Fluorescent RPA (recombinase polymerase amplification) detection kit for detecting ichthyophthirius multifilis and application method

Abstract

The invention belongs to the technical field of agricultural and aquatic organism detection, and particularly relates to a fluorescent RPA (recombinase polymerase amplification) detection kit for detecting ichthyophthirius multifilis and an application method. Compared with a traditional PCR technology, the detection kit and the detection method have the advantages that the operation steps are greatly simplified, after RPA amplification is finished, the result can be directly interpreted through a real-time fluorescence signal, subsequent analysis operation such as uncovering or electrophoresis is not needed, cross contamination among different amplification products is avoided, false positive results are reduced, and the detection accuracy is improved. And the detection efficiency and accuracy are greatly improved. In the aquaculture industry, the innovative RPA kit can greatly improve the on-site rapid detection capability of ichthyophthirius multifilis, a solution which is efficient, simple, convenient and low in cost and does not need cold chain transportation is provided, and the urgent demand of the modern breeding industry for rapid and accurate pathogen detection is met.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural and aquatic biological detection, and particularly relates to a fluorescent RPA detection kit for detecting Ichthyophthirius multifeldianus and an application method thereof. Background Art

[0002] Multi-species Ichthyophthirius ( Ichthyophthirius multifiliis ) is a parasite widely distributed in freshwater bodies, primarily parasitizing the gills, fins, and skin of fish. It is highly pathogenic and causes Ichthyophthirius punctatus (commonly known as "white spot disease") in freshwater fish. Infection with this parasite causes characteristic white particles to appear on the gills and body surface of fish, and in severe cases, can lead to fish mortality. According to existing research, traditional detection methods include microscopic examination and direct observation of fish pathological symptoms, but these methods often have drawbacks such as complex procedures, poor sensitivity, and delayed results.

[0003] Jinan University's patent CN 115181803 B, "Taqman probe qPCR primer set and application for detecting Ichthyophthirius multifellows," and Fuzhou Ocean and Fisheries Technology Center's patent CN 118028506 A, "A goldfish-derived Ichthyophthirius multifellows dual TaqMan probe fluorescence quantitative PCR detection kit," require approximately one hour to complete detection, while the method of the present invention can complete detection in just 20 minutes. Furthermore, the reagents used in this method are freeze-dried, eliminating the need for cold chain transportation and low-temperature storage.

[0004] The Institute of Hydrobiology, Chinese Academy of Sciences, has patent CN 115807112 A, "A primer set for identifying and quantitatively detecting multi-sperm Ichthyophthirius and its application." This method is costly and has a narrow application range for ddPCR, with most applications in laboratories.

[0005] Patent CN 105524996 A of the Chinese Acipenser Research Institute of China Three Gorges Corporation is "A method for rapid detection of Ichthyophthirius punctatus in water bodies". Ordinary PCR operation is complex and has low sensitivity, and is prone to aerosol pollution.

[0006] Patent CN 118755845 A of the Zhejiang Freshwater Fisheries Research Institute, "LAMP-LFD primer probe set, kit and application for detecting multi-sperm Ichthyophthirius," has certain advantages in field applications, but there is still room for improvement in terms of specificity. Non-specific amplification may occur in some cases, affecting the accuracy of the test results.

[0007] Existing methods for detecting Ichthyophthirius multifellows, including molecular biology techniques such as TaqMan probe qPCR, dual TaqMan probe fluorescence quantitative PCR, ddPCR, conventional PCR, and LAMP, have improved detection sensitivity to a certain extent, but still have some common shortcomings and challenges: Insufficient sensitivity: Although PCR methods can improve sensitivity, impurities and inhibitors in the sample can affect the detection results, leading to false negatives.

[0008] Complex operation: Traditional molecular detection methods, such as real-time fluorescent PCR, usually require expensive equipment and complex experimental procedures, which are not suitable for on-site rapid detection.

[0009] Long time: The amplification process of PCR methods usually takes a long time, and methods such as LAMP have difficulties in operation and incomplete amplification, resulting in low detection efficiency.

[0010] In addition, the above reagents also require cold chain transportation and low temperature storage. Their detection technology still relies on strict cold chain transportation and low temperature storage conditions.

[0011] Therefore, the existing technology still has many deficiencies in the detection of Paecilia multivesiculata, and there is an urgent need for a detection method that is efficient, rapid, simple, and has high sensitivity and specificity, to meet the actual needs of on-site rapid detection in aquaculture and solve the limitations of cold chain transportation, low temperature storage, etc. SUMMARY

[0012] The purpose of the present application is to provide a fluorescent RPA detection kit for detecting Paecilia multivesiculata and an application method.

[0013] The present application is realized by the following technical solutions: A fluorescent RPA detection kit for detecting Paecilia multivesiculata, the kit comprising RPA freeze-dried microsphere Mix, positive quality control, and negative quality control. Wherein, the RPA freeze-dried microsphere Mix is a freeze-dried spherical solid, containing an oligonucleotide upstream primer, an oligonucleotide downstream primer, and an RPA oligonucleotide fluorescent probe designed based on the 18S rRNA gene conserved region of Paecilia multivesiculata. The oligonucleotide upstream primer sequence is shown in SEQ ID NO. 1, the oligonucleotide downstream primer sequence is shown in SEQ ID NO. 2, and the RPA oligonucleotide fluorescent probe is obtained by modifying and labeling the nucleotide sequence shown in SEQ ID NO. 3.

[0014] Further, the positive quality control is a freeze-dried powder prepared from a recombinant plasmid containing the 18S rRNA gene conserved region target sequence of Paecilia multivesiculata, and the target sequence is shown in SEQ ID NO. 4.

[0015] Further, the negative quality control is Nuclease-Free Water.

[0016] Further, the modification mark is specifically: the 3' end is subjected to C3 Spacer blocking modification, and the 31st base is [FAM-dT], the 32nd base is [THF], and the 33rd base is [BHQ1-dT].

[0017] SEQ ID NO. 1: 5'-GTCATCAGCTTGCGTTGATTATGTCCCTGCCGTTTGTACACA-3' SEQ ID NO. 2: 5'-GCAGGTTCACCTACAGATACCTTGTTACGACTTCTTGTTGTTCC-3' SEQ ID NO. 3: 5'-GCTTGTAGTAACGAATGGTCTGGTGAACCTTCTGGACCGAGGTCGCAAG-3' SEQ ID NO. 4: 5'-GTCATCAGCTTGCGTTGATTATGTCCCTGCCGTTTGTACACACCGCCCCGTCGCTTGTAGTAACGAATGGTCTGGTGAACCTTCTGGACCGAGGTCGCAAGGCTTTGGGAAGTTAAGTAAACCCTACCATTTGGAACAACAAGAAGTCGTAACAAGGTATCTGTAGGTGAACCTGC-3' A detection method for detecting Ichthyophthirius multifiliis with high sensitivity comprises the following steps: 1) collecting fish tissue samples; 2) extracting DNA of the fish tissue samples, using a commercial DNA extraction kit and performing operations according to the kit instructions, and finally collecting DNA solution for direct detection or storage at -20 DEG C; 3) performing fluorescent RPA amplification using the fluorescent RPA detection kit for detecting Ichthyophthirius multifiliis; 4) determining whether Ichthyophthirius multifiliis exists in the fish tissue sample according to the fluorescence signal value.

[0018] Further, the fish tissue is gill, fin strip or skin.

[0019] Compared with the prior art, the present application has the following advantages: 1. The present application provides a detection method for detecting Ichthyophthirius multifiliis based on fluorescent RPA technology, Ichthyophthirius multifiliisCompared with the traditional PCR technology, the detection kit greatly simplifies the operation process, and the result can be directly judged by the real-time fluorescence signal after amplification, without opening the cover or carrying out subsequent experimental treatment such as electrophoresis, so as to avoid the cross contamination between different amplification products and reduce the occurrence of false positive results. The innovative method overcomes the shortcomings of low sensitivity and poor repeatability of the traditional kit, and the detection result is more accurate and reliable.

[0020] 2, The core component of the kit of the present application is RPA freeze-dried microsphere Mix, which contains a plurality of components required for amplification and optimized additives, including upstream primer (50-500 mM), downstream primer (50-500 mM) and fluorescent probe (25-250 mM) designed for the conserved region of 18S rRNA gene of Ichthyophthirius multifiliis, the T base in the fluorescent probe is modified by fluorescent emitting group (such as FAM, VIC, HEX, JOE, ROX, Texas-Red or Cy5) and fluorescent quenching group (such as DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2, BHQ-3), and tetrahydrofuran (THF) is introduced between them to improve the performance of the probe.

[0021] The RPA freeze-dried microsphere Mix also contains recombinant enzyme (10-100 ng / μL), strand displacement DNA polymerase (1-10 U) and single-stranded DNA binding protein (10-100 ng / μL), Exonuclease III (10-30 U) and the like, so as to realize high-efficiency nucleic acid amplification under constant temperature conditions. In order to improve the reaction efficiency and specificity, Tris-HCl buffer (pH 8.0, 10-100 mM), U-containing dNTP (10-50 mM), KCl (100 mM-1 M), Tween-20 (0.01-0.1% (V / V)), Betaine (5-50 mM), DMSO (0.01-0.1% (V / V)), X-1000 (0.01-0.5% (V / V)) and the like are further added to the system.

[0022] In particular, the RPA freeze-dried microsphere Mix of the present application adds freeze-drying protectants such as trehalose, sucrose and mannitol, and the total concentration range is 5-15% (W / V), which is used to stabilize the activity and structure of primers, enzymes and other active components during freeze-drying and long-term storage, and significantly prolongs the shelf life of the product.

[0023] All the above components are mixed to make freeze-dried microspheres and are loaded at the bottom of 0.2 mL PCR tubes, and the activator (20 mM magnesium acetate solution) is freeze-dried and placed above the microspheres. During detection, only sample DNA (the volume can be supplemented with enzyme-free water) needs to be added to the reaction tube, and the amplification reaction can be directly carried out without complex operation. The kit has high sensitivity and high specificity, and the detection can be completed within 20 min without cold chain transportation, and can be stored at room temperature for one year, greatly facilitating the rapid detection application on the spot of aquaculture.

[0024] 3, The kit of the present application can detect the 18S rRNA gene of Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) Ichthyophthirius multifiliis ), with high sensitivity and detection limit as low as single copy level, showing high detection sensitivity and ensuring high detection rate of positive samples. The primers and probes are designed based on the conserved region of the 18S rRNA gene of Ichthyophthirius multifiliis, and the recombinase polymerase amplification (RPA) technology is used. Under constant temperature conditions, the recombinase mediates the high-efficiency pairing of primers and target DNA, and then the polymerase extends along the 3' end of the primer to realize amplification. When the fluorescent probe with a fluorescent group and a quenching group in the system binds to the target DNA and is cut by Exonuclease III during the amplification process, the fluorescent group and the quenching group are separated, and the fluorescent signal is released. Only when the upstream primer, the downstream primer and the fluorescent probe are specifically combined with the sample DNA at the same time and successfully participate in the amplification reaction, the fluorescence intensity in the system will be enhanced and the amplification curve will appear, which ensures the high specificity of the detection. The detection result is in the form of fluorescence amplification curve, and the operation result is objective, direct and obvious, which is convenient for rapid interpretation.

[0025] 4, The freeze-dried kit of the present application can be stored at room temperature for up to one year. This feature avoids the strict requirements of traditional kits for cold chain transportation and low temperature storage, significantly reduces the logistics cost and transportation difficulty, and adapts to the rapid detection demand in the field of aquaculture. In the aquaculture industry, the innovative RPA kit will greatly improve the on-site rapid detection capability of Ichthyophthirius multifiliis, provide an efficient, simple, low-cost and cold chain-free transportation solution, and meet the urgent needs of modern aquaculture for rapid and accurate pathogen detection. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 The sensitivity detection experiment result graph of the fluorescent RPA of Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) provided for experimental example 1 of the present application is shown in the following figure: Ichthyophthirius multifiliis Figure 2 The accuracy detection experiment result graph of the fluorescent RPA of Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) provided for experimental example 2 of the present application is shown in the following figure: Ichthyophthirius multifiliis Figure 3 The accuracy detection experiment result graph of the fluorescent RPA of Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) provided for experimental example 3 of the present application is shown in the following figure: Ichthyophthirius multifiliis ​​) Specificity detection experimental results of fluorescent RPA; Figure 4 It is a schematic diagram of the present invention; Figure 5 This is the RPA freeze-dried microsphere format of the present invention. DETAILED DESCRIPTION

[0027] In order to further explain the present invention, it is described below with reference to the following specific embodiments.

[0028] Recombinase polymerase amplification (RPA) technology utilizes different enzymes to achieve rapid, enzyme-mediated amplification at constant temperatures, reducing equipment requirements. In vitro nucleic acid amplification does not require heating; double-stranded DNA can be melted and amplified cyclically under constant temperature, resulting in efficient, rapid, highly specific, and sensitive amplification of target genes under isothermal conditions. Gel electrophoresis is also unnecessary for visualization, minimizing the risk of environmental contamination from opening the container. Amplification is typically completed in less than 20 minutes. Currently, this technology has been widely used in animal disease diagnosis, pathogen detection and identification, food safety testing, biosafety testing, genetically modified crops, and environmental monitoring. It also plays an important role in human medicine. In aquaculture pathogen detection, it has been used for rapid detection of white spot syndrome virus (WSSV), carp spring virus, koi herpesvirus, Schistosoma japonicum, Vibrio mimicus, Photobacterium mermanii, and sulfonamide resistance genes in shrimp. However, there are no reports on the use of RPA for the detection of Ichthyophthirius multifeldianus.

[0029] Based on the existing problems faced by the detection methods of Ichthyophthirius multifellows, such as insufficient sensitivity, complex operation, long detection time, and the need for cold chain transportation and low-temperature storage, the present invention has developed an innovative freeze-dried recombinase polymerase amplification (RPA) kit for the rapid detection of Ichthyophthirius multifellows ( Ichthyophthirius multifiliis This kit utilizes RPA technology, which achieves rapid nucleic acid amplification at a constant temperature through the action of different enzymes. Compared to traditional PCR, RPA offers significant advantages. It completes double-stranded DNA melting and amplification at a constant temperature without the need for heating. This eliminates the need for high-temperature cycling equipment and reduces dependence on operator intervention, making the detection process simpler and more efficient.

[0030] Example 1: A multi-sperm Ichthyophthirius insect based on fluorescent RPA ( Ichthyophthirius multifiliis ) detection kit, which includes three components: RPA freeze-dried microspheres Mix, positive quality control, and negative quality control.

[0031] RPA lyophilized microspheres Mix is the core component of the reaction system of the detection method involved in the present application, which contains primer probe, recombinase (10-100 ng / μL), strand displacement DNA polymerase (1-10 U) and single-stranded DNA binding protein (10-100 ng / μL) and the like. The mixed liquid of other substrates required for RPA amplification is treated by freeze-drying. The activator (20 mM magnesium acetate solution) is also freeze-dried separately. These freeze-dried microspheres are packed in 0.2 mL PCR tubes as complete RPA lyophilized microspheres Mix. When performing detection, only sample DNA (such as sample DNA volume is insufficient, which can be supplemented with Nuclease-Free Water) needs to be added to the reaction tube for amplification. Such design simplifies the operation process, without other complex processing steps, improves the efficiency and simplicity of the experiment.

[0032] The components of RPA lyophilized microspheres Mix include: The upstream primer (50-500 mM), downstream primer (50-500 mM) and fluorescent probe (25-250 mM) designed for the conserved region of 18S rRNA gene of Philaophthalmus sp. are modified by fluorescent emitting groups (such as FAM, VIC, HEX, JOE, ROX, Texas-Red or Cy5) and fluorescent quenching groups (such as DABCYL, DABSYL, TAMRA, BHQ-1, BHQ-2, BHQ-3) in T base, and tetrahydrofuran (THF) is introduced between them to improve the performance of the probe.

[0033] The RPA lyophilized microspheres Mix also contains recombinase (10-100 ng / μL), strand displacement DNA polymerase (1-10 U) and single-stranded DNA binding protein (10-100 ng / μL), Exonuclease III (10-30 U) and the like to achieve efficient nucleic acid amplification under isothermal conditions. In order to improve the reaction efficiency and specificity, Tris-HCl buffer (pH 8.0, 10-100 mM), U-containing dNTP (10-50 mM), KCl (100 mM-1 M), Tween-20 (0.01-0.1% (V / V)), Betaine (5-50 mM), DMSO (0.01-0.1% (V / V)), X-1000 (0.01-0.5% (V / V)) and other aids are further added to the system.

[0034] In particular, RPA lyophilized microspheres Mix adds freeze-drying protectants such as trehalose, sucrose and mannitol, with a total concentration range of 5-15% (W / V).

[0035] All the above components were mixed to form freeze-dried microspheres and placed at the bottom of a 0.2 mL PCR tube. The activator (20 mM magnesium acetate solution) was freeze-dried and placed on top of the microspheres.

[0036] Positive quality control: The positive quality control product in the kit is the freeze-dried powder of the plasmid synthesized from the target gene sequence of Ichthyophthirius multifeldianus.

[0037] Negative control: Nuclease-Free Water.

[0038] The reaction system of the kit is:

[0039] Example 2: A highly sensitive method for detecting Ichthyophthirius multifellows, comprising the following steps: 1) Sample type: Collecting fish gill tissue samples; 2) Nucleic acid extraction: Use a commercial DNA extraction kit, such as a nucleic acid extraction reagent based on a silica membrane centrifugal column method or a nucleic acid extraction reagent based on a magnetic bead method, and follow the kit instructions to collect 100 μL of nucleic acid solution for direct testing or storage at -20°C.

[0040] 3) Add sample: Add 5-25 μL of sample DNA solution to a 0.2 mL PCR tube containing RPA freeze-dried microspheres (if the sample volume is insufficient, use Nuclease-Free Water to make up the difference). Close the tube tightly and wait for 1-2 seconds for the freeze-dried microspheres to dissolve. Vortex to mix thoroughly and centrifuge to collect the solution at the bottom of the tube. 4) On-machine amplification detection: The settings of the RPA amplification program analysis program are shown in Table 1: Table 1

[0041] 5) Result analysis The pathogen was detected and the results are shown in Table 2; Table 2

[0042] Test Example 1: Detection sensitivity of the kit of the present invention: Nanodrop and Qubit were used to detect the multi-sperming Ichthyophthirius ( Ichthyophthirius multifiliis ) The positive quality control product was determined to have a fixed value of 1×10 12 copies / μL, set 8 concentration gradients, 1×10 6copies / μL, 1x10 5 copies / μL, 1x10 4 copies / μL, 1x10 3 copies / μL, 1x10 2 copies / μL, 1x10 1 copies / μL, 5 copies / μL, 2.5 copies / μL, to verify the sensitivity of the detection method described in embodiments 1 and 2 of the present application. The detection results Figure 1 As shown in the table, the multiple sub-cucumis worms ( Ichthyophthirius multifiliis ) in the 5 copies / μL simulated sample can be accurately detected, indicating that the detection method of the present application has high sensitivity.

[0043] Test example 2: detection accuracy of the kit of the present application: Using known multiple sub-cucumis worms ( Ichthyophthirius multifiliis ) positive and negative nucleic acid samples, using the kit described in embodiment 1, and according to the method of embodiment 2, the known samples were detected, and the experimental results are shown in Figure 2 As shown in the table, the results show that the RPA system can detect the corresponding target, and after RPA amplification, the detection accuracy can be judged by the report fluorescence signal value, and Figure 2 It can be seen that the positive detection rate is 100%, the negative coincidence rate is 100%, there is no false positive and missed detection phenomenon, and the detection has high accuracy.

[0044] Test example 3: detection specificity of the kit of the present application: Other non-target fish parasites DNA (cone worm, poly shrink, iodine bubble worm, wave worm, tetrahymena) were used as specific detection samples, and the kit described in embodiment 1 of the present application and the detection method described in embodiment 2 were used for detection, and the detection results are shown in Figure 3 As shown in the table, the results found that there was no non-specific amplification, and the RPA was not amplified, indicating that the kit has high specificity.

[0045] Test example 4: detection repeatability of the kit of the present application: 20 samples of the same concentration of multiple sub-cucumis worm DNA were used as detection samples, and the kit described in embodiment 1 of the present application and the detection method described in embodiment 2 were used for detection, and the detection results are shown in table 3, which has high repeatability, and the CV is less than 5%.

[0046] Table 3

[0047] Test example 5: detection stability of the kit of the present application: The positive plasmid of the N. gartii is used as a detection sample, and the kit and the detection method in Embodiment 1 and Embodiment 2 are used for detection, and the difference between the reagent placed at room temperature for one year and the newly produced reagent is tested, and the detection result is shown in Table 4, and there is almost no difference between the two.

[0048] Table 4

[0049] The above description is only an exemplary description of the present application, and does not represent the whole content of the present application. Those skilled in the art can make various equivalent changes or substitutions to the above embodiments without departing from the spirit and scope of the present application, and these equivalent changes or substitutions shall be included in the scope defined by the claims of the present application.

Claims

1. A fluorescent RPA detection kit for detecting Ichthyophthirius multifellows, characterized in that: The kit includes RPA freeze-dried microspheres Mix, positive quality control products, and negative quality control products; Among them, RPA freeze-dried microspheres Mix is ​​a freeze-dried spherical solid containing an oligonucleotide upstream primer, an oligonucleotide downstream primer, and an RPA oligonucleotide fluorescent probe designed based on the conserved region of the 18S rRNA gene of Ichthyophthirius multifeldianus. The oligonucleotide upstream primer sequence is shown in SEQ ID NO.1, the oligonucleotide downstream primer sequence is shown in SEQ ID NO.2, and the RPA oligonucleotide fluorescent probe is obtained by modifying and labeling the nucleotide sequence shown in SEQ ID NO.

3.

2. The fluorescent RPA detection kit for detecting Ichthyophthirius multifellows according to claim 1, characterized in that: The positive quality control product is a freeze-dried powder, which is prepared from a recombinant plasmid containing a target sequence of the conserved region of the 18S rRNA gene of Ichthyophthirius multifida, and the target sequence is shown in SEQ ID NO.

4.

3. The fluorescent RPA detection kit for detecting Ichthyophthirius multifellows according to claim 1, characterized in that: The negative control product is Nuclease-Free Water.

4. The fluorescent RPA detection kit for detecting Ichthyophthirius multifellows according to claim 1, characterized in that: The modification labeling is specifically as follows: the 3' end of the probe is modified with C3 Spacer blocking, and the 31st base is [FAM-dT], the 32nd base is [THF], and the 33rd base is [BHQ1-dT].

5. A highly sensitive method for detecting Ichthyophthirius multifellows, characterized in that: The steps include: 1) Collect fish tissue samples; 2) Extract DNA from fish tissue samples using a commercial DNA extraction kit according to the kit instructions. Collect the DNA solution and test directly or store at -20°C. 3) performing fluorescent RPA amplification using the fluorescent RPA detection kit for detecting Ichthyophthirius multifellows according to any one of claims 1 to 4; 4) Determining whether Ichthyophthirius multifleshed is present in the fish tissue sample based on the fluorescence signal value.

6. The highly sensitive detection method for Ichthyophthirius multifellows according to claim 5, wherein: The fish tissue is gills, fin rays or skin.

Images