Primer and product for detecting and identifying plant lactobacillus, application and method

Abstract

The invention discloses a primer and a product for detecting and identifying plant lactobacillus, application and a method, and relates to the technical field of biological detection. The primers comprise the primers as shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3. According to the invention, the specific primer is designed aiming at the plant lactobacillus, and the primer has high species specificity, can effectively identify the specific DNA sequence of the plant lactobacillus, and avoids cross reaction with other lactic acid bacteria, so that the probability of occurrence of false positive results is obviously reduced. In a complex sample, even if multiple other microorganism DNAs exist, the specific primer provided by the invention can still efficiently amplify the DNA fragment of a target strain, so that the detection sensitivity and accuracy are improved, and a trace amount of plant lactobacillus can be stably detected.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, and in particular to primers and products, applications and methods for detecting and identifying Lactiplantibacillus plantarum. BACKGROUND

[0002] Lactiplantibacillus plantarum is one of the widely used lactic acid bacteria strains, which can perform lactic acid fermentation under certain conditions and convert sugars into lactic acid. At present, the detection and identification of Lactiplantibacillus plantarum mainly rely on traditional culture method, biochemical analysis and molecular biology method. Among them, the primer amplification technology based on polymerase chain reaction (PCR) has become one of the mainstream means due to its high sensitivity, rapidness and specificity. Specific primers are designed for 16S rDNA gene or specific functional genes of Lactiplantibacillus plantarum to realize efficient identification of the strain.

[0003] Although the existing PCR-based detection method has achieved certain results in the identification of Lactiplantibacillus plantarum, there are still some deficiencies: some universal primers have low specificity for Lactiplantibacillus plantarum, and are prone to cross-reaction with other similar lactic acid bacteria, resulting in false positive results. In addition, the existing method is often disturbed by other microbial DNA when dealing with complex samples, and the sensitivity and stability need to be improved. SUMMARY

[0004] In order to solve at least one problem mentioned in the background, the present application provides primers and products, applications and methods for detecting and identifying Lactiplantibacillus plantarum. By designing specific primers for Lactiplantibacillus plantarum, the primers have high species specificity, can effectively identify the specific DNA sequence of Lactiplantibacillus plantarum, avoid cross-reaction with other lactic acid bacteria, and significantly reduce the probability of false positive results.

[0005] The specific technical solutions provided by the embodiments of the present application are as follows:

[0006] In a first aspect, a primer is provided, comprising a primer pair as shown in SEQ ID NO. 1 and SEQ ID NO. 2.

[0007] In a second aspect, a reagent is provided, comprising the primer as described above; the reagent is used for identifying whether a test strain is Lactiplantibacillus plantarum and / or detecting Lactiplantibacillus plantarum in a sample.

[0008] In a third aspect, a kit is provided, comprising the reagent as described above.

[0009] In a fourth aspect, a composition is provided, comprising the primer as described above, a Cas12a protein, a crRNA739 and a ssDNA probe.

[0010] The nucleotide sequence of the crRNA 739 is shown as SEQ ID NO. 3, and the nucleotide sequence of the ssDNA probe is shown as SEQ ID NO. 4.

[0011] In a fifth aspect, there is provided an application of the primer described above, which is any one of a1 to a4:

[0012] a1. Identifying whether a to-be-tested strain is Lactobacillus plantarum;

[0013] a2. Preparing a product for identifying whether a to-be-tested strain is Lactobacillus plantarum;

[0014] a3. Detecting whether Lactobacillus plantarum exists in a to-be-tested sample;

[0015] a4. Preparing a product for identifying whether Lactobacillus plantarum exists in a to-be-tested sample.

[0016] In a sixth aspect, there is provided a method for identifying Lactobacillus plantarum for non-disease diagnosis purposes, comprising the following steps:

[0017] Extracting nucleic acid in a to-be-tested strain or a to-be-tested sample, contacting the nucleic acid with the primer described above or the reagent described above, and performing a PCR amplification reaction, and then judging as follows:

[0018] If there is amplification and the reaction cycle number Ct value is < 30, it is judged that the to-be-tested strain is Lactobacillus plantarum, or that Lactobacillus plantarum exists in the to-be-tested sample;

[0019] If there is no amplification, or there is amplification and the reaction cycle number Ct value is ≥ 30, it is judged that the to-be-tested strain is not Lactobacillus plantarum, or that Lactobacillus plantarum does not exist in the to-be-tested sample.

[0020] In a seventh aspect, there is provided a method for detecting Lactobacillus plantarum for non-disease diagnosis purposes, which uses the composition described above for detection, and the method comprises the following steps:

[0021] Extracting nucleic acid in a to-be-tested strain or a to-be-tested sample, and performing a PCR amplification reaction on the nucleic acid using the primer to obtain a PCR amplification product;

[0022] Preparing a reaction system, which comprises: a PCR amplification product, a Cas12a protein, a crRNA 739, and a ssDNA probe, the PCR amplification product is reacted in the reaction system, and after the reaction is completed, it is judged whether the to-be-tested strain is Lactobacillus plantarum or whether Lactobacillus plantarum exists in the to-be-tested sample.

[0023] In a specific embodiment, after the reaction is completed, judging whether the to-be-tested strain is Lactobacillus plantarum or whether Lactobacillus plantarum exists in the to-be-tested sample comprises:

[0024] If the cleavage reaction of the Cas12a protein exists in the reaction system, it is judged that the tested strain is Lactiplantibacillus or Lactiplantibacillus exists in the tested sample;

[0025] If the cleavage reaction of the Cas12a protein does not exist in the reaction system, it is judged that the tested strain is not Lactiplantibacillus or Lactiplantibacillus does not exist in the tested sample.

[0026] In a specific embodiment, the concentration ratio of the Cas12a to the ssDNA probe is 1: (1-32), and the concentration of the ssDNA probe is 31.25-1000 nM.

[0027] In a specific embodiment, the 5' end of the ssDNA probe is connected with a fluorescent labeling group and the 3' end is connected with a quenching group.

[0028] Beneficial effects:

[0029] (1) The present application designs specific primer pairs (SEQ ID NO. 1 and SEQ ID NO. 2) for Lactiplantibacillus, which has high species specificity and can effectively recognize the unique DNA sequence of Lactiplantibacillus, avoiding cross-reaction with other lactic acid bacteria, thereby significantly reducing the probability of false positive results. In complex samples, even if there are many other microbial DNAs, the specific primers in the present application can still efficiently amplify the DNA fragments of the target strain, improving the sensitivity and accuracy of detection, and ensuring that trace amounts of Lactiplantibacillus can be stably detected.

[0030] (2) The present application optimizes the CRISPR / Cas12a reaction system conditions to improve the detection of Lactiplantibacillus, and combines PCR amplification to improve specificity and sensitivity, the results are simple and fast, and the detection limit is lower; it has potential in the detection of Lactiplantibacillus content, and provides a new scheme for the detection of Lactiplantibacillus content. BRIEF DESCRIPTION OF DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0032] Figure 1 Comparison chart of CRISPR / Cas12a detection results with different PCR reaction cycle numbers in the present application;

[0033] Figure 2 Figure for comparison of detection results of different Cas12a / ssDNA concentration ratios in the present application;

[0034] Figure 3 Figure for comparison of specificity evaluation results in the present application;

[0035] Figure 4 Figure for comparison of sensitivity evaluation results in the present application;

[0036] Figure 5 Figure for comparison of anti-interference results in the present application. DETAILED DESCRIPTION

[0037] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the description of the present application herein only for the purpose of describing specific embodiments, and is not intended to limit the present application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0039] Example 1: Designing specific primers for Lactiplantibacillus

[0040] A specific gene of Lactiplantibacillus was selected: drug / metabolite transporter family gene (DMT family transporter). The DMT family transporter gene sequence of Lactiplantibacillus was downloaded from the National Center for Biotechnology Information (NCBI) website, and the gene sequence (5'-3') is as follows:

[0041] ATGAAGCGTTTAGTTGGAACTCTGTGCGGTATTATTAGTGCCGCTTTATTTGGGCTAGGTGGAATACTAGCACAGCCTTTGTTAAGTGAGCAAGTTCTGACTCCGCAACAGATTGTATTGTTACGGCTGTTAATCGGTGGGGCAATGTTGTTGCTATATCGTAACTTGTTTTTCAAGCAGGCTAGAAAAAGCACGAAAAAGATTTGGACACATTGGCGAATTTTAACACGAATTATGATATACGGCATCGCCGGCTTGTGCACGGCACAAATTGCCTTTTTTTCTGCGATTAATTACAGTAATGCAGCAGTTGCAACTGTTTTTCAGTCCACTAGTCCGTTTATTCTGCTTGTATTTACCGCGCTGAAAGCGAAAAGACTTCCCAGTTTATTAGCAGGAATGAGCTTAATAAGCGCATTGATGGGAATCTGGCTTATTGTTGAATCCGGATTTAAGACCGGATTAATAAAACCGGAAGCAATTATTTTTGGCCTGATTGCGGCTATCGGGGTTATCTTATACACCAAACTACCTGTTCCATTGTTAAACCAAATTGCCGCAGTGGATATTTTGGGATGGGCACTAGTTATTGGCGGTGTGATAGCGTTGATTCACACACCGTTACCAAATTTAGTTAGATTTTCAAAAACGCAGCTTTTAGCGGTTCTTATCATTGTTATTCTAGCCACCGTTGTTGCGTATGATCTTTATTTAGAAAGTTTAAAGCTAATAGACGGATTTCTGGCAACTATGACTGGACTATTTGAACCAATCAGTTCCGTACTTTTTGGCATGTTATTCTTGCACCAAATCTTGGTTCCTCAGGCCTTGGTTGGTATTATATTGGTTGTGGGTGCAATTATGATACTGAATTTACCTCACCATATCACGGCACCTGTTCCCAGCAAAACCTGTCAATGTACGATGTCTAATCAATAG (SEQ ID NO. 5)

[0042] The primer sequence, the crRNA739 sequence and the ssDNA probe sequence are designed and synthesized by using the DMT family transporter gene sequence described above:

[0043] The sequence of the forward primer DMT-F (5'-3') is TACGGCTGTTAATCGGTGGG (SEQ ID NO. 1), and the sequence of the reverse primer DMT-R (5'-3') is ACAGGTGCCGTGATATGGTG (SEQ ID NO. 2).

[0044] The sequence of the crRNA739 (5'-3') is:

[0045] GAAAUUAAUACGACUCACUAUAGGGUAAUUUCUACUAAGUGUAGAUUGGCAACUAUGACUGGACUAUUU (SEQ ID NO. 3).

[0046] The sequence of the ssDNA probe (5'-3') is GATCAAGAGCTA (SEQ ID NO. 4).

[0047] Example 2: Designing a composition for detecting Lactiplantibacillus plantarum

[0048] The composition comprises the forward primer, the reverse primer, the crRNA739, the ssDNA probe and the Cas12a of Example 1.

[0049] The sequence of the forward primer is shown in SEQ ID NO. 1, the sequence of the reverse primer is shown in SEQ ID NO. 2, the sequence of the crRNA739 is shown in SEQ ID NO. 3, and the sequence of the ssDNA probe is shown in SEQ ID NO. 4.

[0050] Further, the ssDNA probe is modified with a fluorescent group and a quenching group at both ends, and the sequence of the DNA probe is 5'-FAM-GATCAAGAGCTA-BHQ1-3'.

[0051] Further, the composition further comprises: 10x Buffer buffer and RNase-free water.

[0052] Example 3: Establishing a method for detecting Lactiplantibacillus plantarum for non-disease diagnosis purposes

[0053] The detection method comprises the following steps:

[0054] Step S1, extracting nucleic acid in the strain to be tested or the sample to be tested, using the primer to perform PCR amplification reaction on the nucleic acid, and obtaining PCR amplification product;

[0055] Step S2, preparing a CRISPR / Cas12a reaction system, the CRISPR / Cas12a reaction system comprising: a PCR amplification product, Cas12a, crRNA739 and ssDNA probe; the PCR amplification product is reacted in the reaction system, after the reaction is completed, it is judged whether the Lactobacillus plantarum exists in the bacteria liquid to be detected.

[0056] If the cleavage reaction of Cas12a protein exists in the reaction system, it is judged that the tested strain is Lactobacillus plantarum, or the Lactobacillus plantarum exists in the tested sample;

[0057] If the cleavage reaction of Cas12a protein does not exist in the reaction system, it is judged that the tested strain is not Lactobacillus plantarum, or the Lactobacillus plantarum does not exist in the tested sample.

[0058] The primers used in the above detection method include forward primers and reverse primers. The sequences of the forward primers, the reverse primers, the crRNA739 and the ssDNA probe are the sequences of the forward primers, the reverse primers, the crRNA739 and the ssDNA probe in Example 1.

[0059] Specifically, in step S1, the PCR amplification reaction system is: 5-10 μL 10x Buffer (Mg 2+ plus), 4 μL dNTP Mixture (2.5 mM each), 0.625-1.50 μL 10 μM forward primer DMT-F, 0.625-1.50 μL 10 μM reverse primer DMT-R, 0.25 μL TaKaRa Taq (5 U / μL), and RNase-free water is added to 50 μL.

[0060] Specifically, in step S1, the PCR amplification reaction conditions are: 94℃ pre-denaturation for 3 min; 94℃ reaction for 20 sec, 64.5℃ reaction for 30 sec, 72℃ reaction for 40 sec, the cycle number is set to 30 cycles; 72℃ extension for 10 min.

[0061] Specifically, in step S2, the CRISPR / Cas12 reaction system comprises Cas12a 31.25 nM, crRNA739 125 nM, ssDNA probe (5'-FAM-GATCAAGAGCTA-BHQ1-3') 31.25-1000 nM with modified fluorescent group and quenching group, 10x Buffer buffer, PCR product and RNase-free water per 20 μL. The reaction temperature of the PCR amplification product in the CRISPR / Cas12a reaction system is 37℃, and the reaction time is 40 min.

[0062] Example 4: Strain genomic DNA extraction

[0063] (1) Liquid culture of strains: The strains (as shown in Table 1) purchased from China Industrial Microbial Culture Collection Center and China General Microbiological Culture Collection Center were activated and preserved in glycerol tubes. During the experiment, 100 μL of each strain was inoculated into the corresponding sterile liquid medium for culture. The liquid medium formula: 52.4 g of MRS broth medium was weighed, and distilled water was added to 1 L, the pH was adjusted to 6.0-6.2, and high-pressure steam sterilization was performed at 115°C for 15 min, and then cooled for standby.

[0064] (2) 1 mL of bacterial liquid cultured for 24 h was taken, and the bacterial DNA was extracted using the Ezup column bacterial genomic DNA extraction kit.

[0065] Table 1: Experimental strain table

[0066]

[0067] Example 5: Verification of the effectiveness of the forward primer DMT-F and the reverse primer DMT-R in Example 1

[0068] (1) Establishment of qPCR method

[0069] The qPCR amplification reaction system, 20 μL each, includes: 1 μL of each strain DNA template, 0.25-0.60 μL of 10 μM forward primer DMT-F, 0.25-0.60 μL of 10 μM reverse primer DMT-R, 10 μL of 2x Universal SYBR Green qPCR Master mix, and RNase-free water to make up to 20 μL.

[0070] The qPCR amplification program is: 95°C pre-denaturation for 2 min; 95°C reaction for 10 sec, 64.5°C reaction for 30 sec, 72°C reaction for 40 sec, and the number of cycles is set to 40 cycles.

[0071] The DNA of Pediococcus pentosaceus, Bacillus amyloliquefaciens, Bacillus subtilis, Lactococcus lactis and Lactobacillus plantarum extracted by the Ezup column bacterial genomic DNA extraction kit was selected as the strain DNA template.

[0072] (2) Detection results

[0073] The reaction cycle number Ct value results of qPCR detection are shown in Table 2, and the amplification curve is shown in Figure 3 (B). The average Ct value of Lactobacillus plantarum reaching the detection threshold is 18.94±0.10, while the average Ct values of Pediococcus pentosaceus, Bacillus amyloliquefaciens, Bacillus subtilis and Lactococcus lactis are all greater than 30. Combined with 2 and Figure 3(B)It can be seen that the genome DNA of P. acidilactici can be amplified specifically, while the genome DNA of P. pentosaceus, B. amyloliquefaciens, B. subtilis and P. acidilactic cannot be amplified specifically, which further proves that the forward primer DMT-F and the reverse primer DMT-R can specifically detect P. acidilactici.

[0074] Table 2 Ct values of the specific primers DMT-F and DMT-R for 5 strains in qPCR detection

[0075] Strain name Ct mean Lactiplantibacillus 18.94±0.10 Pediococcus pentosaceus 35.28±1.00 Bacillus amyloliquefaciens 36.62±0.75 Bacillus subtilis 30.36±0.17 Pediococcus acidilactici 32.92±0.68 ddH2O 34.65

[0076] Example 6: Verification of CRISPR / Cas12a detection effect under different PCR reaction cycle numbers

[0077] The PCR amplification reaction system and the PCR amplification reaction conditions in Example 3 were used, and the DNA of P. acidilactici was used as the strain DNA template to perform amplification to obtain the PCR amplification product. The SanPrep column DNA gel recovery kit was used to recover and purify the PCR amplification product, and the concentration of the PCR amplification product after recovery and purification was 75 nM. The PCR amplification product was diluted into samples with different concentrations of 75 nM, 7.5 nM, 0.75 nM and 0.075 nM, respectively, and 20, 25, 30 and 35 cycles were set for the amplification detection of the samples with different concentrations of 75 nM, 7.5 nM, 0.75 nM and 0.075 nM, respectively, to form four groups of different cycle numbers.

[0078] The CRISPR / Cas12 reaction system in Example 3 was used, and 16 groups of different experimental groups were set. The difference between the 16 groups of experimental groups is that the PCR product in the CRISPR / Cas12 reaction system is different, specifically, the PCR product used is derived from the results of different concentrations of samples after amplification with different cycle numbers. Specifically, the sample concentrations are 75 nM, 7.5 nM, 0.75 nM and 0.075 nM, respectively, and each concentration is subjected to 20, 25, 30 and 35 cycles of amplification, respectively, to form 4 (concentrations) x 4 (cycle numbers) = 16 groups of different PCR products.

[0079] The cutting rate of Cas12a protein represents the rate of the reaction, and the CRISPR / Cas12a detection results of different cycle numbers 20, 25, 30 and 35 cycles are shown in Figure 1 Figure 1 ​It can be seen that the detection values of different concentrations of samples are not much different when the cycle number is 35, and 75nM, 7.5nM, 0.75nM and 0.075nM different concentrations of samples cannot be effectively distinguished. When the cycle number is 30, 75nM, 7.5nM, 0.75nM and 0.75nM different concentrations of samples can be distinguished obviously due to different detection values, and the detection effect when the cycle number is 30 is better than that when the cycle number is 20 or 25, so the PCR amplification effect is best when the PCR reaction cycle number is 30.

[0080] Example 7: Verification of detection effect of CRISPR / Cas12a detection system under different Cas12a:ssDNA probe concentration ratios

[0081] The PCR amplification reaction system and PCR amplification reaction conditions in Example 3 were used, and the DNA of Lactobacillus plantarum was used as the strain DNA template to amplify to obtain the PCR amplification product. The SanPrep column DNA gel recovery kit was used to recover and purify the PCR amplification product, and the concentration of the PCR amplification product after recovery and purification was 25nM. The recovered and purified PCR amplification product was divided into 7 groups.

[0082] Based on the CRISPR / Cas12 reaction system in Example 3, 7 groups of experimental groups with different concentration ratios of Cas12a and ssDNA probe were set, and the PCR products in the 7 groups of experimental groups were derived from the above-mentioned 7 groups of PCR amplification products. The concentration ratios of Cas12a / ssDNA probe in the 7 groups of experimental groups were 1:1, 1:4, 1:8, 1:12, 1:16, 1:24 and 1:32, respectively.

[0083] The cutting rate of Cas12a protein was used to represent the rate of the reaction, and the detection results of the CRISPR / Cas12a detection system under different Cas12a:ssDNA probe concentration ratios were as shown in Figure 2 When the concentration ratio of Cas12a:ssDNA probe was 1:24, the cutting rate of Cas12a protein was the largest.

[0084] Example 8: Verification of specificity and sensitivity of CRISPR / Cas12a reaction system

[0085] (1) Verification of specificity

[0086] The detection method in Example 3 was used, and the number of PCR reaction cycles was set to 30, and the concentration ratio of Cas12a:ssDNA probe was set to 1:24, to verify the specificity and sensitivity of the RISPR / Cas12a reaction system. The genomic DNA of 11 strains shown in Table 1 was extracted, and the 11 strains were subjected to PCR amplification and CRISPR / Cas12a reaction system reaction to verify the specificity of the CRISPR / Cas12a reaction system, and the detection results were obtained. The detection results are shown in Figure 3 (A), wherein Figure 3 In (A), NTC refers to "No Template Control", i.e. no template control. It can be seen from Figure 3 (A) that only rs-3: Lactiplantibacillus plantarum produces a cleavage reaction of Cas12a protein in the CRISPR / Cas12a reaction system, and the other strains do not produce a reaction.

[0087] (2) Verify the sensitivity

[0088] 4x10 8 CFU of Lactiplantibacillus plantarum was used to extract the genomic DNA of Lactiplantibacillus plantarum, and at this time the extracted DNA was 4x10 8 CFU of total DNA, and the concentration was diluted to 1x10 6 , 1x10 5 , 1x10 4 , 1x10 3 , 1x10 2 , 1x10 1 , 1x10 0 CFU, respectively. The detection method in Example 3 was used, and the number of PCR reaction cycles was set to 30, and the concentration ratio of Cas12a:ssDNA probe was set to 1:24, to determine the detection limit (LOD) of the CRISPR / Cas12a reaction system by PCR amplification and CRISPR / Cas12a reaction system for different samples. The detection results are shown in Figure 4 (A) and Figure 4 (B).

[0089] It can be seen from Figure 4 (A) and Figure 4 (B) that the linear equation of the cleavage rate of Lactiplantibacillus plantarum in the concentration range of 1x10 1 ~1x10 5 CFU / mL is y=687.2x+2520 (in this equation, x is the Lg concentration, and y is the cleavage rate), and the correlation coefficient R 2 is 0.9929, indicating that in the concentration range of 1x10 1 ~1x10 5 CFU / mL, the cleavage rate is linear.The concentration of Lg in the range of CFU / mL has a linear relationship with the cleavage rate. The detection limit of the method is 10 CFU / mL, and the detection range is 1 x 10 1 ~ 1 x 10 5 CFU / mL.

[0090] Example 9: Anti-interference detection of CRISPR / Cas12a reaction system

[0091] The DNAs of 10 strains in Table 1 except for L. plantarum were mixed, and the DNAs of each bacterial solution were diluted to the same concentration and 40 ng of each was mixed to obtain a first mixed bacterial DNA sample. The DNAs of the L. plantarum solution and the first mixed bacterial DNA were mixed in different volume ratios, and mixed bacterial DNA samples with the same total volume but different volume fractions of the DNAs of the L. plantarum solution, i.e., 25%, 50%, 75%, 87.5%, and 100%, were prepared for subsequent detection and analysis.

[0092] The detection method in Example 3 was used, the number of PCR reaction cycles was set to 30, and the concentration ratio of Cas12a:ssDNA probe was set to 1:24. The PCR amplification and CRISPR / Cas12a reaction system were determined for different mixed bacterial DNA samples, and the stability of the CRISPR / Cas12a reaction system was determined. Figure 5 (A) and Figure 5 (B) shown in.

[0093] As can be seen from Figure 5 (A) and Figure 5 (B), the linear equation of the cleavage rate of the mixed bacterial DNA detection at different volume fractions is y = 118.1x + 17643 (in this equation, x is the volume percentage, and y is the cleavage rate), and the correlation coefficient R 2 is 0.9975, and the cleavage rate has a linear relationship with the volume percentage, indicating that the cleavage rate of the Cas12a protein of the mixed bacterial DNA sample at different volume fractions has stability, and the CRISPR / Cas12a reaction system has feasibility.

[0094] Although the preferred embodiments in the embodiments of the present application have been described, those skilled in the art can make further changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted as including all changes and modifications falling within the scope of the embodiments of the present application.

[0095] Obviously, many modifications and variations of the present application are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the appended claims and their equivalents, the application can be practiced otherwise than as specifically described.

Claims

1. A primer, characterized in that The primer pair includes SEQ ID NO.1 and SEQ ID NO.

2.

2. A reagent, characterized in that The method comprises the primers as claimed in claim 1; the reagent is used to identify whether the strain to be tested is Lactobacillus plantarum and / or to detect Lactobacillus plantarum in a sample.

3. A kit, characterized in that Comprising the reagent as claimed in claim 2.

4. A composition, characterized in that Comprising the primers as claimed in claim 1, Cas12a protein, crRNA739 and ssDNA probe; Among them, the nucleotide sequence of the crRNA739 is shown as SEQ ID NO.3, and the nucleotide sequence of the ssDNA probe is shown as SEQ ID NO.

4.

5. An application based on the primer according to claim 1, characterized in that, The application of the primer is any one of the following a1 to a4: a1. Identify whether the test strain is Lactobacillus plantarum; a2. Preparation for identifying whether the test strain is a product of Lactobacillus plantarum; a3. Detecting the presence of Lactobacillus plantarum in the test sample; a4. Prepare a product for identifying the presence of Lactobacillus plantarum in a test sample.

6. A method for identifying Lactobacillus plantarum for non-disease diagnosis purposes, characterized in that: The following steps are involved: Extract nucleic acid from the strain to be tested or the sample to be tested, contact the nucleic acid with the primers according to claim 1 or the reagent according to claim 2, perform PCR amplification reaction, and then make the following judgment: If amplification occurs and the reaction cycle number Ct value is less than 30, it is determined that the strain to be tested is Lactobacillus plantarum, or Lactobacillus plantarum exists in the sample to be tested; If there is no amplification, or if there is amplification and the reaction cycle number Ct value is ≥30, it is determined that the strain to be tested is not Lactobacillus plantarum, or Lactobacillus plantarum does not exist in the sample to be tested.

7. A method for detecting Lactobacillus plantarum for non-disease diagnosis purposes, characterized in that: The method uses the composition according to claim 4 for detection, and the method comprises the following steps: Extracting nucleic acid from the strain to be tested or the sample to be tested, and performing a PCR amplification reaction on the nucleic acid using primers to obtain a PCR amplification product; A reaction system is prepared, wherein the reaction system includes: a PCR amplification product, a Cas12a protein, crRNA739, and an ssDNA probe, and the PCR amplification product is reacted in the reaction system. After the reaction is completed, it is determined whether the strain to be tested is Lactobacillus plantarum or whether Lactobacillus plantarum is present in the sample to be tested.

8. A method for detecting Lactobacillus plantarum for non-disease diagnosis purposes as claimed in claim 7, characterized in that: After the reaction is completed, determining whether the strain to be tested is Lactobacillus plantarum or whether Lactobacillus plantarum exists in the sample to be tested includes: If there is a cleavage reaction of the Cas12a protein in the reaction system, it is determined that the strain to be tested is Lactobacillus plantarum, or Lactobacillus plantarum is present in the sample to be tested; If there is no cleavage reaction of the Cas12a protein in the reaction system, it is judged that the strain to be tested is not Lactobacillus plantarum, or Lactobacillus plantarum is not present in the sample to be tested.

9. A method for detecting Lactobacillus plantarum for non-disease diagnosis purposes as claimed in claim 7, characterized in that: The concentration ratio of the Cas12a to the ssDNA probe is 1: (1-32), and the concentration of the ssDNA probe is 31.25-1000 nM.

10. The method for detecting Lactobacillus plantarum for non-disease diagnosis purposes according to claim 7, wherein: The 5' end of the ssDNA probe is connected to a fluorescent labeling group and the 3' end is connected to a quenching group.

Images