SNP (Single Nucleotide Polymorphism) marker influencing porcine purine base content and application thereof

Abstract

The invention relates to the technical field of molecular markers and animal genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) marker capable of influencing the content of porcine purine bases and application of the SNP marker. According to the invention, based on three test swinery of American-series purebred landrace, American-series purebred large white pig and American-series purebred Duroc, pig whole genome re-sequencing and GWAS analysis are adopted, 15 SNP markers which significantly influence the content of pig purine bases are researched and determined, and by optimizing the dominant alleles of the SNP markers, the frequency of the dominant alleles can be increased generation by generation, and the number of the dominant alleles can be increased. The corresponding purine content is reduced or increased, and the genetic improvement progress of pigs is accelerated, so that the economic benefit of breeding of boars is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers and animal genetic breeding, and in particular to a SNP marker affecting the purine base content of pigs and an application thereof. Background Art

[0002] Purines are naturally occurring substances found in all human cells and in nearly all foods. Purines in human food, including nucleotides, nucleosides, and free purine bases, are absorbed as corresponding nucleosides or bases and enter the purine metabolic pathway. Excessive purine intake can lead to elevated blood urate concentrations. If this exceeds the body's excretion capacity, uric acid crystals will deposit in joints, causing gout. Therefore, reducing purine content in food has become an important research topic.

[0003] Pork, a food with a moderate purine content, currently accounts for a significant portion of the population. Current methods for reducing purine content in meat primarily involve meat processing, including appropriate cooking methods (research has shown that over 60% of hypoxanthine can be transferred to the broth during boiling) and specialized processing methods (research has shown that treating swordfish with sake lees can reduce total purine). However, these processing methods are complex and may also result in the loss of other components. Molecular marker-assisted breeding can be used to specifically improve purine base content, but research on reducing purine content in meat through this approach is limited. Research and identification of molecular markers associated with purine content could provide a reference and direction for breeding low-purine pig populations.

[0004] The four most common purine bases in living organisms—adenine, guanine, hypoxanthine, and xanthine—are widely involved in physiological processes such as nucleic acid metabolism, base modification, and energy conversion. Reducing purine levels also affects meat quality and taste. However, the levels of total purines (the sum of the four purines) and the two major purine-forming bases (adenine and hypoxanthine) are negatively correlated with pork tenderness, juiciness, oiliness, and overall taste, but have no significant correlation with umami. Guanine, a relatively small percentage, is positively correlated with umami. Targeted purine base selection is necessary to reduce purine base content without compromising taste. Therefore, identifying markers that influence purine bases and improving breeding populations based on these markers is crucial for the production and economic benefits of the pig industry. Summary of the Invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP marker that affects the purine base content of pigs.

[0006] Another object of the present invention is to provide applications of the above-mentioned SNP markers.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A SNP marker that affects the purine base content of pigs, comprising at least one of the following SNP markers:

[0009] (I) The SNP site corresponds to the T>C mutation at position 9130411 on chromosome 2 of the international porcine genome version 11.1;

[0010] (II) The SNP site corresponds to the C>T mutation at position 111047325 on chromosome 8 of the international porcine genome version 11.1;

[0011] (III) The SNP site corresponds to the T>C mutation at position 59962069 on chromosome 12 of the international porcine genome version 11.1;

[0012] (IV) The SNP site corresponds to the T>C mutation at position 40604597 on chromosome 12 of the international porcine genome version 11.1;

[0013] (V) The SNP site corresponds to the A>G mutation at position 64561163 on chromosome 2 of the international porcine genome version 11.1;

[0014] (VI) The SNP site corresponds to the T>C mutation at position 15496193 on chromosome 15 of the international porcine genome version 11.1;

[0015] (VII) The SNP site corresponds to the A>T mutation at position 1627202 on chromosome 9 of the international porcine genome version 11.1;

[0016] (VIII) The SNP site corresponds to the A>G mutation at position 28473456 on chromosome 17 of the international porcine genome version 11.1;

[0017] (IX) The SNP site corresponds to the G>A mutation at position 223710348 on chromosome 1 of the international porcine genome version 11.1;

[0018] (Ⅹ) The SNP site corresponds to the C>T mutation at position 63901107 on chromosome 2 of the international porcine genome version 11.1;

[0019] (ⅩⅠ) The SNP site corresponds to the C>T mutation at position 121459275 on chromosome 7 of the international porcine genome version 11.1;

[0020] (ⅩⅡ) The SNP site corresponds to the A>G mutation at position 120820145 on chromosome 8 of the international porcine genome version 11.1;

[0021] (ⅩⅢ) The SNP site corresponds to the A>C mutation at position 119883227 on chromosome 15 of the international porcine genome version 11.1;

[0022] (XIV) The SNP site corresponds to the T>C mutation at position 28461000 on chromosome 17 in the international porcine genome version 11.1;

[0023] (XV) The SNP site corresponds to the T>C mutation at position 135447169 on chromosome 15 of the international porcine genome version 11.1.

[0024] In a specific embodiment:

[0025] For (I), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 1, wherein M in the sequence is T or C, and the SNP site is the nucleic acid single base mutation T91-C91 at position 91 of the sequence annotation of SEQ ID NO: 1.

[0026] For (VII), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 2, wherein M in the sequence is A or T, and the SNP site is the nucleic acid single base mutation A40-T40 at position 40 of the sequence annotation of SEQ ID NO: 2.

[0027] For (XII), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 3, wherein M in the sequence is A or G, and the SNP site is the nucleic acid single base mutation A98-G98 at position 98 of the sequence annotation of SEQ ID NO: 3.

[0028] For (I)-(II), the source of the pig is American Landrace pig or its synthetic strain; the purine base is guanine.

[0029] For (III), the source of the pig is American Large White pig or its synthetic strain; the purine base is guanine.

[0030] For (IV), the source of the pig is American Landrace pig, American Large White pig, American Duroc pig or their synthetic lines; and the purine base is guanine.

[0031] For (V) and (VI), the source of the pig is American Landrace pig or its synthetic line; the purine base is adenine.

[0032] For (VII) and (VIII), the source of the pig is American Landrace pig or its synthetic strain; the purine base is hypoxanthine;

[0033] For (IX)-(XIV), the source of the pig is American Landrace pig or its synthetic strain; and the purine base is total purine.

[0034] For (XV), the source of the pig is American Landrace pig, American Large White pig, American Duroc pig or their synthetic lines; the purine base is total purine.

[0035] A primer combination for detecting the above-mentioned SNP marker comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, whose nucleotide sequences are shown in SEQ ID NO:4-9.

[0036] A kit for detecting the above-mentioned SNP marker comprises the above-mentioned primer combination.

[0037] The SNP marker, primer combination or kit is used in identifying pig or pork purine base content or meat quality related traits, screening pig breeds with high guanine base content, low other purine base content or excellent meat quality, or in genetic breeding of pig purine base content or meat quality related traits.

[0038] A method for genetic improvement of pigs, comprising the following steps:

[0039] Determine the above SNP markers for the sows in the sow core group and make corresponding selections based on the SNP markers:

[0040] For (I), selecting from the core population of sows individuals with a C / T or C / C genotype at position 9130411 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a T / T genotype at this position, so as to increase the frequency of the allele C at this position generation by generation;

[0041] For (II), selecting from the core population of sows those with the T / C or C / C genotype at position 111047325 on chromosome 8 of the International Porcine Genome Version 11.1, and eliminating those with the TT genotype at this position to increase the frequency of the allele C at this position generation by generation;

[0042] For (III), selecting from the core group of sows the C / C genotype at position 59962069 on chromosome 12 of the International Porcine Genome Version 11.1, and eliminating the C / T genotype at this position, so as to increase the frequency of the allele C at this position generation by generation;

[0043] For (IV), selecting from the core group of sows those with the T / C or C / C genotype at position 40604597 on chromosome 12 of the International Porcine Genome Version 11.1, and eliminating those with the T / T genotype at this position to increase the frequency of the allele C at this position generation by generation;

[0044] For (V), selecting from the core population of sows individuals with a G / A genotype at position 64561163 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a G / G genotype at this position to increase the frequency of allele A at this position generation by generation;

[0045] For (VI), selecting from the core group of sows those with the C / C or C / T genotype at position 15496193 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the T / T genotype at this position to increase the frequency of the allele C at this position generation by generation;

[0046] For (VII), selecting from the core group of sows those with the T / T genotype at position 1627202 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the T / A genotype at this position to increase the frequency of the allele T at this position generation by generation;

[0047] For (VIII), selecting from the core group of sows those with the G / G or G / A genotype at position 28473456 on chromosome 17 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype at this position to increase the frequency of the G allele at this position generation by generation;

[0048] For (IX), selecting from the core population of sows individuals with the A / A or A / G genotype at position 223710348 on chromosome 1 of the International Porcine Genome Version 11.1, and eliminating sows with the G / G genotype at this position, so as to increase the frequency of allele A at this position generation by generation;

[0049] For (X), selecting sow individuals with a T / C genotype at locus 63901107 on chromosome 2 of the International Porcine Genome Version 11.1 from the sow core group, and eliminating sow individuals with a T / T genotype at the locus, so as to increase the frequency of the allele C at the locus generation by generation;

[0050] For (XI), selecting from the core population of sows those with the T / T or T / C genotype at position 121459275 on chromosome 7 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype at this position to increase the frequency of the T allele at this position generation by generation;

[0051] For (XII), selecting from the core population of sows those with the G / G or G / A genotype at position 120820145 on chromosome 8 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype at this position to increase the frequency of the G allele at this position generation by generation;

[0052] For (XIII), selecting from the core population of sows those with the C / C or C / A genotype at locus 119883227 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype at the locus to increase the frequency of the allele C at the locus generation by generation;

[0053] For (XIV), selecting from the core population of sows individuals with a C / C or C / T genotype at position 28461000 on chromosome 17 of the International Porcine Genome Version 11.1, and eliminating sows with a T / T genotype at this position to increase the frequency of the allele C at this position generation by generation;

[0054] For (XV), select from the core group of sows those with the C / C or C / T genotype at position 135447169 on chromosome 15 of the International Swine Genome Version 11.1, and eliminate those with the T / T genotype at this site to increase the frequency of allele C at this site from generation to generation.

[0055] A method for identifying traits related to purine base content or meat quality in pigs or pork, comprising the following steps:

[0056] Determine the above-mentioned SNP markers of pigs or pork, and judge the purine base content or meat quality-related traits of pigs or pork based on the SNP sites of the SNP markers:

[0057] For (I), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 9130411 on chromosome 2 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype, T / T genotype;

[0058] For (II), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 111047325 on chromosome 8 of the International Porcine Genome Version 11.1, which is: C / C genotype, T / C genotype, T / T genotype;

[0059] For (III), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 59962069 on chromosome 12 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype;

[0060] For (IV), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 40604597 on chromosome 12 of the International Porcine Genome Version 11.1, which is: C / C genotype, T / C genotype, T / T genotype;

[0061] For (V), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 64561163 on chromosome 2 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype;

[0062] For (VI), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 15496193 on chromosome 15 of the International Porcine Genome Version 11.1, which is: T / T genotype, C / T genotype, C / C genotype;

[0063] For (VII), the purine base content of the pigs or pork is ranked from high to low according to the genotype of position 1627202 on chromosome 9 of the International Porcine Genome Version 11.1, which is: T / A genotype, T / T genotype;

[0064] For (VIII), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 28473456 on chromosome 17 of the International Porcine Genome Version 11.1, which is: A / A genotype, G / A genotype, G / G genotype;

[0065] For (IX), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 223710348 on chromosome 1 of the International Porcine Genome Version 11.1, which is: G / G genotype, A / G genotype, A / A genotype;

[0066] For (X), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 63901107 on chromosome 2 of the International Porcine Genome Version 11.1, which is: T / T genotype, T / C genotype;

[0067] For (XⅠ), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 121459275 on chromosome 7 of the international porcine genome version 11.1, which is: C / C genotype, T / C genotype, T / T genotype;

[0068] For (XII), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 120820145 on chromosome 8 of the International Porcine Genome Version 11.1, which is: A / A genotype, G / A genotype, G / G genotype;

[0069] For (XIII), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 119883227 on chromosome 15 of the International Porcine Genome Version 11.1, as follows: A / A genotype, C / A genotype, C / C genotype;

[0070] For (XIV), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 28461000 on chromosome 17 of the International Porcine Genome Version 11.1, which is: T / T genotype, C / T genotype, C / C genotype;

[0071] For (XV), the purine base content of the pigs or pork is arranged from high to low according to the genotype at position 135447169 on chromosome 15 of the international porcine genome version 11.1, which is: T / T genotype, C / T genotype, and C / C genotype.

[0072] Application of the SNP marker, primer combination or kit in the field of gene editing or transgenic.

[0073] A method for establishing a new pig strain and / or a new pig breed with improved purine base content or meat quality traits, comprising the following steps:

[0074] The above-mentioned SNP markers of pigs or pork are determined, and the following mutations are performed based on the SNP markers:

[0075] For (I), for pigs whose SNP marker genotype is T / T or C / T, the T / T or C / T genotype is mutated to a C / C genotype by site-directed mutagenesis;

[0076] For (II), the genotype of the SNP marker is T / T or T / C in pigs, and the T / T or T / C genotype is mutated to C / C genotype by site-directed mutagenesis;

[0077] For (III), the pigs whose SNP marker genotype is C / T are mutated into C / C genotype by site-directed mutagenesis;

[0078] For (IV), in pigs whose SNP marker genotype is T / T or T / C, the T / C or T / T genotype is mutated to a C / C genotype by site-directed mutagenesis;

[0079] For (V), the genotype of the SNP marker is G / G in pigs, and the G / G genotype is mutated to G / A genotype by site-directed mutagenesis;

[0080] For (VI), the pigs whose SNP marker genotype is C / T or T / T are mutated to C / C genotype by site-directed mutagenesis;

[0081] For pigs with the SNP marker genotype of T / A in (VII), the T / A genotype is mutated to a T / T genotype by site-directed mutagenesis;

[0082] For (VIII), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to the G / G genotype by site-directed mutagenesis;

[0083] For (IX), for pigs whose SNP marker genotype is A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype by site-directed mutagenesis;

[0084] For (X), the pigs whose SNP marker genotype is T / T are mutated to T / C genotype by site-directed mutagenesis;

[0085] For (XI), the pigs whose SNP marker genotype is T / C or C / C are mutated to T / T genotype by site-directed mutagenesis;

[0086] For pigs whose SNP marker genotype is G / A or A / A, mutating the G / A or A / A genotype to a G / G genotype by site-directed mutagenesis;

[0087] For (XIII), the pigs whose SNP marker genotype is C / A or A / A are mutated to C / C genotype by site-directed mutagenesis;

[0088] For (XIV), the pigs whose SNP marker genotype is C / T or T / T are mutated to C / C genotype by site-directed mutagenesis;

[0089] For (XV), in pigs whose SNP marker genotype is C / T or T / T, the C / T or T / T genotype is mutated to a C / C genotype by site-directed mutagenesis.

[0090] The mutation method is to use a transgenic method or a gene editing method to perform mutation.

[0091] The mutation method is preferably to perform mutation using the CRISPR / Cas9 gene editing method.

[0092] The present invention has the following advantages and effects compared to the prior art:

[0093] (1) The present invention is based on three experimental pig groups, namely American purebred Landrace pigs, American purebred Large White pigs and American purebred Duroc pigs. By using pig whole genome resequencing and GWAS analysis, 15 SNP markers that significantly affect the purine base content of pigs were studied and identified. At least one of the SNP markers of the present invention can be used to detect relevant indicators of pigs, or corresponding genetic improvement can be carried out through at least one of these SNP markers.

[0094] (2) The present invention establishes a set of efficient and accurate molecular marker-assisted breeding technologies based on SNP markers that affect the purine base content of pigs, including primers and kits for detecting the SNP markers, methods for identifying traits related to the purine base content or meat quality of pigs or pork, methods for genetic improvement of pigs, etc., which are applied to the genetic improvement of traits related to the purine base content and pork quality of pigs, and can quickly and accurately select and breed for traits related to the purine base content and pork quality of pigs, thereby significantly accelerating the breeding process.

[0095] (3) The present invention uses molecular breeding to solve the problem of high adenine, hypoxanthine and total purine content, or low guanine content. By optimizing the dominant allele of the above-mentioned SNP marker, the dominant allele frequency can be increased from generation to generation, the purine content can be reduced or increased, and the progress of pig genetic improvement can be accelerated, thereby effectively improving the economic benefits of pig breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] Figure 1 It is the Manhattan plot of the GWAS analysis of the guanine base content trait on different chromosomes of the experimental population; the X-axis is the position of the molecular marker site on the chromosome, and the Y-axis is the -log 10 (P value).

[0097] Figure 2 It is the Manhattan plot of the GWAS analysis of the adenine base content trait in the experimental population on different chromosomes; the X-axis is the position of the molecular marker site on the chromosome, and the Y-axis is the -log 10 (P value).

[0098] Figure 3 It is the Manhattan plot of the GWAS analysis of the hypoxanthine base content trait in the experimental population on different chromosomes; the X-axis is the position of the molecular marker site on the chromosome, and the Y-axis is the -log 10 (P value).

[0099] Figure 4 It is the Manhattan plot of the GWAS analysis of the total purine base content trait of the experimental population on different chromosomes; the X-axis is the position of the molecular marker site on the chromosome, and the Y-axis is the -log 10 (P value).

[0100] Figure 5 It is a violin plot of the guanine base content and adenine base content of different genotypes in the corresponding experimental population; wherein the X-axis represents the genotype of the SNP molecular marker site, and the Y-axis represents the base content of the individual.

[0101] Figure 6It is a violin plot of the hypoxanthine base content and total purine base content of different genotypes in the corresponding test population; wherein the X-axis represents the genotype of the SNP molecular marker site, and the Y-axis represents the base content of the individual. DETAILED DESCRIPTION

[0102] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0103] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0104] In the embodiment, guanine base, adenine base and hypoxanthine base together constitute the total purine. Among them, the xanthine base content of pigs is very low and difficult to detect, so the total purine content in the present invention does not include the xanthine content.

[0105] In the examples, the standard substances for HPLC detection were guanine (CAS: 73-40-5), adenine (CAS: 73-24-5) and hypoxanthine (CAS: 68-94-0), all purchased from Sigma.

[0106] Example 1

[0107] 1. Experimental Animals

[0108] The pig population used in the present invention includes: American purebred Landrace pigs (177 heads), American purebred Large White pigs (170 heads), and American purebred Duroc pigs (160 heads).

[0109] All pigs were obtained from Jiangxi Yudu Jiada Livestock Co., Ltd. and slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. at 200 days of age in the slaughterhouse's cutting room. The individual pigs were slaughtered, bled, and then the hair, viscera, head, tail, and limbs (below the wrist and joints) were removed and skinned to obtain white carcasses. Sampling was completed within 30 minutes of slaughter to minimize the effects of post-mortem metabolism on nuclear purine base content. The eye muscle (longissimus dorsi) was precisely isolated from the left side of the carcass between the first and second lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0 g of muscle tissue was quickly transferred to a 2 mL cryotube, minced, and quickly frozen in liquid nitrogen (-196°C). The sample was then stored in a -80°C ultra-low temperature freezer until testing.

[0110] 2. Quantitative determination of purine bases in pork by HPLC

[0111] (1) Accurately weigh 0.2 g of eye muscle tissue and place it in a 15 mL centrifuge tube. After mincing, add 2 mL of 8% (w / w) perchloric acid solution (which can hydrolyze the purine bases in nucleosides, nucleotides, nucleic acids and other compounds in the sample) and 1 mL of water, and vortex thoroughly to mix.

[0112] (2) Place the sample mixed in step (1) in a boiling water bath (100°C) and heat for 1 h, vortexing carefully every 10 min. After the sample cools to room temperature, adjust the pH of the system to 3.6 using 2 M potassium hydroxide solution and 5% (v / v) formic acid solution, and then dilute the extract to a final volume of 10 mL using ammonium formate buffer (pH = 3.6).

[0113] (3) The content of the three purine bases in the extract of each individual was detected by high performance liquid chromatography (HPLC) (unit: mg / 100 g). The specific operation was as follows: 10 mL of the extract obtained in step (2) was centrifuged at 3000 rpm at 4°C for 5 min to obtain a clear supernatant, which was then filtered through a 0.22 μm filter membrane and then measured on the instrument; HPLC analysis was performed on an Agilent 1260 InfinityII system (Agilent, USA) equipped with a UV detector and an operating wavelength of 254 nm. The sample components were separated on a Waters Atlantis T3 column (4.6 mm × 250.0 mm × 5.0 μm) (Waters, USA). The column temperature was 30°C, and the injection volume for each sample was 10 μL. For each injection, the sample was eluted at a constant flow rate of 1.0 mL / min using a mobile phase consisting of 99% (v / v) 10.0 mmol / L ammonium formate solution (pH = 3.6) and 1% (v / v) methanol solution. Concentration data obtained from the HPLC system were converted from the original unit of μg / mL to mg / 100 g using the following formula:

[0114]

[0115] where C represents the content of each purine base in 100 g of pork (mg / 100 g), and C0 represents the concentration of purine bases measured by HPLC (µg / mL).

[0116] (4) The present invention used the Wilcoxon rank sum test method in R language software (v4.3.1) to compare and analyze the differences in purine base content among the three pig breeds and the differences in purine content between individuals of different sexes within each breed. In addition, the Pearson correlation coefficient was used to calculate the correlation between the two groups of data for each purine phenotype.

[0117] Descriptive statistical results are shown in Table 1. As can be seen from the table, there are significant differences in guanine content among the three varieties. Duroc has the highest content, while Dabai has the lowest. Duroc has the highest content in hypoxanthine, while Dabai and Changbai do not show significant differences. Adenine shows an opposite trend to guanine. Total purine content, as the sum of the contents of the three bases, shows a similar trend to hypoxanthine, which is mainly related to the fact that hypoxanthine accounts for the highest proportion of total purine content.

[0118] Table 1 Descriptive statistics of four purine phenotypes in three varieties

[0119]

[0120] Note: LSM, least square mean; SD, standard deviation; CV, coefficient of variation (%); a,b,c , different letters indicate significant differences in the same trait between the two populations; S_B, slaughter batch; M_B, measurement batch; ns, P ≥ 0.05; *, P < 0.05; **, P ≤ 0.01; ***, P ≤ 0.001.

[0121] Example 2

[0122] 1. Acquisition, quality control, and typing of porcine whole-genome resequencing data

[0123] (1) DNA extraction: Ear tissue samples were collected from each individual of the three experimental pig groups in Example 1, and genomic DNA of each individual was extracted using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was between 1.8 and 2.0 and the A260 / 230 ratio was between 1.7 and 1.9.

[0124] (2) DNA sequencing: The concentration of DNA samples that meet the standards was diluted to 50 ng / μL, and the whole genome resequencing (double-end 150 bp sequencing mode) was completed using the BGI T7 sequencing platform. The average sequencing depth of the samples reached 30×, and the raw sequencing data in fastq format were obtained. After quality control by fastp (v0.23.0), clean reads were obtained for subsequent analysis.

[0125] (3) Sequence alignment: The data obtained in step (2) were aligned with the Sscrofa11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.

[0126] (4) Variation detection: Use samtools (v1.10) to sort and convert the sam format files in step (3) into bam format files, then use Sambamba (v0.8.2) to remove PCR duplicate sequences in the bam format files, and finally use Graphtyper (v2.7.7) to detect genetic variations in all individual bam files to obtain population-level genotype data (vcf file).

[0127] (5) Variant quality control: samtools was used to perform quality control on the population-level genotype data obtained in step (4). Among them, the variant sites with high-quality detection were retained under the conditions of "FILTER="PASS"" and the variant detection quality value GQ>20; Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with minor allele frequency (MAF) lower than 5% and samples with individual genotype call rate lower than 80%; finally, beagle (r1399) was used to self-fill the genotypes to obtain high-quality genotype data.

[0128] After a series of treatments using the above methods, 2,199,681, 2,258,840 and 1,757,796 mutation sites (including SNPs and Indels) were obtained in Large White, Landrace and Duroc, respectively.

[0129] 2. Genome-wide association study (GWAS) and meta-analysis

[0130] (1) Genome-wide Efficient Mixed Model Association algorithm (GEMMA, v0.98.1) was used to perform genome-wide association analysis on phenotypic data corrected for confounding factors. Specifically:

[0131] ① Processing of phenotype: The present invention uses the lm() function in the R language to perform simple linear regression by putting gender and batch into the function, and the corrected residual is used as the phenotype for the final association analysis.

[0132] ② The univariate linear mixed model (ULMM) was used for statistical inference, and its mathematical expression is constructed as follows:

[0133] Where y represents the n-dimensional vector of the phenotype to be analyzed (quantitative trait or binary vector), which in this study is the content of the four purine bases; W represents a matrix consisting of a column of "1" (n×c dimensions); α represents the effect of the corresponding covariate and the intercept value vector (c dimension), x represents the vector of genotypes at the test site (n dimension); β represents the vector of the effect size of the test site; u represents the mean is 0, and the covariance-variance matrix is ​​λτ -1 K random effect vectors (n dimensions) of a multivariate normal distribution; ε indicates that the mean is 0, and the covariance-variance matrix is ​​τ -1 The remaining residual vector (n-dimensional) of In. In two n-ary normal distributions, n represents the number of phenotypes, τ -1 represents the variance of the residuals, λ represents the ratio of the variance of the random effect to the variance of the residuals, K represents the n×n kinship matrix, and In represents the n×n identity matrix. MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, the genome-wide significance threshold was set at 0.05 / N (Bonferroni correction), where N is the number of valid SNPs / indels.

[0134] (2) Using the results of the above GWAS analysis, a meta-analysis of the purine base content in these three groups was performed using the METAL software according to conventional methods. The meta-analysis was performed based on the standard error weighting method (SCHEME STDERR).

[0135] The present invention is based on GWAS analysis ( Figure 1-Figure 4 ), a total of 15 representative SNP loci were obtained (including those obtained through meta-analysis). Their basic genetic parameter information is shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the SNP name for a locus was not available on the website, the SNP name was presented as "chromosome_position." Other important genetic parameter information for each representative locus can be obtained from the GWAS analysis results using GEMMA software, including chromosome location and position information, alleles, effect size, and P value (Wald test).

[0136] Table 2 Basic genetic parameter information of 15 representative SNP loci in the mixed population

[0137]

[0138] Note: The meta-analysis integrated genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.

[0139] 3. Analysis of the differences in purine base content phenotypes among different genotypes

[0140] Plink (v1.9) was used to extract the genotypes of the molecular marker sites displayed by each individual of the three experimental groups of 507 pigs from the sequencing files. After counting the number of individuals of each genotype, the genotypes of these individuals were matched with their corresponding purine base content. Then, the summarize function in the dplyr package in the R language was used to statistically analyze the differences in phenotypic distribution under different genotypes. The results are shown in Table 3 and Figure 5-Figure 6 As shown in Figure 2. Among them, the P value is obtained from the variance test.

[0141] Table 3 Effects of various molecular marker sites on purine base content (unit: mg / 100g)

[0142]

[0143] 4. Heritability Analysis

[0144] Heritability is the most important basic genetic parameter in quantitative genetics and can be divided into broad-sense heritability, narrow-sense heritability and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h 2 ), which refers to the proportion of the variance of the quantitative trait's breeding value to the phenotypic variance. It is the additive effect after eliminating dominant and epistatic effects and is stably inherited across generations. This method estimates single-marker heritability based on the effect value (β) and its standard error (SE) for each locus in the GWAS result file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the genome-wide level. The specific calculation formula is as follows:

[0145]

[0146] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.

[0147] As shown in Table 4 , the heritability estimates for all phenotypes were at a moderate level, roughly ranging from 0.32 to 0.36.

[0148] Table 4 Heritability estimates of four phenotypes in three experimental populations (h 2 )

[0149]

[0150] Example 3

[0151] This example provides a method and process for detecting the SNP markers in Example 2. Specifically, the SNP markers rs331794591, 9_1627202, and rs339018821 are used as examples. The corresponding phenotypes are guanine base content, hypoxanthine base content, and total purine base content, respectively. The specific method is as follows:

[0152] 1. Primer Design

[0153] (1) The target fragment containing the SNP site (rs331794591) significantly associated with the guanine base content of American Landrace pigs is a 257 bp nucleotide sequence on chromosome 2 (SEQ ID NO: 1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and their nucleic acid sequences are as follows:

[0154] Upstream primer primer-F1: 5′-AGTGGCTGAGCAGAGTTGTC-3′ (SEQ ID NO: 4);

[0155] Downstream primer primer-R1: 5′-ATTGCCCCGTGCGTAAAATG-3′ (SEQ ID NO: 5).

[0156] (2) The target fragment containing the SNP site (9_1627202) significantly associated with the hypoxanthine base content of American Landrace pigs is a 294 bp nucleotide sequence on chromosome 9 (SEQ ID NO: 2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and their nucleic acid sequences are as follows:

[0157] Upstream primer primer-F2: 5′-GGAGTCCTCTAAGCATCACTGG-3′ (SEQ ID NO: 6);

[0158] Downstream primer: primer-R2: 5′-ATTCCCATTTCCCTCAACAGGAA-3′ (SEQ ID NO: 7).

[0159] (3) The target fragment containing the SNP site (rs339018821) significantly associated with the total purine base content of American Landrace pigs is a 215 bp nucleotide sequence on chromosome 8 (SEQ ID NO: 3). The upstream and downstream primers for sequence amplification are primer-F3 and primer-R3, and their nucleic acid sequences are as follows:

[0160] Upstream primer primer-F3: 5′-GCGCCTTGGGTTTCTTGTCT-3′ (SEQ ID NO: 8);

[0161] Downstream primer: primer-R3: 5′-CAACAGAGTGATGCTTCGCA-3′ (SEQ ID NO: 9).

[0162] 2. PCR Amplification

[0163] To a 10 μL reaction system, add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2× Taq PCR StarMix with Loading Dye, and 0.3 μL of each upstream and downstream primer. PCR reaction conditions were: 94°C denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55-60°C for 30 s, and extension at 72°C for 45 s, with a final extension at 72°C for 5 min.

[0164] 3. DNA Sequencing

[0165] DNA sequencing: performed at Shenzhen BGI Genomics Co., Ltd., with both forward and reverse reactions of the gene fragments tested. The resulting sequence was compared with the NCBI genome sequence to identify the mutation at the corresponding SNP site.

[0166] SEQ ID No:1 (chr2:9130320-9130577): AGTGGCTGAGCAGAGTTGTCTCAGAGTCTGTACAGGCCTCTGGACACCTGAATTATTCGTTCTCATCCTGTCCTGGGCCTCTCCTTTATT M (T>C) TCTAAAGAGAGATTGTCACCTTATCATCTAATGACTGTCATCTCTGGAATTCACCTGTCCCTTTCCTTTCCTCTTGAGCGATGATAAGGACCTTCTTGCGCAAGCTTTCAGAGCCCTCCCTGGACGGGGGATGTACCTTCTGGATACATTTTACGCACGGGGCAAT SEQ ID No:2 (chr9:1627162-1627456): GGAGTCCTCTAAGCATCACTGGTGTGACTGATGTGGAAA M (A>T) ACCACTGTCTACTGAAGCCAAATGGCCAAGGAAGAGGTACATGGGGGTGTGAAGCTGGGGACAGCTTTTTTAAAAGAATTATGCTGACATTGCCTACTAAGGTGACAACATAAATGCCTAGAAAT ATCACAAAGCAGATGACACCAAGCACAGGATCCTCCGTGAGCCCCAAAAGGATGAACTCTGTCACACTGCTGTGGTTTCCAGCCTCCATCTCTCCTGTGGGTTGTTCCTGTTGAGGGAAATGGGAAT SEQIDNo:3 (chr8:120820047-120820262): GCGCCTTGGGTTTCTTGTCTCTTTAGAGCATGTTAGAGTTACTAGGTACCACCCATTCTCCAGACAGGTGCCATATTTGACTCAGCCAGGCAGAGAA M (A>G) CCGTTGAGAAGTAGCATAGCAATGACGTCCCTGACACCCACTGCAGCCACCGCTCTTAAGTAAGCTATTATTTCACATCACAGAAGCAGCTGTGATTTGCGAAGCATCACTCTGTTG

[0167] Note: The M marked in the sequence is the mutation site, which is underlined (the mutated base in brackets is the allele mutation). The bold at the beginning and end of the sequence is the primer sequence binding position.

[0168] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A use of a SNP marker affecting purine base content in pigs for identifying traits related to purine base content or meat quality in pigs or pork, for screening pig breeds with high guanine base content, low other purine base content, or excellent meat quality, or for genetic breeding of traits related to purine base content or meat quality in pigs, characterized in that The SNP markers include at least one of the following SNP markers: (I) The SNP site corresponds to the T>C mutation at position 9130411 on chromosome 2 of the international porcine genome version 11.1; (II) The SNP site corresponds to the C>T mutation at position 111047325 on chromosome 8 of the international porcine genome version 11.1; (III) The SNP site corresponds to the T>C mutation at position 59962069 on chromosome 12 of the international porcine genome version 11.1; (IV) The SNP site corresponds to the T>C mutation at position 40604597 on chromosome 12 of the international porcine genome version 11.1; (V) The SNP site corresponds to the A>G mutation at position 64561163 on chromosome 2 of the international porcine genome version 11.1; (VI) The SNP site corresponds to the T>C mutation at position 15496193 on chromosome 15 of the international porcine genome version 11.1; (VII) The SNP site corresponds to the A>T mutation at position 1627202 on chromosome 9 of the international porcine genome version 11.1; (VIII) The SNP site corresponds to the A>G mutation at position 28473456 on chromosome 17 of the international porcine genome version 11.1; (IX) The SNP site corresponds to the G>A mutation at position 223710348 on chromosome 1 of the international porcine genome version 11.1; (Ⅹ) The SNP site corresponds to the C>T mutation at position 63901107 on chromosome 2 of the international porcine genome version 11.1; (ⅩⅠ) The SNP site corresponds to the C>T mutation at position 121459275 on chromosome 7 of the international porcine genome version 11.1; (ⅩⅡ) The SNP site corresponds to the A>G mutation at position 120820145 on chromosome 8 of the international porcine genome version 11.1; (ⅩⅢ) The SNP site corresponds to the A>C mutation at position 119883227 on chromosome 15 of the international porcine genome version 11.1; (ⅩⅣ) The SNP site corresponds to the T>C mutation at position 28461000 on chromosome 17 of the international porcine genome version 11.1; (XV) The SNP site corresponds to the T>C mutation at position 135447169 on chromosome 15 of the international porcine genome version 11.

1.

2. The use according to claim 1, characterized in that: For (I), the nucleic acid sequence of the SNP marker is as shown in SEQ ID NO: 1, wherein M in the sequence is T or C; For (VII), the nucleic acid sequence of the SNP marker is as shown in SEQ ID NO: 2, wherein M in the sequence is A or T; For (XII), the sequence of the SNP-tagged nucleic acid is shown in SEQ ID NO: 3, wherein M in the sequence is A or G.

3. A primer combination for detecting SNP markers affecting purine base content in pigs for use in identifying traits related to purine base content or meat quality in pigs or pork, screening pig breeds with high guanine base content, low other purine base content, or excellent meat quality, or genetic breeding for traits related to purine base content or meat quality in pigs, characterized in that The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, and the nucleotide sequences thereof are shown in SEQ ID NOs: 4-9.

4. A kit for detecting SNP markers that affect purine base content in pigs for use in identifying traits related to purine base content or meat quality in pigs or pork, screening for pig breeds with high guanine base content, low other purine base content, or excellent meat quality, or genetic breeding for traits related to purine base content or meat quality in pigs, characterized in that The kit comprises the primer combination described in claim 3.

5. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the SNP markers of the sows in the sow core group according to claim 1 or 2, and make corresponding selections based on the SNP markers: For (I), selecting from the core population of sows individuals with a C / T or C / C genotype at position 9130411 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a T / T genotype at this position, so as to increase the frequency of the allele C at this position generation by generation; For (II), selecting from the core population of sows those with the T / C or C / C genotype at position 111047325 on chromosome 8 of the International Porcine Genome Version 11.1, and eliminating those with the TT genotype at this position to increase the frequency of the allele C at this position generation by generation; For (III), selecting from the core group of sows the C / C genotype at position 59962069 on chromosome 12 of the International Porcine Genome Version 11.1, and eliminating the C / T genotype at this position, so as to increase the frequency of the allele C at this position generation by generation; For (IV), selecting from the core group of sows those with the T / C or C / C genotype at position 40604597 on chromosome 12 of the International Porcine Genome Version 11.1, and eliminating those with the T / T genotype at this position to increase the frequency of the allele C at this position generation by generation; For (V), selecting from the core population of sows individuals with a G / A genotype at position 64561163 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a G / G genotype at this position to increase the frequency of allele A at this position generation by generation; For (VI), selecting from the core group of sows those with the C / C or C / T genotype at position 15496193 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the T / T genotype at this position to increase the frequency of the allele C at this position generation by generation; For (VII), selecting from the core group of sows those with the T / T genotype at position 1627202 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the T / A genotype at this position to increase the frequency of the allele T at this position generation by generation; For (VIII), selecting from the core group of sows those with the G / G or G / A genotype at position 28473456 on chromosome 17 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype at this position to increase the frequency of the G allele at this position generation by generation; For (IX), selecting from the core population of sows individuals with the A / A or A / G genotype at position 223710348 on chromosome 1 of the International Porcine Genome Version 11.1, and eliminating sows with the G / G genotype at this position, so as to increase the frequency of allele A at this position generation by generation; For (X), selecting sow individuals with a T / C genotype at locus 63901107 on chromosome 2 of the International Porcine Genome Version 11.1 from the sow core group, and eliminating sow individuals with a T / T genotype at the locus, so as to increase the frequency of the allele C at the locus generation by generation; For (XI), selecting from the core population of sows those with the T / T or T / C genotype at position 121459275 on chromosome 7 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype at this position to increase the frequency of the T allele at this position generation by generation; For (XII), selecting from the core population of sows those with the G / G or G / A genotype at position 120820145 on chromosome 8 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype at this position to increase the frequency of the G allele at this position generation by generation; For (XIII), selecting from the core population of sows those with the C / C or C / A genotype at locus 119883227 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype at the locus to increase the frequency of the allele C at the locus generation by generation; For (XIV), selecting from the core population of sows individuals with a C / C or C / T genotype at position 28461000 on chromosome 17 of the International Porcine Genome Version 11.1, and eliminating sows with a T / T genotype at this position to increase the frequency of the allele C at this position generation by generation; For (XV), select from the core group of sows those with the C / C or C / T genotype at position 135447169 on chromosome 15 of the International Swine Genome Version 11.1, and eliminate those with the T / T genotype at this site to increase the frequency of allele C at this site from generation to generation.

6. A method for identifying traits related to purine base content or meat quality in pigs or pork, characterized in that The following steps are included: Determine the SNP marker of claim 1 or 2 of pig or pork, and judge the purine base content or meat quality-related traits of the pig or pork based on the SNP site of the SNP marker: For (I), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 9130411 on chromosome 2 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype, T / T genotype; For (II), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 111047325 on chromosome 8 of the International Porcine Genome Version 11.1, which is: C / C genotype, T / C genotype, T / T genotype; For (III), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 59962069 on chromosome 12 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype; For (IV), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 40604597 on chromosome 12 of the International Porcine Genome Version 11.1, which is: C / C genotype, T / C genotype, T / T genotype; For (V), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 64561163 on chromosome 2 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype; For (VI), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 15496193 on chromosome 15 of the International Porcine Genome Version 11.1, which is: T / T genotype, C / T genotype, C / C genotype; For (VII), the purine base content of the pigs or pork is ranked from high to low according to the genotype of position 1627202 on chromosome 9 of the International Porcine Genome Version 11.1, which is: T / A genotype, T / T genotype; For (VIII), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 28473456 on chromosome 17 of the International Porcine Genome Version 11.1, which is: A / A genotype, G / A genotype, G / G genotype; For (IX), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 223710348 on chromosome 1 of the International Porcine Genome Version 11.1, which is: G / G genotype, A / G genotype, A / A genotype; For (X), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 63901107 on chromosome 2 of the International Porcine Genome Version 11.1, which is: T / T genotype, T / C genotype; For (XⅠ), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 121459275 on chromosome 7 of the international porcine genome version 11.1, which is: C / C genotype, T / C genotype, T / T genotype; For (XII), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 120820145 on chromosome 8 of the International Porcine Genome Version 11.1, which is: A / A genotype, G / A genotype, G / G genotype; For (XIII), the purine base content of the pig or pork is ranked from high to low according to the genotype at position 119883227 on chromosome 15 of the International Porcine Genome Version 11.1, as follows: A / A genotype, C / A genotype, C / C genotype; For (XIV), the purine base content of the pigs or pork is ranked from high to low according to the genotype at position 28461000 on chromosome 17 of the International Porcine Genome Version 11.1, which is: T / T genotype, C / T genotype, C / C genotype; For (XV), the purine base content of the pigs or pork is arranged from high to low according to the genotype at position 135447169 on chromosome 15 of the international porcine genome version 11.1, which is: T / T genotype, C / T genotype, and C / C genotype.

7. Use of a SNP marker affecting purine base content in pigs, a primer combination for detecting a SNP marker affecting purine base content in pigs, or a kit for detecting a SNP marker affecting purine base content in pigs in the field of gene editing or genetic modification, characterized in that: The SNP marker is the SNP marker described in claim 1; The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, and the nucleotide sequence thereof is shown in SEQ ID NO:4-9; The kit comprises the above primer combination.

8. A method for establishing a new pig strain and / or new pig breed with improved purine base content or meat quality traits, characterized in that The following steps are included: Determine the SNP markers of pigs or pork according to claim 1 or 2, and perform the following mutations based on the SNP markers: For (I), for pigs whose SNP marker genotype is T / T or C / T, the T / T or C / T genotype is mutated to a C / C genotype by site-directed mutagenesis; For (II), the genotype of the SNP marker is T / T or T / C in pigs, and the T / T or T / C genotype is mutated to C / C genotype by site-directed mutagenesis; For (III), the pigs whose SNP marker genotype is C / T are mutated into C / C genotype by site-directed mutagenesis; For (IV), in pigs whose SNP marker genotype is T / T or T / C, the T / C or T / T genotype is mutated to a C / C genotype by site-directed mutagenesis; For (V), the genotype of the SNP marker is G / G in pigs, and the G / G genotype is mutated to G / A genotype by site-directed mutagenesis; For (VI), the pigs whose SNP marker genotype is C / T or T / T are mutated to C / C genotype by site-directed mutagenesis; For pigs with the SNP marker genotype of (VII) being T / A, the T / A genotype is mutated to a T / T genotype by site-directed mutagenesis; For (VIII), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to the G / G genotype by site-directed mutagenesis; For (IX), for pigs whose SNP marker genotype is A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype by site-directed mutagenesis; For (X), the pigs whose SNP marker genotype is T / T are mutated to T / C genotype by site-directed mutagenesis; For (XI), the pigs whose SNP marker genotype is T / C or C / C are mutated to T / T genotype by site-directed mutagenesis; For pigs whose SNP marker genotype is G / A or A / A, mutating the G / A or A / A genotype to a G / G genotype by site-directed mutagenesis; For (XIII), the pigs whose SNP marker genotype is C / A or A / A are mutated to C / C genotype by site-directed mutagenesis; For (XIV), the pigs whose SNP marker genotype is C / T or T / T are mutated to C / C genotype by site-directed mutagenesis; For (XV), in pigs whose SNP marker genotype is C / T or T / T, the C / T or T / T genotype is mutated to a C / C genotype by site-directed mutagenesis.

9. The method for establishing a new pig strain and / or new pig breed with improved purine base content or meat quality traits according to claim 8, characterized in that: The mutation method is to use a transgenic method or a gene editing method to perform mutation.

Images