Soybean eugenol synthesis gene GmEGS and application thereof

Abstract

The application belongs to the field of plant genetic engineering, and particularly relates to a soybean eugenol synthesis gene GmEGS and application thereof. The application provides application of a soybean eugenol synthesis protein GmEGS or a nucleic acid molecule coding the soybean eugenol synthesis protein GmEGS in increasing the content of eugenol in soybean or improving the ability of soybean to resist Phytophthora sojae, the protein GmEGS includes a protein GmEGS1a, a protein GmEGS1c and a protein GmEGS2a, the amino acid sequences of the protein GmEGS1a, the protein GmEGS1c and the protein GmEGS2a are shown in SEQ ID NO. 1-3 in sequence, and the ORF of the nucleic acid includes nucleic acid molecules shown in SEQ ID NO. 4-6. The content of eugenol in soybean can be obviously increased by transforming a soybean plant with the biomaterial of the application, and meanwhile, the disease resistance of soybean to Phytophthora sojae can also be improved. The application provides a good theoretical basis for the molecular mechanism of disease resistance of soybean, and has important significance for molecular design breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the soybean eugenol synthesis gene GmEGS and its applications. Background Technology

[0002] Soybean (Glycine max (L.) Merr.) is one of the world's major crops, an important source of protein and oil for humans and animals. However, its production is severely hampered by a variety of diseases, including root rot and stem rot caused by oomycetes and fungi, and diseases caused by Pseudomonas syringae (…). Pseudomonas syringae pv.) or Xanthomonas violaceum ( Xanthomonas campestris Bacterial diseases induced by Fusarium. Among them, those caused by Fusarium (… Fusarium spp.), Rhizoctonia solani ( Rhizoctonia solani ), Phytophthora indicum ( Phytophthora sojae ) and Pythium ( Pythium Soybean root rot and stem rot caused by pathogens such as *S. spp.* are particularly devastating. These disease complexes lead to symptoms such as damping-off, root and stem rot, yellowing and wilting of lower leaves, and ultimately plant death, causing estimated economic losses of billions of dollars annually worldwide. Bacterial diseases of soybean are another major threat, significantly causing yield losses globally and posing a serious challenge to global food security. Currently, disease control relies primarily on chemical treatments. However, the overuse of chemical agents has led to drug resistance in pathogens, complicating disease management. Furthermore, the widespread use of synthetic fungicides has raised serious concerns about their safety for human health and the environment. Therefore, there is an urgent need to develop sustainable and environmentally friendly disease management strategies to ensure the long-term stability of soybean production.

[0003] Eugenol is a volatile phenylpropanoid compound widely distributed in the plant kingdom, playing a dual role: both a flower attractant to pollinators and a defensive metabolite. It is also a major contributor to the aroma of many fruits. This compound has attracted widespread attention due to its diverse biological activities, including analgesic, antibacterial, antifungal, antioxidant, anti-inflammatory, anticancer, antimutagenic, and insecticidal activities. Numerous studies have demonstrated that eugenol and its derivatives possess broad-spectrum antibacterial activity against plant and human pathogenic fungi. Notably, eugenol exhibits activity against Aspergillus species (…). Aspergillus ), Penicillium ( Penicillium ), genus *Nucleate* ( Emericella Botrytis cinerea ( ), Botrytis cinerea ( Botrytis cinerea ) and Fusarium genus ( Fusarium Eugenol (spp.) and other compounds exhibit potent antifungal activity. Given these properties, eugenol represents a promising candidate for environmentally friendly crop protection.

[0004] The biosynthetic pathway of eugenol has been extensively studied in various plants. Eugenol is synthesized from phenylalanine via a common phenylpropanoid metabolic pathway. The initial step involves the acetylation of coniferyl alcohol by a BAHD family acyltransferase (CFAT), while the final step is catalyzed by eugenol synthase (EGS). EGS is an NADPH-dependent reductase belonging to the PIP family (pinoresinol-lariciresinol reductase, isoflavone reductase, and phenylcoumaran benzylic ether reductase). To date, only a few plant EGS enzymes have been functionally identified, including ObEGS1 from basil (Ocimum basilicum), CbEGS1 and CbEGS2 from Clarkia breweri, PhEGS1 from petunia, and FaEGS1 and FaEGS2 from strawberry (Fragaria). These enzymes produce eugenol in vitro using coniferyl acetate as a substrate. Phylogenetic analysis indicates that these EGS enzymes originate from different branches of a large reductase family. Through transgenic poplar (… Populus Overexpression of PhCFAT and PhEGS in petunia spp. has successfully increased eugenol production. Similarly, overexpression of FaEGS1a, FaEGS2, or ObEGS1 in strawberry fruit has also significantly increased eugenol accumulation.

[0005] Despite these advances, little is known about the specific EGS enzyme responsible for the biosynthesis of eugenol in soybeans and its potential applications in enhancing soybean disease resistance. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention proposes three soybean eugenol synthesis genes, GmEGS, and their applications. This invention provides a valuable example of soybean eugenol's role in crop disease resistance, offering insights into the regulation of pathogen resistance by soybean eugenol. Furthermore, the study of the GmEGS gene provides a sound theoretical foundation for the molecular mechanism of soybean disease resistance, which is significant for molecular design breeding.

[0007] In a first aspect, the present invention provides the application of soybean eugenol synthesis protein GmEGS or nucleic acid molecules encoding soybean eugenol synthesis protein GmEGS in increasing the eugenol content in soybeans or enhancing the soybean's resistance to soybean blight.

[0008] In some embodiments, the protein GmEGS includes protein GmEGS1a, protein GmEGS1c and protein GmEGS2a, and the amino acid sequences of protein GmEGS1a, protein GmEGS1c and protein GmEGS2a are shown in SEQ ID NO. 1-3, respectively.

[0009] In some embodiments, the ORF of the nucleic acid includes nucleic acid molecules as shown in SEQ ID NO.4-6.

[0010] In some embodiments, increasing the activity of soybean eugenol synthesis protein GmEGS or overexpressing the nucleic acid molecule encoding soybean eugenol synthesis protein GmEGS can increase the eugenol content in soybeans or enhance the soybean's resistance to soybean blight.

[0011] Secondly, this invention provides the application of biomaterials containing nucleic acid molecules encoding the soybean eugenol synthesis protein GmEGS in increasing the eugenol content in soybeans or preventing soybean blight, wherein the biomaterial is any one of the following.

[0012] 1) An expression cassette containing the nucleic acid molecules described in the first aspect;

[0013] 2) An expression vector containing the nucleic acid molecules described in the first aspect;

[0014] 3) An expression carrier containing the expression box described in 1);

[0015] 4) Recombinant microorganisms containing the expression vector described in 2);

[0016] 5) Recombinant microorganisms containing the expression vector described in 3).

[0017] In some embodiments, overexpression of nucleic acid molecules encoding the soybean eugenol synthesis protein GmEGS increases the eugenol content in soybeans or enhances the soybean's resistance to soybean blight.

[0018] Thirdly, the present invention also provides a method for increasing the content of eugenol in soybeans and / or preventing soybean blight, the method comprising converting the protein GmEGS or the nucleic acid molecule encoding the soybean eugenol synthesis protein GmEGS, or the biological material described herein, into soybean plant tissues.

[0019] In some embodiments, the conversion is performed using Agrobacterium-mediated transformation.

[0020] In some embodiments, the soybean plant tissue is a seed, cotyledon, or leaf.

[0021] Compared with existing technologies, this invention, through obtaining transgenic soybean plants, demonstrates that the soybean eugenol synthesis protein GmEGS or the nucleic acid molecule encoding GmEGS can increase the eugenol content in soybeans or enhance their resistance to soybean Phytophthora infestans. Utilizing eugenol and its synthetic pathway regulation for crop disease control offers advantages such as high inhibitory activity against plant pathogenic fungi, broad spectrum of action, low phytotoxicity, and harmlessness to mammals. The protein or gene combinations of this invention hold promise as alternatives to chemically synthesized fungicides for the integrated management of important diseases in various crops, vegetables, and ornamental plants, which is of great significance for the development of sustainable agriculture. Attached Figure Description

[0022] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0023] Figure 1 The expression results of the GmEGS gene are shown. GmEGS expression was significantly upregulated in soybeans infected with different pathogens, indicating that GmEGS expression was induced by pathogen infection; among them, *Phytophthora indicum* (soybean blight) showed the highest expression level. Phytophthora sojae ), grain sickle ( Fusarium graminearum ), ultimate humic acid ( Pythium ultimum Rhizoctonia solani ( ) Rhizoctonia solani Xanthomonas ( Xanthomonas ), Xanthomonas pseudoepiplos ( Pseudomonas The vertical axis represents gene expression levels, and the horizontal axis represents pathogen infection time.

[0024] Figure 2 The results of Western blot protein detection for the transgenic strain are shown.

[0025] Figure 3 The experimental results show the eugenol content in wild-type and transgenic materials. The vertical axis represents the eugenol content, and the horizontal axis represents the transgenic line number.

[0026] Figure 4 Photos showing the effects of wild-type and genetically modified materials on soybean disease resistance. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0028] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods or selected according to the product instructions. Unless otherwise specified, the experimental materials used in the following examples are all purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0029] Reagents and materials

[0030] Soybean Plant: Williams 82 was used as a wild-type soybean variety. This variety is an antifungal improvement of the Williams cultivar, jointly developed by the USDA Agricultural Research Service and the Illinois Agricultural Experiment Station. Williams 82 is resistant to all Phytophthora races except for race 25, which was found in Indiana. In 2010, the first soybean reference genome for the Williams 82 cultivar was assembled using a shotgun rig with integrated physical and high-density genetic maps. Williams 82 was introduced and preserved by the Chinese Academy of Agricultural Sciences as a "standard experimental line for soybean research."

[0031] Gene: The GmEGS gene was cloned from Williams82.

[0032] Vector: PFGC5941 vector was purchased from Beijing Huabodeyi Biotechnology Co., Ltd., catalog number VT-3034. For vector details and usage methods, please refer to the product manual. Reference: Kerschen A, Napoli CA, Jorgensen RA, et al. Effectiveness of RNA interference in transgenic plants[J].FEBSletters, 2004, 566(1-3): 223-228.

[0033] Agrobacterium: Agrobacterium strain AGL1 was purchased from the China Plasmid Vector Strain Cell Gene Preservation Center (BiovectorScience Lab, Inc.).

[0034] Reagent kits: Enzyme digestion and recovery kits and other consumables were purchased from New England Biolabs and Tiangen Biotech (Beijing) Co., Ltd.

[0035] Sequencing company: Nanjing Genscript Biotech Co., Ltd.

[0036] Example 1: Quantitative PCR detection of soybean GmEGS gene

[0037] Based on extensive sequence analysis and functional validation, three proteins were identified from the soybean variety Williams82, collectively referred to as GmEGS proteins, and named GmEGS1a, GmEGS1c, and GmEGS2a, respectively. The amino acid sequences of the three proteins are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 of the sequence listing. The genes encoding the GmEGS proteins are collectively referred to as the GmEGS genes, and the ORF sequences of the genes encoding proteins GmEGS1a, GmEGS1c, and GmEGS2a are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6 of the sequence listing.

[0038] To determine whether the GmEGS gene is induced by pathogen infection, samples were collected from different pathogens (including Phytophthora soybean). Phytophthora sojae ), grain sickle ( Fusarium graminearum ), ultimate humic acid ( Pythium ultimum Rhizoctonia solani ( ) Rhizoctonia solani Xanthomonas ( Xanthomonas ), Xanthomonas pseudoepiplos ( Pseudomonas Expression analysis was performed on the samples.

[0039] The quantitative detection system consisted of: 10 μL of 2×ChamQ SYBR Color qPCR Master Mix, 0.4 μL of qRT-PCR Forward Primer, 0.4 μL of qRT-PCR Reverse Primer, 3 μL of cDNA, and 6.2 μL of ddH2O, for a total volume of 20 μL. The PCR reaction program was: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing for 34 s; 40 cycles. The melting curve was: 95℃ denaturation for 15 s, 60℃ annealing for 1 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s. The primers used for quantitative PCR are shown in Table 1.

[0040] Table 1 Primers for Quantitative PCR Detection

[0041]

[0042] Test results as follows Figure 1 As shown, the expression of the GmEGS gene was upregulated inducible by pathogen infection.

[0043] Example 2: Establishment of GmEGS overexpression transgenic soybean plants

[0044] I. Construction of Recombinant Plasmids

[0045] 1. The floral tissue of soybean variety Williams82 was isolated from the plant, RNA was extracted and reverse transcribed to obtain cDNA of the floral tissue of soybean variety Williams82.

[0046] 2. Using the cDNA synthesized in step 1 as a template, perform PCR amplification of one of the genes using primers consisting of EGS1a-F and EGS1a-R, and obtain a PCR amplification product of approximately 969 bp in size.

[0047] EGS1a-F: ATGTTAAGCATTTGCAACCT (5'-3') (SEQ ID NO. 13);

[0048] EGS1a-R: TCACTCAAAAGCAGCAGAGG (5'-3') (SEQ ID NO. 14).

[0049] Using the cDNA synthesized in step 1 as a template, one of the genes was amplified by PCR using a primer pair consisting of EGS1c-F and EGS1c-R, resulting in a PCR amplification product of approximately 933 bp in size.

[0050] EGS1c-F: ATGGGTGAGAAAAGCAAGAT (5'-3')(SEQ ID NO.15);

[0051] EGS1c-R: TCAAGCGAACTGACCAAGGT (5'-3') (SEQ ID NO. 16).

[0052] Using the cDNA synthesized in step 1 as a template, one of the genes was amplified by PCR using a primer pair consisting of EGS2a-F and EGS2b-R, resulting in a PCR amplification product of approximately 933 bp in size.

[0053] EGS2a-F: ATGGCAGGGGACAGCAAGAG (5'-3')(SEQ ID NO.17);

[0054] EGS2a-R: TTAGACAAACTGATTAAGGT (5'-3') (SEQ ID NO. 18).

[0055] The vector used was pFGC5941. The pFGC5941 vector was digested with NcoI and SamI enzymes to directly ligate the exogenous fragment into the digested vector. Based on the sequences of SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, the ORF was amplified by PCR, digested, and then ligated into vectors. After sequencing verification, the three resulting vectors were identified as three GmEGS gene overexpression vectors, which were electroporated into Agrobacterium AGL1. Single colonies were picked and cultured for expansion. After PCR verification, an equal volume of 50% glycerol was added, mixed thoroughly, and stored at -80℃ for later use.

[0056] II. Obtaining GmEGS-overexpressing transgenic plants

[0057] 1. Three recombinant plasmids pFGC5941-GmEGS were introduced into Agrobacterium strain AGL1 using common methods to obtain recombinant Agrobacterium, which was then frozen at -80℃ and stored in glycerol.

[0058] 2. The recombinant Agrobacterium obtained in step 1 was transformed into the recipient plant Williams82 using the cotyledonary node transformation method (Margie M.P. et al. 2004 Assessment of conditions affecting Agrobacterium-mediated soybean transformation using the cotyledonary node explant. Euhytica 136:167-179), and T1 generation seeds were harvested.

[0059] The specific steps are as follows:

[0060] (1) Seed sterilization and germination

[0061] Select plump, round soybean seeds with smooth surfaces and no disease spots and place them in 120mm petri dishes. Place the petri dishes in a desiccator, and add 100ml of sodium hypochlorite solution to a 250ml beaker inside the desiccator. Then, slowly add 4ml of concentrated hydrochloric acid along the edge of the beaker. Immediately close the desiccator lid and sterilize the soybean seeds with chlorine gas for 18 hours. After sterilization, open the lid in a clean bench to blow away any residual chlorine gas. Arrange the sterilized soybean seeds, hilum-side down, evenly in the germination medium, with 30-35 seeds per dish. Then, wrap them in plastic bags, cut off the vents, and place them in a dark incubator at 22℃ for at least 16 hours to germinate.

[0062] (2) Infection by Agrobacterium and co-culture of explants

[0063] Take the germinated seeds, first cut off part of the cotyledons, then cut the seeds longitudinally into two symmetrical parts along the hypocotyl. Under a microscope, gently scrape off a pair of true leaves at the cotyledon node, and finally gently prick the cotyledon node a few times with a scalpel to obtain the explants for transformation.

[0064] After thawing the recombinant Agrobacterium stored in glycerol at -80℃ on ice, use a sterile pipette tip to draw a small amount of bacterial solution in a laminar flow hood and streak it onto YEP solid medium containing 100ug / ml Kan (kanamycin) and 100ug / ml Gen (gentamicin). Activate and culture at 28℃ for 2 days. Then, spread it onto fresh YEP solid medium containing Kan and Gen using a spreader and culture overnight. Finally, resuspend the Agrobacterium cultured overnight in liquid co-culture medium until the OD 600 value is 0.6.

[0065] The prepared explants were placed in a resuspended Agrobacterium culture and incubated overnight in a dark incubator at 22°C. After blotting off the excess culture solution on the surface with sterile filter paper, the cotyledonary segments were laid flat on a solid co-culture medium covered with sterile filter paper and incubated in the dark at 22°C for 5 days.

[0066] The solid co-culture medium consisted of B5 salt, B5 vitamins, 30 g / L sucrose, 0.6 g / L MES (2-morpholinoethanesulfonic acid), 1.6 mg / L 6-BA (benzyladenine), 100 mg / L L-Cys, 0.1 M DDT (bis(p-chlorophenyl)trichloroethane), 0.5 mg / L GA3 (gibberellin), 0.2% (w / v) plant gel (Sigma-P8169), and pH 5.4.

[0067] (3) Obtaining transgenic seedlings

[0068] After co-culturing for 5 days, the cotyledonary nodes were obliquely inserted into bud induction medium I (SI-I), at 25℃, with 16 hours of light and 8 hours of darkness, and a light intensity of 5000-6000 Lux. After 7 days of recovery culture, the excessively long hypocotyls were cut off and the plants were transferred to bud induction medium II (SI-II) containing 8 mg / ml PPT (glufosinate), and cultured for another 14-20 days.

[0069] Cut the clustered shoots from the hypocotyl and transfer them to shoot elongation medium (SEM) containing 4 mg / ml PPT. Incubate at 25°C with a 16-hour light-8-hour dark cycle and a light intensity of 5000-6000 Lux. Subculture every 10 days until the shoots elongate to about 5 cm. Cut off the shoots that have elongated to about 5 cm and insert them directly into rooting medium. Incubate at 25°C with a 16-hour light-8-hour dark cycle and a light intensity of 5000-6000 Lux until the roots elongate to 3-4 cm, ready for transplanting.

[0070] In this step, the composition of each culture medium is as follows:

[0071] The bud induction medium I consisted of B5 salt, B5 vitamin, 30 g / L sucrose, 0.6 g / L MES, 1.6 mg / L 6-BA, 50 mg / L Cef (cephalosporin), 150 mg / L Timentin, 4 g / L glufosinate, 0.2% (w / v) plant gel, and pH 5.7.

[0072] The composition of bud induction medium II was B5 salt, B5 vitamin, 30 g / L sucrose, 0.6 g / L MES, 1.6 mg / L 6-BA, 50 mg / L Cef, 150 mg / L Tim, 8 g / L glufosinate, 0.2% (w / v) plant gel, pH 5.7;

[0073] The shoot elongation medium consisted of MS salts, vitamin B5, 30 g / L sucrose, 0.6 g / L MES, 0.5 mg / L GA3, 1 mg / L ZR (zeatin nucleoside (trans)), 50 mg / L L-Glu, 50 mg / L Asp, 0.1 mg / L IAA (indoleacetic acid), 50 mg / L Cef, 100 mg / L Tim, 4 g / L glufosinate, 0.2% (w / v) plant gel, and pH 5.8.

[0074] The rooting medium consisted of MS salts, vitamin B5, 20 g / L sucrose, 0.6 g / L MES, 50 mg / L L-Glu, 50 mg / L Asp, 1.5 mg / L IBA (indolebutyric acid), 25 mg / L Tim, 0.2% (w / v) plant gel, and pH 5.8.

[0075] (4) Seedling hardening, transplanting and screening

[0076] Remove the sealing film from the tissue culture seedlings to be transplanted, add a small amount of sterile water, and incubate at 25℃ with 16 hours of light and 8 hours of darkness, at a light intensity of 5000-6000 Lux. After two days of cultivation, transplant the seedlings. Mix equal amounts of vermiculite and peat moss evenly, place the mixture in a water-filled tray, then remove the tissue culture seedlings from the rooting medium, rinse off any remaining medium from the roots, and transplant them into fully saturated nutrient soil. Apply soybean leaves with a 0.1% Basta herbicide; plants showing no yellowing reaction after 3 days are considered transgenic positive. From the transgenic positive plants, two transgenic lines are randomly selected, designated as OE-1 and OE-2 (OE stands for overexpressed), for subsequent protein expression identification. Figure 2 ).

[0077] Example 3: Phenotypic analysis of plants overexpressing the GmEGS gene

[0078] Eugenol content determination

[0079] The materials to be identified (GmEGS overexpressing plants and Williams82) were sown in 50 cm diameter pots, with about 10 seeds per pot, and three pots were sown for each material. When the seedlings reached the first compound leaf stage, the poorly growing seedlings were removed, and samples were taken from each pot to determine the eugenol content. The determination method was high performance liquid chromatography-tandem mass spectrometry (HPLC-MS).

[0080] like Figure 3 As shown, the eugenol content in the GmEGS overexpressing transgenic lines was significantly increased compared to the wild type.

[0081] Disease resistance analysis of transgenic materials

[0082] The materials to be identified (GmEGS overexpressing plants and Williams82) were sown in 50 cm diameter pots, with about 10 seeds per pot, and three pots were sown for each material. When the seedlings reached the first compound leaf stage, the seedlings with poor growth were removed, and leaves from each pot were inoculated with Phytophthora soybeanis. The area of ​​the lesions was then observed.

[0083] like Figure 4 As shown, after inoculating wild-type and transgenic lines with Phytophthora indica, the lesion area of ​​the transgenic lines was significantly smaller than that of the wild-type, indicating that the transgenic lines are more resistant to Phytophthora indica infection than the wild-type.

[0084] Unless otherwise specifically stated, the numerical values ​​set forth in these embodiments do not limit the scope of the invention. In all examples shown and described herein, any specific value should be interpreted as merely exemplary and not as a limitation, unless otherwise specified; therefore, other examples of exemplary embodiments may have different values.

Claims

1. The use of a soybean eugenol synthase protein GmEGS or a nucleic acid molecule encoding a soybean eugenol synthase protein GmEGS in increasing the content of eugenol in soybean or increasing the ability of soybean to resist Phytophthora sojae, characterized in that, The soybean eugenol synthesis protein GmEGS is protein GmEGS1a, protein GmEGS1c and protein GmEGS2a, the amino acid sequences of the protein GmEGS1a, protein GmEGS1c and protein GmEGS2a are shown in SEQ ID NO. 1-3 in turn; the nucleic acid molecule is the ORF of the nucleic acid encoding protein GmEGS1a, protein GmEGS1c and protein GmEGS2a, the sequence of the nucleic acid molecule is shown in SEQ ID NO. 4-6 in turn; The application is overexpression of the soybean eugenol synthesis protein GmEGS or overexpression of the nucleic acid molecule encoding the soybean eugenol synthesis protein GmEGS, increasing the content of eugenol in soybean or increasing the ability of soybean to resist Phytophthora sojae.

2. Use of biological material containing a nucleic acid molecule encoding a soybean eugenol synthesis protein GmEGS for increasing the content of eugenol in soybean or for increasing the ability of soybean to resist Phytophthora sojae, characterized in that, The biological material is any of the following, 1) an expression cassette containing a nucleic acid molecule encoding a soybean eugenol synthesis protein GmEGS; 2) an expression vector containing a nucleic acid molecule encoding a soybean eugenol synthesis protein GmEGS; 3) an expression vector containing the expression cassette of 1); 4) a recombinant microorganism containing the expression vector of 2); 5) a recombinant microorganism containing the expression vector of 3); The nucleic acid molecule is the ORF of the nucleic acid encoding protein GmEGS1a, protein GmEGS1c and protein GmEGS2a, the sequence of the nucleic acid molecule is shown in SEQ ID NO. 4-6 in turn; the application is overexpression of the nucleic acid molecule encoding the soybean eugenol synthesis protein GmEGS, increasing the content of eugenol in soybean or increasing the ability of soybean to resist Phytophthora sojae.

3. A method for increasing the content of eugenol in soybean and / or increasing the ability of soybean to resist Phytophthora sojae, characterized by, The method comprises transforming a nucleic acid molecule encoding a soybean eugenol synthesis protein GmEGS into a soybean plant tissue, the nucleic acid molecule is the ORF of the nucleic acid encoding protein GmEGS1a, protein GmEGS1c and protein GmEGS2a, the sequence of the nucleic acid molecule is shown in SEQ ID NO. 4-6 in turn.

4. The method of claim 3, wherein, The transformation is by Agrobacterium.

5. The method of claim 3, wherein, The soybean plant tissue is seed, cotyledon or leaf. The soybean plant tissue is seed, cotyledon or leaf.

Images