018] The present invention provides a non-tissue culture method for inducing hairy roots in Chinese cabbage. The method involves infecting rootless seedlings with Agrobacterium rhizogenes transformed with a target vector and continuing to culture to obtain transgenic hairy roots. The Agrobacterium rhizogenes is the K599 strain, and the infection time is 8 to 20 minutes. The rootless seedlings are obliquely cut Chinese cabbage seedlings, with the cut located 1 to 1.5 cm below the growing point. The advantages of the present invention are that it bypasses the plant tissue culture process and directly uses Chinese cabbage seedlings seeded in a substrate, greatly reducing operating costs and difficulty and simplifying the operational process. The method has high induction efficiency for hairy roots in both diploid and tetraploid Chinese cabbages, is widely adaptable, and provides important technical support for tetraploid Chinese cabbage research. It also provides a theoretical basis for analyzing gene function and the biosynthesis of specific metabolites in Chinese cabbage. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the technical solutions of the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.
[0020] Figure 1 This is a schematic diagram of the process steps of the present invention. From front to back, it includes the cultivation of Chinese cabbage seedlings, the growth state before treatment, the excision of the seedling roots, the state of the rootless seedlings (the dotted line shows the incision effect after bevel cutting), the infection process in the culture dish, the insertion of the infected rootless seedlings into the substrate, the light protection process, and the moisturizing culture after the light protection is completed.
[0021] Figure 2 The following are photographs of the hairy roots of the present invention. Figure A shows the phenotype of the transgenic hairy roots; Figure B shows the magnified observation of the area around the white frame in Figure A using a stereo microscope. The scale bar is 1000 μm.
[0022] Figure 3 The results of the hairy root DNA test in the present invention are shown below. M: Marker; +: Positive control; -: Negative control; 1-4: M124; 5-8: D571. The target band is 750 bp in size.
[0023] Figure 4 The results of anthocyanin content determination in hairy roots of the present invention are shown. M124: diploid Chinese cabbage M124; D571: tetraploid Chinese cabbage D571; CK: control hairy roots; OE: transgenic hairy roots. "nd" means not detected. Statistical analysis was performed using the Student's t-test. **p < 0.01. DETAILED DESCRIPTION
[0024] The application aims to provide a non-tissue culture hairy root induction method suitable for different ploidy Brassica rapa, to establish a stable and efficient hairy root induction method applicable to diploid and tetraploid Brassica rapa, independent of plant tissue culture process, and to provide technical support for rapid analysis of gene function and biosynthesis of metabolites.
[0025] The application provides a non-tissue culture hairy root induction method suitable for different ploidy Brassica rapa, comprising the following steps: 1, constructing a target vector and transforming Agrobacterium rhizogenes; 2, obtaining Brassica rapa seedlings; 3, preparing an infection solution; 4, obtaining and infecting rootless seedlings; and 5, culturing and obtaining hairy roots.
[0026] The above method adopted by the application is suitable for non-tissue culture hairy root induction of different ploidy Brassica rapa, and the method is independent of plant tissue culture technology, simple to operate, short in cycle, and capable of rapidly inducing transgenic hairy roots of diploid and tetraploid Brassica rapa, and can be used for analysis of gene function and biosynthesis of metabolites such as anthocyanins.
[0027] More specifically, the technical scheme of the application specifically comprises the following steps:
[0028] Step 1, constructing a target vector and transforming Agrobacterium rhizogenes: after cloning and constructing a target gene into a functional vector, the recombinant plasmid is transformed into Agrobacterium rhizogenes to obtain positive bacteria.
[0029] Step 2, obtaining Brassica rapa seedlings: fully matured diploid and tetraploid Brassica rapa seeds are sowed in a substrate and cultured under suitable conditions to obtain Brassica rapa seedlings.
[0030] Step 3, preparing an infection solution: positive bacteria are picked into a liquid LB medium containing corresponding resistance, and cultured at 28 DEG C and 180 rpm for 16 hours. After centrifugation at 5000 rpm for 10 minutes, the supernatant is removed, the precipitate is suspended with a suspension buffer, and then cultured at 28 DEG C and 180 rpm for 3 hours to obtain an infection solution.
[0031] Step 4, obtaining and infecting rootless seedlings: the Brassica rapa seedlings in step 1 are quickly cut to remove the root part to obtain rootless seedlings. The rootless seedlings are soaked in the prepared infection solution for infection.
[0032] Step 5, culturing and obtaining hairy roots: the infected rootless seedlings are inserted into a substrate, dark-cultured for 2 days, and then transferred to suitable conditions for culture, and transgenic hairy roots can be obtained after identification.
[0033] Preferably, the Agrobacterium rhizogenes in step 1 is selected from K599 strain, and positive bacteria are obtained after identification by PCR using specific primers.
[0034] Preferably, the substrate component used in step 2 is grass charcoal: vermiculite = 2:1.
[0035] Preferably, the different ploidy of Brassica napus culture condition in step 2 is 16h of day temperature 23℃ (light intensity 12000lx) and 8h of night temperature 18℃.
[0036] Preferably, the Brassica napus seedling in step 2 is 7-8 days old, at which time the two cotyledons are fully expanded and the hypocotyl length is 2.5-3cm.
[0037] Preferably, the positive bacteria in step 3 are first streaked on solid medium containing 50mg / L streptomycin and 50mg / L kanamycin and cultured in a 28℃ incubator for 1-2 days to obtain activated Agrobacterium rhizogenes.
[0038] Preferably, the suspension buffer components in step 3 are: 0.474g / L MS powder, 3.5g / L sucrose, 120μM acetosyringone, 0.02M 2-morpholinoethanesulfonic acid, pH=5.2.
[0039] Preferably, the OD600 of the bacterial solution is adjusted to 1.2 with the suspension buffer in step 3.
[0040] Preferably, when cutting the Brassica napus seedling with a blade in step 4, the position is selected to be 1-1.5cm below the growth point, and an oblique cutting method is used to increase the wound surface area.
[0041] Preferably, in the rootless seedling infection process in step 4, the seedling is placed upright in a culture dish, and the infection solution is poured in so that the cut is completely immersed in the infection solution, the infection time is 12min, and the seedling is shaken several times to ensure sufficient infection, and the leaf part is avoided from contacting the infection solution as much as possible.
[0042] Preferably, the substrate used in step 5 is single vermiculite that is fully water-absorbing, so as to facilitate observation of the hairy roots later.
[0043] Preferably, after the infected rootless seedling is inserted into the substrate in step 5, 3-4 drops of the infection solution in step 3 are dripped onto the substrate near the insertion site.
[0044] Preferably, after the seedling is inserted in step 5, it is covered with a transparent cover for moisture retention, and the dark culture condition is completely covered with black cloth and the temperature is 23℃.
[0045] Preferably, the hairy roots cultured in step 5 are subjected to phenotype identification and molecular identification by PCR and other techniques to obtain positive hairy roots.
[0046] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0047] The endpoints of the ranges and any values disclosed in the specification are not limited to the precise values stated. The ranges or values should be construed to be approximations that allow for significant variation. Various ranges of values are stated in terms of being between two specific values. When values are expressed between two values, it is meant to encompass both the lower range values and the higher range values, as well as the individual values themselves. When individual values are listed, it is meant to encompass both the lower value and the higher value, as well as the individual values themselves.
[0048] In the description of the present application, the description of the terms "one embodiment", "some embodiments", "specific embodiments", or "some specific embodiments" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the embodiments of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any suitable manner in any one or more embodiments or examples. In addition, those skilled in the art can combine and combine the different embodiments or examples described in the present specification and the features of the different embodiments or examples, without contradiction.
[0049] As used herein, "comprise", "comprising", "have", "having", "include", "including", "contain", "containing", and the like, are open-ended terms that are intended to mean including, but not limited to.
[0050] The materials, reagents and the like used in the following examples can be obtained from commercial channels unless otherwise specified. The experimental methods in the examples not marked with specific conditions are usually carried out according to the conventional conditions or the conditions recommended by the manufacturer.
[0051] In the following examples, the Chinese cabbage seeds used in the experiments of the present application are diploid M124 (female parent of selfing line of Chinese cabbage variety "JiBai No. 5") and tetraploid D571, which are provided by the Leafy Vegetable Research Room of the Economic Crop Research Institute of Hebei Academy of Agriculture and Forestry Sciences. The above-mentioned varieties are used for non-tissue culture hairy root induction and application, and the tested genes are selected from anthocyanin synthesis genes BrPAP2.
[0052] In the following examples, the sequences involved include:
[0053] SEQ ID NO. 1:
[0054] ATGGAGGATTCGTCCAAAGGGTTGACAAAAGGTGCATGGACCGCTGAAGAAGACAGTCTCTTGAGGCGATGCATTGATAAGTATGGAGAAGGCAAATGGCATCAAGTTCCTTTAAGAGCTGGGCTTAATAGGTGTAGGAAGAGTTGTAGACTAAGATGGCTGAACTATTTGAAGCCAAATATCAAGAGAGGAAAACTTAGCTCTGATGAAGTTGATCTTCTTCTCCGTCTTCATAAGCTTTTAGGAAACAGGTGGTCTTTAATTGCTGGTAGACTACCCGGTCGGACCGCTAATGATATCAAGAATTACTGGAACACCCATCTGAGCAAGAAACATGAACCATGTTGTAAGACCAAGATGAAGAAGAGAAACGTTACATTCTCTTCTACCACACCCGCCCAAAAAATCGACGTTTTCAAACCTCGACCTCGACTCTTCACCGTTAACAATGGCTGCAGCCATCTCCATGGCCTGCCAGAAGTTGACGTTGTTCCTCCATGCCTTGGACTCAACAACATTAATAATGTCTGTGAAAATAGTATGACATGTAACAAAGCTGGGGAGAAGTATGAACTTTATAGTAATTTAATGGATGGAGAGAATATGTGGTGGGAGAGTTTGCTAGAGGAGAGCAAACAGCCTGACGGGCTCGTTCCAAAAGGTACGGCAACAAAAAAGGGGGCAACCTTTGCGTTTGACGTTGAGCAACTTTGGAATATGTTGGATGGAGAGACTGTAGAACTTGATTAG.
[0055] SEQ ID NO. 1:
[0056] ATGGAGGATTCGTCCAAAGGGTTGA.
[0057] SEQ ID NO. 2:
[0058] ATCAAGTTCTACAGTCTCTCCAT.
[0059] SEQ ID NO. 3:
[0060] CTCGAGGGGGGGCCCGGTACCATGGAGGATTC.
[0061] SEQ ID NO. 5:
[0062] CGATCTGCAGCCCGGTCTAGAATCAAGTTCTA.
[0063] SEQ ID NO. 6:
[0064] GCTCCTACAAATGCCATCA.
[0065] SEQ ID NO. 7:
[0066] AAGAGTCGAGGTCGAGGTTTG.
[0067] Example 1
[0068] This example is the construction of the target vector pCAMBIA1301-35S-BrPAP2 and the transformation of Agrobacterium rhizogenes.
[0069] (1) According to the CDS sequence of BrPAP2, SEQ ID NO. 1, the primers BrPAP2-F (SEQ ID NO. 2) and BrPAP2-R (SEQ ID NO. 3) were designed.
[0070] The PCR amplification system was as follows: 1 μL of cDNA template, 1 μL of BrPAP2-F and 1 μL of BrPAP2-R (the concentration of primers was 10 μM), 10 μL of 2×TransStart FastPfu Fly PCR SuperMix (purchased from Quanshijin Biotechnology Co., Ltd.), and 7 μL of ddH2O.
[0071] The PCR amplification program was as follows: 98 ℃ pre-denaturation for 1 min; 98 ℃ denaturation for 10 s, 60 ℃ annealing for 5 s, 72 ℃ extension for 30 s, 38 cycles; 72 ℃, 1 min; 4 ℃, incubation.
[0072] The product was detected by agarose gel electrophoresis, and the target band was recovered using a gel recovery kit (purchased from Aikangrui Biological Company) to obtain the gene product.
[0073] (2) Using the super-expression vector pCAMBIA1301, selecting the enzyme cutting sites Kpnl and Xbal, and designing specific linker primers (15 bp homologous arm + 6 bp enzyme cutting site + 11 bp BrPAP2 sequence primer) according to the BrPAP2 sequence as pCAMBIA1301-BrPAP2-F (SEQ ID NO. 4) and pCAMBIA1301-BrPAP2-R (SEQ ID NO. 5).
[0074] The PCR amplification system and procedure are the same as (1), with the annealing temperature being 65°C, and other parameters being unchanged. After gel recovery, the added linker product is obtained.
[0075] (3) Selecting the Kpnl and Xbal enzyme cutting sites, double enzyme cutting the super-expression vector pCAMBIA1301, and using a DNA purification kit (purchased from the Genewiz Biotechnology Company) to obtain a linearized vector. The added linker fragment is connected to the pCAMBIA1301 vector (purchased from the Genewiz Biotechnology Company) by means of homologous recombination. The recombination product is transformed into competent cells DH5a (purchased from the Unique Biotech Company), and after sequencing the plasmid, the recombination plasmid pCAMBIA1301-35S-BrPAP2 (Shanghai Sangon Sequencing) is obtained.
[0076] (4) 100 μL of Agrobacterium rhizogenes competent K599 is taken out from the -80°C ultra-low temperature refrigerator, melted to an ice water mixture state at room temperature, and inserted into ice. 3 μL of the pCAMBIA1301-35S-BrPAP2 plasmid is added, gently stirred and mixed, then subjected to ice bath for 5 min, liquid nitrogen rapid freezing for 5 min, 37°C water bath for 5 min, ice bath for 5 min, and then 500 μL of LB liquid medium is added and moved to a 28°C shaker at 200 rpm for 3 h. The supernatant is sucked and beaten, and then coated on LB solid medium (containing 50 mg / L kanamycin and 50 mg / L streptomycin sulfate), and cultured in a 28°C constant temperature incubator for 3 days. The colonies grown on the surface of the culture medium are adjusted to LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L streptomycin sulfate), and after overnight culture, a turbid bacterial solution is obtained, and the preparation of the target bacterial solution is completed. If not used immediately in a short period of time, it can be mixed with sterile 50% glycerol solution in equal amounts and stored in a -80°C ultra-low temperature refrigerator. Before use next time, the bacterial solution is coated on LB solid medium (containing 50 mg / L kanamycin and 50 mg / L streptomycin sulfate) and cultured overnight to activate the bacterial solution.
[0077] Example 2
[0078] This example is an infection process example of diploid Brassica rapa.
[0079] (1) Select no cracks and full of Chinese cabbage M124 (diploid) seeds, sowing to grass charcoal: vermiculite = 2: 1 of the matrix, placed in the light incubator culture, environmental parameters for 16h (light intensity 12000lx) temperature 23℃, night 8h (light intensity 0lx) temperature 18℃. Cultured for 7-8 days or so, as shown, at this time the two cotyledons of Chinese cabbage fully expanded, hypocotyl length 2.5 ~ 3cm. Figure 1
[0080] (2) The K599 rhizobium of Agrobacterium tumefaciens into pCAMBIA1301-35S-BrPAP2 plasmid, add LB liquid medium (containing 50mg / L of kanamycin and 50mg / L of streptomycin sulfate), 28℃, 180rpm shock culture 16h. Then 5000rpm room temperature centrifugal 5min, suspended in the buffer (0.474g / L MS powder, 3.5g / L sucrose, 120μM acetyl-syringone, 0.02M 2-morpholinoethanesulfonic acid, pH = 5.2) to OD600 = 1.5, 28℃, 180rpm vibration culture 3h, obtain the infection liquid.
[0081] (3) As shown in Figure 1 , using a knife blade to quickly remove the root of Chinese cabbage seedlings to obtain the rootless seedlings, and put it in the culture dish. Pour the infection liquid into the culture dish, so that the liquid completely covers the wound site of the rootless seedlings, soak for 15min, during every 3min gently shake the culture dish, complete the infection of the rootless seedlings.
[0082] (4) As shown in Figure 1 , vermiculite as the substrate to fill the hole tray, and poke the small hole. The infected rootless seedlings were gently inserted into the hole, and the infection liquid was slowly dropped into the pores around the seedlings and the surrounding substrate. Cover the transparent cover to keep moist, and use black cloth to shade, in the light incubator dark culture. After 2 days, open the black cloth and continue to culture.
[0083] (5) Wash the surface of the root with water, as shown in Figure 2 , obtain purple hairy roots, sample and freeze in liquid nitrogen. Use CTAB method to extract the DNA of the root, design specific primers 35S-F (SEQ ID NO. 6) and BrPAP2-test-R (SEQ ID NO. 7) on the carrier and gene sequence.
[0084] PCR reaction system: 2 × Taq Master Mix (purchased from Kangwei Century Biotechnology Co., Ltd.) 10μL, each 1μL of detection primer (primer concentration is 10μM), extracted hairy root DNA 1μL, ddH2O 7μL.
[0085] PCR reaction procedure: 94℃ pre-denaturation 4 min; 94℃ denaturation 30 s, 58℃ annealing 30 s, 72℃ extension 30 s, 35 cycles; 72℃, 5 min; 4℃, incubation.
[0086] Imaging by agarose gel, as shown in Figure 3 the target band is 750 bp, and the obtained purple hairy roots are transgenic hairy roots. The anthocyanin content of the hairy roots produced by the diploid Brassica rapa M124 is analyzed by using the hydrochloric acid methanol method (plant proanthocyanidin test kit, purchased from Suzhou Keming Biotechnology Co., Ltd.). Figure 4 It is shown that no anthocyanin is detected in the wild-type hairy roots, while the anthocyanin content in the transgenic hairy roots obtained by the method is significantly increased to 20.3391 μg / g FW( Figure 4 ).
[0087] In summary, the embodiment provides a non-tissue culture hairy root induction method suitable for different ploidy Brassica rapa and application, which can induce transgenic hairy roots of the diploid Brassica rapa M124 under non-tissue culture conditions, and can not only verify the gene function of BrPAP2, but also realize the synthesis of anthocyanin.
[0088] Example 3
[0089] This embodiment is an infection process example of tetraploid Brassica rapa.
[0090] (1) Select Brassica rapa D571 (tetraploid) seeds without cracks and fullness, and sow them in the matrix of grass charcoal: vermiculite = 2:1, and place them in a light incubator for culture. The environmental parameters are 16 h of light (light intensity 12000 lx) at 23℃ during the day and 8 h of light (light intensity 0 lx) at 18℃ at night. Culture for about 7-8 days, at which time the two cotyledons of the Brassica rapa are fully expanded, and the hypocotyl length is 2.5-3 cm.
[0091] (2) The K599 Agrobacterium rhizogenes into which the pCAMBIA1301-35S-BrPAP2 plasmid is transferred is added to LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L streptomycin sulfate), and cultured at 28℃, 180 rpm for 16 h. Then centrifuge at 5000 rpm for 5 min at room temperature, suspend the precipitate in suspension buffer (0.474 g / L MS powder, 3.5 g / L sucrose, 120 μM acetyl-syringone, 0.02 M 2-morpholinoethanesulfonic acid, pH = 5.2) to OD600 = 1.5, and culture at 28℃, 180 rpm for 3 h to obtain the infection liquid.
[0092] (3) Using the way of beveling, the root of Chinese cabbage seedling is cut off by using blade to obtain rootless seedling, and it is stood in the culture dish. The inoculation liquid is poured into the culture dish to cover the wound of rootless seedling completely, and the rootless seedling is soaked for 15 min, and the culture dish is shaken gently every 3 min to complete the inoculation of rootless seedling.
[0093] (4) The vermiculite is used as substrate to fill the hole tray, and the small hole is poked. The inoculated rootless seedling is inserted into the hole gently, and 600 μL of inoculation liquid is absorbed by using the pipette gun and dropped slowly on the pore around the seedling and the substrate around the seedling. The transparent cover is covered to keep the moisture, and the black cloth is used for shading, and the dark culture is carried out in the light culture box. After 2 days, the black cloth is opened to continue the culture.
[0094] (5) The surface of the root is washed with water to obtain purple hairy root, and the DNA of the root is extracted by using CTAB method to carry out PCR identification of the transgenic hairy root. Figure 3 ) The anthocyanin content in the tetraploid Chinese cabbage D571 hairy root is increased to 27.0714 μg / g FW by the method. Figure 4
[0095] In summary, the embodiment provides a non-tissue culture hairy root induction method and application suitable for different ploidy Chinese cabbage, which can induce the transgenic hairy root of tetraploid Chinese cabbage D571 under non-tissue culture condition, and not only can verify the gene function of BrPAP2, but also can realize the synthesis of anthocyanin.
[0096] Finally, it should be noted that: the above embodiments are only the preferred embodiments of the present application, which are used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: the technical solutions recorded in the foregoing embodiments can be modified, or some technical features can be replaced by equivalent; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application; therefore, any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.
Claims
1. A method for inducing hairy roots of Chinese cabbage without tissue culture, characterized in that: Rootless seedlings are infected with Agrobacterium rhizogenes transformed with a target vector, and culture is continued to obtain transgenic hairy roots; the Agrobacterium rhizogenes is selected from the K599 strain; the infection time is 8 to 20 minutes; the rootless seedlings are selected from obliquely cut Chinese cabbage seedlings, with the oblique cutting position being 1 to 1.5 cm below the growing point.
2. The non-tissue culture hairy root induction method of Chinese cabbage according to claim 1, wherein The Chinese cabbage seedlings are diploid and / or tetraploid.
3. The non-tissue culture hairy root induction method of Chinese cabbage according to claim 1 or 2, characterized in that: The Chinese cabbage seedlings are obtained by sowing plump Chinese cabbage seeds in a substrate for cultivation; the substrate comprises 1-3 parts of peat and 1 part of vermiculite by mass.
4. The non-tissue culture hairy root induction method of Chinese cabbage according to claim 3, wherein The conditions for the spot-seeding culture in the substrate include: 16±1h daytime, temperature 23±2℃, light intensity 12000±1000 lx; 8±1h nighttime, temperature 18±℃.
5. The method for inducing hairy roots of Chinese cabbage without tissue culture according to any one of claims 1 to 4, characterized in that: The Chinese cabbage seedlings were 7 to 8 days old, with two cotyledons fully expanded and the hypocotyl length 2.5 to 3 cm.
6. The method for inducing hairy roots of Chinese cabbage without tissue culture according to any one of claims 1 to 5, characterized in that: The destination vector contains BrPAP2 Gene.
7. The method for inducing hairy roots of Chinese cabbage without tissue culture according to any one of claims 1 to 6, characterized in that: The rootless seedlings were infected with an infection solution, and the preparation method of the infection solution included: picking positive rhizogenes transformed with the target vector into an LB liquid culture medium containing the corresponding resistance, shaking and culturing at 28±2°C and 180±20 rpm for 16±4 hours; resuspending by centrifugation, and shaking and culturing at 28±2°C and 180±20 rpm for 3±1 hours; the OD600 of the infection solution was 1.20±0.
01.
8. The method for inducing hairy roots of Chinese cabbage without tissue culture according to any one of claims 1 to 7, characterized in that: After infecting the rootless seedlings with Agrobacterium rhizogenes transformed with the target vector, the rootless seedlings are inserted into the substrate, 3 to 4 drops of infection solution are dripped onto the substrate near the insertion port, and the culture is continued.
9. The non-tissue culture hairy root induction method of Chinese cabbage according to claim 8, characterized in that: After the rootless seedlings are inserted, they are covered with a transparent cover to keep them moist and cultured in the dark at a temperature of 23±2℃.
10. Use of the non-tissue culture hairy root induction method of Chinese cabbage according to any one of claims 1 to 9 in the research or construction of a genetic transformation system of Chinese cabbage.