Application of potato laccase gene StLAC19 in breeding of shade-resistant new variety

Abstract

The invention provides an application of potato laccase StLAC19 in a shade avoidance reaction. The overexpression of the StLAC19 gene can significantly enhance the shading tolerance of potato plants, and effectively improve the lignin content, the osmotic regulation substance content, the chlorophyll content, the stalk strength, the CAT and POD enzyme activity and the PRO and MDA content; on the contrary, interference on expression of the StLAC19 gene results in a contrary result. The result shows that the StLAC19 gene positively regulates and controls the shading reaction of potato plants. The screening of varieties with high expression of the StLAC19 gene is helpful for obtaining materials with stronger shade-avoiding tolerance, so that the gene can be used as a target gene for breeding shade-avoiding tolerance type potato varieties.

Description

Technical Field

[0001] The invention belongs to the field of potato molecular breeding, and particularly relates to the application of the StLAC19 gene in screening shade-tolerant potato varieties. Background Art

[0002] Potatoes are one of the most widely grown food crops worldwide. Due to their adaptability and nutrient-rich nature, potato planting seasons and patterns vary across ecological regions, and different climatic conditions also have varying impacts on potatoes. Potatoes are light-loving crops, and continuous rainy weather can reduce light intensity, causing excessive growth and plant lodging. Furthermore, in intercropping, as low-growing crops, potatoes are shaded by taller crops throughout their growth and development, affecting their growth and development, ultimately affecting their quality and yield. Therefore, the identification of potato shade-tolerance genes and the study of their molecular mechanisms provide important theoretical support for breeding shade-tolerant and high-yield potato varieties.

[0003] Most studies have shown that plant laccases are related to the thickening and lignification of secondary cell walls. During the lignification process of plant cell walls, from lignin synthesis to transport to polymerization and deposition, this series of processes can increase the hardness of plant tissues and increase the support and pressure resistance of cells to resist adverse stress. Lignin is a photosensitive phenolic compound, and changes in the light environment will directly affect the synthesis of lignin. Therefore, it is speculated that laccase regulates the shade avoidance response of plants under low light conditions. Plant laccase genes have been identified in multiple species and shown to be associated with a variety of abiotic stresses, such as salt, drought, low temperature and heavy metal stress, but the function of laccase genes in regulating potato shading response has not been reported. The applicant's research group has previously conducted a systematic screening of the potato laccase gene family. This application further provides the specific functions and uses of potato StLAC19 in regulating shade stress. Summary of the Invention

[0004] The key technical problem to be solved by the present invention is to provide the application of the StLAC19 gene in the shade avoidance response of potato plants. To solve the above technical problem, the present invention adopts the following technical solution:

[0005] 1. Potato StLAC19 gene, the expression level of this gene was most significant under shade stress, upregulated by about three times.

[0006] 2. Potato StLAC19 gene. The transcript sequence of this gene is shown in the sequence listing as SEQ No. 1. The CDS length is 1686 bp, encoding 561 amino acids. The accession number in the potato database is Soltu.DM.09G000560.1.

[0007] 3. Application of overexpression of the StLAC19 gene to enhance shade tolerance in potatoes. The transcript sequence of the StLAC19 gene is shown in SEQ No. 1 in the sequence listing.

[0008] 4. Application of the potato StLAC19 gene in breeding new shade-tolerant varieties. The transcript sequence of the StLAC19 gene is shown in SEQ No. 1 in the sequence listing. Varieties with high StLAC19 gene expression levels have stronger shade tolerance.

[0009] 5. Application of interfering with the expression of potato StLAC19 gene to reduce potato shade tolerance, wherein the transcript sequence of the StLAC19 gene is shown in SEQ No. 1 in the sequence listing.

[0010] 6. Application of overexpressing the StLAC19 gene to increase potato lignin and chlorophyll content, improve stem strength, and reduce soluble sugar content. The transcript sequence of the StLAC19 gene is shown in SEQ No. 1 in the sequence listing.

[0011] 7. Application of overexpression of the StLAC19 gene to increase POD and CAT enzyme activities and PRO content and reduce MDA content in potatoes. The transcript sequence of the StLAC19 gene is shown in SEQ No. 1 in the sequence listing.

[0012] 8. The application verification method of the potato StLAC19 gene to enhance the negative tolerance of potato plants includes: (1) potato genetic transformation; (2) detection of transgenic positive lines; (3) identification of negative tolerance of transgenic potato plants.

[0013] Beneficial effects: This application screened out the target gene StLAC19 by analyzing the expression levels of potato laccase family genes, and then constructed the overexpression vector pCAMBIA1300-StLAC19 and the interference expression vector pCAMBIA1300-amiR-StLAC19, respectively, and successfully obtained potato plants with overexpression and interference expression of StLAC19. Through plant phenotypic observation, it was found that after 7 days of shading treatment, the growth condition of the overexpression potato plants was significantly better than that of the wild type, while the leaves of the interference expression strain were obviously wilted and yellowed severely. Overexpression of StLAC19 can significantly improve the shade tolerance of potato plants, and effectively change the content of lignin, osmotic regulating substances, chlorophyll, stem strength, CAT and POD enzyme activities, and MDA and PRO contents, while the opposite results appeared in the interference expression plants, proving that StLAC19 can enhance the shade tolerance of potato plants. Plants overexpressing StLAC19 have better shade tolerance than wild-type plants, while plants with interference expression have the opposite effect. This shows that the StLAC19 gene plays a positive regulatory role in the shade avoidance response of potato, laying the foundation for elucidating the regulatory mode and molecular mechanism of action of StLAC19. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 : Analysis of StLACs gene expression before and after shading treatment.

[0015] Figure 2 : Agrobacterium-mediated transformation of potato and rooting screening of transgenic plants. Figure 2 A. Induced potato; Figure 2 B. Co-cultivation of transformed potato chips; Figure 2 C. potato chip callus differentiation and budding; Figure 2 D. Rooting and screening of transformed plants.

[0016] Figure 3 : PCR detection and expression level detection of transgenic plants. Figure 3 A. PCR detection of transgenic plants; Figure 3 B. Detection of expression level of transgenic line StLAC19.

[0017] Figure 4 : Phenotypic analysis of potato StLAC19 transgenic plants before and after shade stress. Figure 4 A. Transgenic potted plants 35 days; Figure 4 B and Figure 4 C. Transgenic potted plants after shading for 7 days; Figure 4 D. Leaves of transgenic plants after shading for 7 days; Figure 4 E. Plant height of transgenic plants before and after shading; Figure 4 F. Average internode length of transgenic plants before and after shading; Figure 4 G. Average stem diameter of transgenic plants before and after shading; Figure 4 H. Number of internodes in transgenic plants before and after shading; Figure 4 I. Figure 4 J and Figure 4 K. Lengths of internodes 2, 3, and 4 in OE, WT, and RNAi plants before and after shading; Figure 4 L. Elongation of the second, third, and fourth internodes of transgenic plants after shading.

[0018] Figure 5 : Changes in lignin, soluble sugar, soluble protein, chlorophyll contents and stem strength in potato StLAC19 transgenic plants after shade stress. Figure 5 A. Lignin content; Figure 5 B. Soluble sugar content; Figure 5 C. Soluble protein content; Figure 5 D. Chlorophyll content; Figure 5 E. Stem strength. Among them, Figure 5 A and Figure 5 B and Figure 5The bar graph in C is OE-1, OE-2, OE-3, WT, RNAi-1, RNAi-2, and RNAi-3 from left to right.

[0019] Figure 6 : Changes in CAT and POD enzyme activities and MDA and PRO contents in potato StLAC19 transgenic plants after shade stress. Figure 6 A.POD activity; Figure 6 B.CAT activity; Figure 6 C. MDA content; Figure 6 D. PRO content. The bar graphs from left to right are OE-1, OE-2, OE-3, WT, RNAi-1, RNAi-2, and RNAi-3.

[0020] Figure 7 : The structure of potato StLAC19 gene. The underlined codons are the start codon and the stop codon, and the CDS region is between them. Specific implementation methods

[0021] The methods and apparatus used in the following embodiments of the present invention are conventional methods and apparatus unless otherwise specified; the equipment and reagents used are conventional equipment and reagents purchased from a reagent company. In order to make the purpose, technical solutions and advantages of the present invention clearer, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments. Examples of these preferred implementations are illustrated in the specific embodiments. It should also be noted that in order to avoid obscuring the technical solutions of the present invention due to unnecessary details, only technical solutions and / or processing steps closely related to the solutions of the present invention are shown in the embodiments, and other details that are not very relevant are omitted.

[0022] Example 1

[0023] This embodiment provides a potato StLAC19 gene, which has the following characteristics:

[0024] Potato StLAC19 (Soltu.DM.09G000560.1) is located on chromosome 9. The gene is 2214 bp long, with a CDS region of 1686 bp. The sequence is shown in SEQ ID No. 1 in the sequence listing and contains six exons. The protein encoded by StLAC19 consists of 561 amino acids with a relative molecular mass of 61.71 kDa and a theoretical isoelectric point of 9.24. The protein has an instability coefficient of 30.35, a fat index of 88.56, and an overall average hydrophilicity of -0.058. Analysis of the protein's transmembrane domain using the online TMHMM software revealed that StLAC19 does not contain a transmembrane domain, indicating that it is a non-transmembrane protein.

[0025] Example 2

[0026] This embodiment provides a method for constructing a potato StLAC19 gene plant overexpression and interference vector, comprising:

[0027] 1. Construction of StLAC19 gene overexpression vector

[0028] The inventors amplified the StLAC19 sequence from cDNA of potato cultivar "Atlantic" stems using the following PCR primers: Forward primer: 5'-AGAACACGGGGGAC GAGCTC ATGAACTCTTGGATTTGCCATTTT-3', reverse primer: 5'- TGCTCACCAT GTCGAC The PCR reaction system consisted of 10.0 μL of PrimeSTAR® Max DNA Polymerase, 3.0 μL of cDNA template (100 ng), 1.0 μL of forward / reverse primers (10 μM), and 5.0 μL of ddH2O. The PCR reaction conditions were 94°C for 25 seconds, 59.1°C for 25 seconds, and 72°C for 1 minute 50 seconds for a total of 34 cycles. The target gene amplified by PCR was recovered from gels using homologous recombination and ligated into the linearized pCAMBIA1300-35S-EGFP vector digested with Sac I and Sal I. The target gene was heat-shock transformed into Escherichia coli DH5α and verified by sequencing. Positive clones identified by sequencing were transformed into Agrobacterium tumefaciens GV3101 with the pCAMBIA1300-StLAC19 plasmid. PCR-positive clones were stored for further genetic transformation.

[0029] 2. Construction of StLAC19 gene interference expression vector

[0030] 2.1 Primer design for artificial miRNA precursor fragments

[0031] Submit the StLAC19 gene coding region sequence to the WMD3 online website (http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi). The target gene's amiRNA interference sequence (5'-TATGTATTGGATGGTTCGCAG-3') was obtained. PCR amplification primers were automatically retrieved using the Oligo function on the website. The optimal primer sequence was selected and downloaded for primer synthesis. Specific primer information is shown in Table 1.

[0032] Table 1 PCR amplification primers for amiR-StLAC19

[0033] Primer name Primer sequence (5'-3') A CTGCAAGGCGATTAAGTTGGGTAAC B GCGGATAACAATTTCACACAGGAAACAG Ⅰ gaTATGTATTGGATGTGTTCGCAGtctctcttttgtattcc Ⅱ gaCTGCGAACCATCCAATACATAtcaaagagaatcaatga Ⅲ gaCTACGAACCATCCTATACATTtcacaggtcgtgatatg Ⅳ gaAATGTATAGGATGGTTCGTAGtctacatatattattcct

[0034] 2.2 Cloning of artificial miRNA precursor fragments

[0035] Using the pRS300 plasmid as a template, precursor fragments a, b, and c were amplified separately. The specific amplification principle was that fragment a, amplified using primers A and IV, replaced the 5' arm of pRS300 mi3191a; fragment b, amplified using primers III and II, replaced the central loop of mi3191a; and fragment c, amplified using primers I and B, replaced the 3' arm of mi3191a. The amplification system is shown in Table 2.

[0036] Table 2 PCR system for amiRNA precursor fragments

[0037] PCR reaction Forward primer Reverse primer template Product length (bp) a A IV pRS300 272 b III II pRS300 171 c I B pRS300 298 d A B a+b+c 701

[0038] The PCR reaction system was as follows: PrimeSTAR® Max DNA Polymerase 10.0 μL, cDNA template (100 ng) 2.0 μL, forward / reverse primers (10 μM) 1.0 μL, and ddH2O 6.0 μL; the PCR reaction conditions were 95°C for 30 seconds, 52°C for 30 seconds, and 72°C for 40 seconds for a total of 35 cycles.

[0039] 2.3 Construction of cloning vector pMD18-amiR-StLAC19

[0040] The amplified fragment d was ligated with the pMD18-T vector using the following ligation system: 1.0 µL of pMD18-T, 4.0 µL of fragment d, and 5.0 µL of Solution I. After addition, the samples were thoroughly mixed and briefly centrifuged. The ligation was then performed in a PCR instrument at 16°C for 30 minutes. The ligated pT18-d fragment was heat-shocked into competent E. coli DH5α and verified by sequencing. The correct clone was designated pMD18-amiR-StLAC19.

[0041] 2.4 Construction of pCAMBIA1300-amiR-StLAC19 interference expression vector

[0042] The pCAMBIA1300-35S-EGFP empty plasmid and the pMD18-amiR-StLAC19 recombinant vector were digested with restriction endonucleases Kpn I and Xba I. The linearized vector large fragment and the target precursor small fragment with sticky ends were recovered from gels and stored at -20°C until use. The precursor small fragment and the linearized vector large fragment were ligated using homologous recombination with T4 ligase. The reaction system consisted of 2.0 μL of 10× ligation buffer, 10.0 μL of the T18-StLAC19 small fragment, 4.0 μL of the linearized pCPB121 vector, 1.0 μL of T4 ligase, and 3.0 μL of ddH2O. The samples were added on ice and briefly centrifuged to mix. The ligation reaction was then performed in a PCR machine at 16°C for 1.5 h. The ligated product was heat-shocked into Escherichia coli DH5α and verified by sequencing. The positive clones pCAMBIA1300-amiR-StLAC19 detected by sequencing were transformed into Agrobacterium GV3101, and the clones positive by PCR were preserved for further genetic transformation.

[0043] Example 3

[0044] This example provides a method for verifying the use of the potato StLAC19 gene in regulating the shade avoidance response of potatoes, comprising:

[0045] 1. Potato genetic transformation

[0046] Agrobacterium GV3101 containing pCAMBIA1300-StLAC19 and pCAMBIA1300-amiR-StLAC19 was inoculated into LB medium containing 50 mg / L Kan and 50 mg / L Rif and cultured at 28°C and 220 rpm on a shaker until the OD 600 The value was about 0.6. The pellet was resuspended in 3% MS liquid medium after centrifugation at 4000 r / min for 6 min. The “Atlantic” tube potato (12-16 weeks old and about 0.5 cm in diameter) was grown. Figure 2 A) Cut into 1-2 mm thick slices and infect with the above Agrobacterium solution for 7-8 minutes, shaking continuously. After infection, remove the slices and blot dry with sterile filter paper. Transfer to co-culture medium S1: 3% MS + 1 mg / L IAA + 0.2 mg / L GA3 + 0.5 mg / L 6-BA + 2 mg / L ZT in a Petri dish ( Figure 2 B), after culturing in the dark at 28°C for 2 days, the cells were transferred to S2 medium: S1+75 mg / L Kan+400 mg / L Cef, and cultured under the conditions of a light intensity of 2000 Lx, a photoperiod of 16 h / d, and a temperature of 23°C until resistant buds regenerated ( Figure 2C). When the resistant buds are 1-1.5 cm long, they are cut and transferred to rooting medium S3: 3% MS + 75 mg / L Kan + 400 mg / L Cef. Those that can normally root after about 7 days are initially considered transformed seedlings ( Figure 2 D).

[0047] 2. Detection of transgenic positive strains

[0048] Cut 1-2 leaves from the seedlings to be tested and place them in a 2 ml centrifuge tube. Extract DNA using the CTAB method. After DNA extraction, use it as a template for PCR detection of transgenic lines. Use the vector primer HYG-F: 5'-GGTCGCGGAGGCTATGGATGC-3' and the reverse primer HYG-R: 5'-GCTTCTCGGGCGATTTGTGT-3'. PCR amplification is performed, and electrophoresis is performed to obtain multiple transgenic plants ( Figure 3 A). Total RNA from transgenic plants and control plants was extracted using a plant RNA rapid extraction kit (Tiangen), and reverse transcribed using a reverse transcription kit (Sevier). Using cDNA as a template, quantitative primers were used to detect the expression level of the target gene StLAC19. The results showed that the expression level of StLAC19 was significantly upregulated / inhibited in multiple positive transgenic lines ( Figure 3 B).

[0049] 3. Identification of genetically modified potatoes

[0050] 3.1 Effects of shade stress on the phenotype of transgenic potato plants

[0051] The stem segments of potato test tube seedlings were transferred to 3% MS solid medium and placed in a culture room at (22±1)℃ with a photoperiod of 16 h light / 8 h dark for 4 weeks. The 4-week-old potato tissue culture seedlings were transferred to plastic pots (10×10 cm) with a soil:vermiculite ratio of 3:1. The culture conditions were set at (22±1)℃, 16 h light / 8 h dark, and watered every 5 days. Shading stress treatment was initiated after 5 weeks of growth. Under normal growth conditions, compared with the WT strain, the OE strain had a shorter plant height, thicker stems, and larger leaves, while the RNAi strain showed the opposite phenotype ( Figure 4A). After 7 days of shading, the WT, overexpression lines OE-1, OE-2, OE-3, and interference expression lines RNAi-1, RNAi-2, and RNAi-3 all showed obvious wilting and leaf yellowing, and their plant height increased significantly, internodes elongated, and stem diameter decreased. However, the degree of wilting and leaf yellowing in the RNAi line was significantly more serious than that in the WT, accompanied by a small number of wilting. The changes in plant height, internode length, and stem diameter were also greater than those in the WT. In contrast, the degree of wilting in the OE line was significantly lighter than that in the WT and RNAi lines, with fewer dead leaves, and the changes in plant height, internode length, and stem diameter were also lower than those in the WT and RNAi lines ( Figure 4 ).

[0052] 3.2 Effects of shading stress on lodging resistance of transgenic plants

[0053] The changes in lignin, soluble sugar, soluble protein, chlorophyll content and stem strength of transgenic potatoes under shade stress were measured. The results showed that under normal conditions, the lignin and chlorophyll content and stem strength of the OE strain were significantly higher than those of the WT and RNAi strains, while the soluble sugar content was significantly lower than that of the WT and RNAi strains, and the opposite was true for the RNAi strain. After shade stress treatment, the lignin, soluble sugar, soluble protein, chlorophyll content and stem strength of all tested plants decreased significantly, and the decrease in the OE strain was significantly lower than that of the WT and RNAi strains, while the opposite was true for the RNAi plants. The results showed that compared with wild-type plants, plants overexpressing StLAC19 had stronger shade tolerance and lodging resistance, while the opposite was true for plants with interference expression ( Figure 5 ).

[0054] 3.3 Effects of shading stress on physiological and biochemical parameters of transgenic plants

[0055] The activities of peroxidase (POD) and catalase (CAT) as well as the changes in malondialdehyde (MDA) and proline (PRO) contents in transgenic potatoes under shade stress were measured. The results of POD and CAT activity measurements showed that under normal growth conditions, the POD activity of RNAi plants was significantly higher than that of WT and OE plants, while the difference in CAT activity was not significant. However, after shade stress treatment, the POD and CAT activities of all tested plants increased significantly. The POD and CAT activities of RNAi plants were significantly lower than those of WT and OE, and significantly higher than those of OE plants ( Figure 6 A, B). This indicates that the antioxidant scavenging capacity of RNAi plants is lower than that of WT and OE plants, while that of OE plants is higher than that of WT. There was no significant difference in MDA content between the strains before treatment. After treatment, the OE strain showed a significant decrease compared to the wild type, while the RNAi strain showed a significant increase compared to the wild type ( Figure 6C). Before shading treatment, PRO content in the WT line was significantly higher than that in the OE and RNAi transgenic lines. After shading treatment, PRO content in all plants increased, with the OE line increasing significantly more than the WT and RNAi lines, while the RNAi line showed the opposite trend ( Figure 6 D). The results showed that plants overexpressing the StLAC19 gene had better shade tolerance than wild-type plants, while the plants with knockdown expression had the opposite effect.

Claims

1. Potatoes StLAC19 gene, characterized by described StLAC19 The gene transcript sequence is shown in the sequence listing SEQ No. 1, and the accession number of the gene in the potato database is Soltu.DM.09G000560.

1.

2. Overexpression StLAC19 Application of gene-enhanced shade tolerance in potato, characterized in that described StLAC19 The gene transcript sequence is shown in the sequence listing SEQ No.

1.

3. Potatoes StLAC19 The application of genes in creating new shade-tolerant varieties is characterized by described StLAC19 The gene transcript sequence is shown in the sequence table SEQ No. 1, StLAC19 Varieties with higher gene expression levels have stronger shade tolerance.

4. The method according to any one of claims 2 and 3 StLAC19 The application of genes is characterized by Overexpression StLAC19 The gene increases potato lignin and chlorophyll content, improves stem strength, and reduces soluble sugar content.

5. The method according to any one of claims 2 and 3 StLAC19 The application of genes is characterized by Overexpression StLAC19 The gene increases the activity of POD and CAT enzymes and PRO content in potatoes, and reduces the MDA content.

6. Disturb potatoes StLAC19 Application of gene expression to reduce potato shade tolerance, characterized in that described StLAC19 The gene transcript sequence is shown in the sequence listing SEQ No.

1.

7. Potatoes StLAC19 A method for verifying the gene-enhanced shade tolerance function of potato plants, characterized in that The method comprises: (1) genetic transformation of potato; (2) detection of transgenic positive lines; and (3) identification of negative tolerance of transgenic potato plants.

Images