Castration M1 virus-like particle subunit vaccine and preparation method thereof
Patent Information
- Application Number
- CN202480015548.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-21
- Filing Date
- 2024-02-23
- Publication Date
- 2025-10-21
AI Technical Summary
The existing technology has not yet provided a castrated M1 virus-like particle subunit vaccine that is easy for industrial production, has strong immunogenicity, and has a fast immune response. In particular, there is a lack of reports on the use of influenza virus M1 protein to construct a GnRH castrated vaccine.
By constructing the GnRH-I-M1 recombinant protein, combined with the influenza virus matrix protein M1, and using insect cell expression systems such as pFastBac1 vector, GnRH-I-M1 virus-like particles are cloned and expressed to achieve efficient production and purification, and combined with appropriate adjuvants for Vaccine preparation.
The GnRH-I-M1 virus-like particle vaccine has achieved high purity, strong immunogenicity and rapid immune response. It is suitable for animal castration, significantly reduces testosterone levels and testicular volume, and avoids animal pregnancy. The production process is simple and safe. high.
Smart Images

Figure 00000020_0000 
Figure 00000020_0001 
Figure 00000020_0002
Abstract
Description
Castration-resistant M1 virus-like particle subunit vaccine and preparation method thereof
[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field
[0002] The present invention relates to the field of biotechnology, and in particular to a castrated M1 virus-like particle subunit vaccine and a preparation method thereof. Background Art
[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.
[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can increase gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promote the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), and promote follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.
[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated counterparts. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, further inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.
[0006] Influenza virus belongs to the family Orthomyxoviridae and the genus Orthomyxovirus. Typical influenza viruses are spherical with a diameter of 80 to 120 nm. Matrix protein (M protein) is the most abundant protein in influenza virus. M protein can be divided into two types, M1 and M2. M1 is located on the outside of the nucleocapsid and the inside of the viral envelope lipids, and together with the surface glycoproteins and nucleocapsid, maintains the integrity of the virus particles. Studies have shown that cloning the three structural proteins HA, NA and M1 of influenza virus into baculovirus vectors can infect insect cells to self-assemble into influenza virus-like particles, and can safely stimulate a good immune response as a vaccine. How to use the M1 protein of influenza virus to construct a GnRH castration vaccine has not been reported in the prior art.
[0007] Summary of the Invention
[0008] In view of this, the technical problem to be solved by the present invention is to provide a castrated HBsAg virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.
[0009] The present invention provides a GnRH-VLP recombinant protein, GNRH-I-M1, which comprises GnRH and influenza virus matrix protein M1.
[0010] The GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.
[0011] The influenza virus matrix protein M1 has the amino acid sequence shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 5; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 5.
[0012] In some embodiments, influenza virus matrix protein M1 is expressed in tandem with GnRH, with GnRH located at the N-terminus.
[0013] The present invention also provides:
[0014] 1), a nucleic acid encoding the GnRH-VLP recombinant protein;
[0015] II), an expression unit containing a nucleic acid encoding GnRH-VLP;
[0016] III), a recombinant vector containing a nucleic acid encoding GnRH-VLP or an expression unit as described above;
[0017] IV), transforming or transfecting host cells with an expression vector for GnRH-VLP;
[0018] V) The culture product of the host cells as described above.
[0019] The nucleic acid can be DNA, RNA, cDNA or PNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be, for example, a part of a vector (e.g., an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc. The gene sequence can use a wild-type sequence or be codon-optimized, which is not limited by the present invention. The nucleic acids described in the present invention are respectively nucleic acids encoding influenza virus matrix protein M1, nucleic acids encoding hemagglutinin HA, nucleic acids encoding neuraminidase NA and nucleic acids encoding GnRH-I. Among them, the nucleic acid sequence encoding M1 is shown in SEQ ID NO: 6, the nucleic acid sequence encoding GnRH-I is shown in SEQ ID NO: 3 or 4, the nucleic acid sequence encoding hemagglutinin HA is shown in SEQ ID NO: 7, and the nucleic acid sequence encoding neuraminidase NA is shown in SEQ ID NO: 8.
[0020] The expression units provided herein contain at least one target fragment, for example, at least one fragment selected from the group consisting of nucleic acid encoding influenza virus matrix protein M1, nucleic acid encoding hemagglutinin HA, nucleic acid encoding neuraminidase NA, and nucleic acid encoding GnRH-I. In some embodiments, the expression units provided herein contain only one target fragment. The expression units described herein include expression units comprising a single or multiple nucleic acids described herein in tandem with a promoter and terminator, but are not limited thereto.
[0021] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for expression of the operably linked coding gene in a specific host organism. Nucleic acid sequences or elements necessary for expression in bacteria include promoters, ribosome binding sites, and possibly other sequences. The recombinant expression vector is selected based on the host. The expression vector described in the present invention can be circular or linear, and this is not limited in the present invention. For example, a prokaryotic host can be Escherichia coli, Bacillus, Streptomyces, or cyanobacteria; for example, a eukaryotic host can be an insect cell or a fungus. In the present invention, the insect cell sf9 is used as the host, and the backbone vector can be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid, a pcDNA series plasmid, or pFastBac1. For example, the recombinant backbone vector is a pET series vector, and optionally, the backbone vector of the recombinant vector is pFastBac1.
[0022] The construction of the recombinant vector provided by the present invention comprises cloning the nucleic acid fragment encoding the fusion protein as described above into an expression vector by homologous recombination method.
[0023] The present invention provides recombinant vectors M1-pFastBac1, HA-pFastBac1, NA-pFastBac1 and GnRH-pFastBac1, which are respectively obtained by cloning nucleic acids encoding influenza virus matrix protein M1, hemagglutinin HA, neuraminidase NA and GnRH-I into the SpeI site and KpnI site of a pFastBac1 vector of a Bac-to-Bac Expression System insect cell-baculovirus expression system through a homologous recombination method.
[0024] Furthermore, the present invention also provides a host cell transformed or transfected with the aforementioned recombinant vector, or with the aforementioned nucleic acid integrated into its genome.
[0025] The hosts described in the present invention include bacteria, fungi, viruses or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeasts include brewer's yeast, cerevisiae, Pichia pastoris, and Candida, etc. The viruses include but are not limited to adenoviruses, adeno-associated viruses, lentiviruses, and prions. The animals include humans, insects, mice, rabbits, pigs, zebrafish, etc. The expression of the nucleic acid encoding the recombinant protein in the host can be either integrated or free, and the present invention does not limit this. In the embodiment of the present invention, insect cells are used as the expression host, preferably Sf9 cells.
[0026] The host construction method of the present invention comprises: co-transfecting Sf9 cells with the aforementioned recombinant baculovirus M1-pFastBac1-V, HA-pFastBac1-V, NA-pFastBac1-V and GnRH-pFastBac1-V to obtain the host.
[0027] Furthermore, the present invention also provides a culture product of the host cell.
[0028] The method for preparing the GnRH-I-M1 recombinant protein of the present invention comprises: culturing the host cell as described above to obtain a culture product containing the recombinant protein.
[0029] Specifically, the method for preparing the GnRH-I-M1 virus-like particles of the present invention comprises the following steps:
[0030] (1) The influenza virus matrix protein M1, hemagglutinin HA, neuraminidase NA, and GnRH-I gene gene fragments were directly cloned into the pFastBac1 insect expression vector to obtain positive recombinant plasmids M1-pFastBac1, HA-pFastBac1, NA-pFastBac1, and GnRH-pFastBac1;
[0031] (2) The above recombinant plasmid was transformed into DH10Bac competent cells and the recombinant bacmid DNA was extracted;
[0032] (3) After the recombinant bacmid was transfected into Sf9 cells, the cell supernatant was collected and further infected with new Sf9 cells. The cells were inoculated for three generations, and the culture supernatant of Sf9 cells was collected and purified to obtain GNRH-I-M1 virus-like particles.
[0033] As a preferred solution for expressing recombinant Sf9, the insect cell expression vector is pFastBac1.
[0034] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention are used in the preparation of subunit vaccines.
[0035] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration M1 virus-like particle subunit vaccine, which includes the recombinant protein as described above. The vaccine is a castration vaccine for male animals. The male animals are animals that can be castrated, including birds and mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, they are felines, canines, or rodents, such as mice. The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant, or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.
[0036] Furthermore, the method for preparing the subunit vaccine comprises mixing the recombinant protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.
[0037] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Correspondingly, the present invention also provides the use of the above-mentioned vaccine in animal castration. Correspondingly, the present invention also provides a method for castrating animals, comprising administering the vaccine as described above. In the present invention, the castration includes increasing the level of GnRH antibodies, reducing the level of testosterone, reducing the volume and / or weight of the testicles, and preventing animal pregnancy. In the present invention, the dosage administered is 200 μg. 10 to 100 days after immunization, the anti-GnRH recombinant protein antibody titer and testosterone level decreased.
[0038] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 3.77% of the original level.
[0039] In some tests, the weight of the mouse testicles was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, the weight of the mouse testicles was reduced to 19.04% of the original level.
[0040] In some tests, the cat's testicular volume is reduced to 50% to 90% of its original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the cat's testicular volume is reduced to 89.15% of its original level.
[0041] The beneficial effects of the present invention are as follows:
[0042] First, the GnRH-I-M1 virus-like particles of the present invention are expressed by Sf9 cells, the production process is simple, and the purity of the GnRH-I-M1 virus-like particles is high;
[0043] Second, the antigens expressed in tandem with the M1 virus-like particles showed high antigenicity, could induce high levels of specific antibodies, and had a rapid humoral immune response;
[0044] Third, subunit vaccines use proteins on the surface of influenza viruses and do not contain nucleic acid substances. Therefore, they are safe and do not pose risks of virus spread, virulence relapse, or environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS
[0045] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. For those skilled in the art, other implementation drawings can be derived from the provided drawings without inventive effort:
[0046] Figure 1 is a schematic diagram of the recombinant plasmids after the gene provided in the embodiment of the present invention is connected with the pFastBac1 plasmid: A: GnRH-pFastBac1, B: M1-pFastBac1, C: HA-pFastBac1, D: NA-pFastBac1;
[0047] FIG2 is a schematic diagram of SDS-PAGE of GnRH-I-M1 virus-like particle protein provided in an embodiment of the present invention;
[0048] Figure 3 shows the serum antibody titers of mice immunized with GnRH-I-M1;
[0049] FIG4 shows the testosterone levels in mouse serum;
[0050] Figure 5 shows the average testicular weight of mice in each group;
[0051] Figure 6 shows the changes in testicular volume of male cats in each group. DETAILED DESCRIPTION
[0052] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.
[0053] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0054] The molecular biology experimental methods such as enzyme digestion and homologous recombination ligation used in the examples of the present invention can be referred to the second edition of Molecular Cloning. The basic materials for preparing the GnRH-I-M1 virus-like particles of the present invention include: M1 protein nucleotide sequence (GenBank: CY027756.1), HA protein nucleotide sequence (GenBank: CY027755.1), NA protein nucleotide sequence (GenBank: CY027757.1), GnRH-I nucleotide sequence (SEQ ID NO. 5), pFastBac1 plasmid, Spodoptera frugiperda Sf9 cells, Invitrogen SNAP Midiprep Kit (Catalog no. K1910-01), LB medium, SF900 III cell culture medium, Opti-mem medium, Cellfectin II transfection reagent, X-gal, IPTG, gentamicin, ampicillin, kanamycin, tetracycline, etc. The nucleotide sequences were sent to BGI for synthesis of M1-pFastBac1, HA-pFastBac1, NA-pFastBac1, and GnRH-I-pFastBac1 recombinant plasmids.
[0055] The present invention provides a GnRH-I-M1 recombinant protein. First, recombinant baculoviruses M1-pFastBac1-V, HA-pFastBac1-V, NA-pFastBac1-V, and GnRH-pFastBac1-V encoding the influenza virus matrix protein M1 gene (GenBank: CY027756.1), hemagglutinin HA (GenBank: CY027755.1), neuraminidase NA (GenBank: CY027757.1), and GnRH-I gene are constructed, and co-infected with Spodoptera frugiperda Sf9 cells to obtain GnRH-I-M1 virus-like particles for preparing a GnRH-I-M1 subunit vaccine. The amino acid sequence of M1 is shown in SEQ ID NO. 2.
[0056] The sequence involved in the present invention is as follows:
[0057] GnRH is also referred to herein as GnRH-I, and its amino acid sequence is:
[0058] QHWSYGLRPG (SEQ ID NO: 1, denoted as GnRH-IQ)
[0059] or EHWSYGLRPG (SEQ ID NO: 2, denoted as GnRH-IE)
[0060] The nucleic acid sequence encoding GnRH-1 is:
[0061] CAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO.3, encoding GnRH-I Q )
[0062] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4, encoding GnRH-I E )
[0063] The amino acid sequence of influenza virus matrix protein M1 is:
[0064] The nucleic acid sequence encoding influenza virus matrix protein M1 is:
[0065] HA nucleotide sequence
[0066] NA nucleotide sequence
[0067] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:
[0068] Example 1 GnRH-I-M1 subunit vaccine
[0069] The viral core protein influenza matrix protein (M1) can assemble into enveloped virus-like particles (VLPs) when expressed simultaneously with antigens containing influenza hemagglutinin (HA) and neuraminidase (NA).
[0070] 1. Acquisition of GnRH-I-M1 target protein
[0071] (1) Construction of recombinant plasmid
[0072] The GnRH-I gene sequence and HA gene sequence were synthesized into the pcDNA3.1 expression vector by a gene company to obtain the recombinant plasmid GnRH-I-HA-pcDNA3.1, and the M1 gene sequence was synthesized into the pcDNA3.1 expression vector to obtain the recombinant plasmid M1-pcDNA3.1.
[0073] (2) Transfer the recombinant plasmid into the mammalian expression system
[0074] The recombinant plasmids GnRH-I-HA-pcDNA3.1 and M1-pcDNA3.1 were co-transfected into 293F cells transiently.
[0075] (3) GnRH-I-M1 VLP purification
[0076] After 48 h, the supernatant of transfected cells was harvested and GnRH-I-M1 VLPs were purified by ultrafiltration. The cells were concentrated using ultracentrifugal filter devices (Merck, Darmstadt, Germany). The concentrated sample was ultracentrifuged at 135,000 × g for 4 h at 4°C through a 20% glycerol buffer. The cell pellet containing GnRH-I-M1 VLPs was harvested and resuspended in 500 μL of phosphate-buffered saline (PBS).
[0077] 2. GnRH-I-M1 VLP subunit vaccine immunization method
[0078] GnRH-I-M1 VLP virus-like particles were mixed with aluminum hydroxide adjuvant for immunization. Eight-week-old male C57BL / 6 mice (five mice per group) were immunized with 50 μg of GnRH-I-M1 VLP vaccine on days 0, 14, and 28. Groups receiving GnRH-I-M1 VLP without adjuvant, adjuvant-PBS-negative, M1 alone, and GnRH-I alone were also set up. Anti-GnRH-I recombinant protein antibody titers and testosterone levels were measured in these mice. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.
[0079] 3. Determination of mouse anti-GnRH-I antibody titer
[0080] At different time points during the experiment, sera were collected from immunized mice and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows:
[0081] A 96-well plate was coated with 2 μg / mL GnRH-I BSA overnight at 4°C, with 100 μL per well added. The next day, the plates were washed five times with PBST and blocked with 300 μL of 2% skim milk powder at 37°C for 2 h. The plates were then washed five times with 1 / 1000 PBST. Mouse serum was serially diluted from the initial dilution of 1:500 to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000 in 2% skim milk powder. From high to low dilutions, 100 μL per well was added and incubated at room temperature with shaking for 45 min. The plates were washed five times with PBST. An HRP-labeled goat anti-mouse polyclonal antibody was used as the secondary antibody at a dilution of 1:5000 in 1% skim milk powder, with 100 μL per well incubated at room temperature with shaking for 45 minutes. Development was performed with TMB for 5-10 minutes, followed by a stop solution. Optical density (OD) was measured at 450 nm using an ELISA reader (BioRad Benchmark). These values were used to calculate the maximum OD450 serum dilution.
[0082] Example 2
[0083] Provided is a GnRH-I-M1 virus-like particle. The virus-like particle is obtained by connecting the H1N1 influenza virus matrix protein M1 gene with a pFastBac1 plasmid, co-transfecting Spodoptera frugiperda Sf9 cells with HA-pFastBac1, NA-pFastBac1, and GnRH-I-pFastBac1, and collecting the supernatant for passage and then purifying.
[0084] Specifically, the influenza virus matrix protein M1, hemagglutinin HA, neuraminidase NA and GnRH-I gene direct synthetic fragments were cloned between the SpeI and KpnI sites of the pFastBac1 insect expression vector to obtain positive recombinant plasmids M1-pFastBac1, HA-pFastBac1, NA-pFastBac1 and GnRH-I-pFastBac1; the expression strain used the Spodoptera frugiperda Sf9 cells.
[0085] The above-mentioned method for preparing M1 virus-like particles comprises the following steps:
[0086] (1) Construction of recombinant plasmids: The influenza virus matrix protein M1, hemagglutinin HA, neuraminidase NA, and GnRH-I genes were ligated with the pFastBac1 insect expression vector to obtain the recombinant plasmids M1-pFastBac1, HA-pFastBac1, NA-pFastBac1, GnRH-IQ-pFastBac1, and GnRH-IE-pFastBac1;
[0087] (2) Obtaining the recombinant bacmid: The recombinant plasmid was transformed into Escherichia coli DH10Bac competent cells and plated on LB medium containing X-gal (final concentration 100 μg / mL), IPTG (final concentration 40 μg / mL), kanamycin (final concentration 50 μg / mL), gentamicin (final concentration 7 μg / mL), and tetracycline (final concentration 10 μg / mL). After blue-white screening, white colonies were selected and the recombinant bacmid DNA was extracted.
[0088] (3) Obtaining and purifying recombinant baculovirus: The above-mentioned recombinant bacmid DNA was co-infected with Sf9 cells, and the supernatant was collected and reinfected with Sf9 cells three times. All the supernatants were collected and purified by ultrafiltration and ultracentrifugation to obtain GnRH-I-M1 virus-like particles dissolved in PBS.
[0089] Specifically, the steps for expressing and purifying GnRH-I-M1 virus-like particles are as follows:
[0090] (a1) Construction of recombinant plasmid
[0091] 5 μl of the glycerol bacteria containing plasmids (M1-pFastBac1, HA-pFastBac1, NA-pFastBac1, and GnRH-pFastBac1) was pipetted into 50 mL of LB medium (containing 100 μg / ml ampicillin) and cultured with shaking at 37°C for 14 to 16 hours. The plasmids were extracted using a plasmid extraction kit, and the nucleic acid concentration was detected by a protein nucleic acid detector.
[0092] (a2) Obtaining recombinant bacmid
[0093] The above recombinant plasmid was transformed into Escherichia coli DH10Bac competent cells. -1 , 10 -2 , 10 -3 Dilute the bacterial solution by 10 -2 , 10 -3A 200 μL dilution was spread on LB medium containing X-gal (final concentration 100 μg / mL), IPTG (final concentration 40 μg / mL), kanamycin (final concentration 50 μg / mL), gentamicin (final concentration 7 μg / mL), and tetracycline (final concentration 10 μg / mL). The cells were cultured at 37°C for 48 h. White colonies were selected and cultured in kanamycin + gentamicin + tetracycline triple antibody medium for 48 h to extract the recombinant bacmid DNA.
[0094] (a3) Obtaining and Purifying Recombinant Baculovirus
[0095] The density of Sf9 insect cells reached 3×10 6 / mL, inoculate the recombinant baculovirus at an MOI of 3, collect the cell supernatant after 3 to 5 days, and repeat 3 times; concentrate the cell supernatant through a 50KDa ultrafiltration tube, and after concentration, ultracentrifuge the sample at 135,000×g, 4°C for 4 hours in 20% glycerol buffer, and add PBS to resuspend the remaining sample to obtain GnRH-I-M1 virus-like particles.
[0096] Comparative Example 1
[0097] The recombinant bacmids of M1, HA, and NA were cultured in Sf9 cells to obtain M1 virus-like particles. The GnRH-I bacmid was inoculated into Sf9 cells to obtain GnRH-I protein, which was purified in the same manner as in Example 1.
[0098] Comparative Example 2
[0099] GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.
[0100] Example 3
[0101] Provided is a GnRH-I-M1 virus-like particle subunit vaccine immunization method:
[0102] GnRH-I prepared in Example 1 Q -M1 and GnRH-I E -M1 virus-like particles and aluminum hydroxide adjuvant were mixed in a volume ratio of 1:1 for immunization. On day 0, day 14, and day 28, 50 μg GnRH-I Q -M1 and GnRH-I E Eight-week-old male C57BL / 6 mice were immunized with the M1 virus-like particle vaccine (five mice per group). At the same time, the GnRH-I-AP205 virus-like particle and aluminum hydroxide adjuvant immunization groups, GnRH-I Q -M1 without adjuvant group, GnRH-IE -M1 without adjuvant group, adjuvant PBS negative group, simple M1 experimental group, simple GnRH-I Q and simple GnRH-I E Experimental group. Anti-GnRH-I recombinant protein antibody titers and testosterone levels were measured in these mice. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.
[0103] Example 4 Determination of mouse anti-GnRH-I antibody titer
[0104] At different time points during the experiment, sera were collected from immunized mice and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows. Q and GnRH-I E Coat 96-well plates overnight at 4°C, adding 100 μl per well. The next day, wash the plates five times with 1:1000 PBST and block with 300 μl of 2% BSA at 37°C for 2 h. Wash the plates five times with 1:1000 PBST. Then, serially dilute mouse serum with 2% BSA at a starting concentration of 1:500, then dilute them two-fold to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. Incubate at room temperature with shaking for 45 min, adding 100 μl per well, from high to low dilutions. Wash the plates five times with 1:1000 PBST. HRP-labeled goat anti-mouse polyclonal antibody was used as the secondary antibody at a dilution of 1:5000 in 2% skim milk powder. 100 μl was added to each well and incubated at room temperature with shaking for 45 minutes. TMB color development was performed for 5-10 minutes, followed by addition of 2M sulfuric acid for termination. The absorbance was read at a wavelength of 450 nm. The optical density (OD) at 450 nm was measured using an ELISA reader (BioRad Benchmark). The maximum OD was calculated using these data. 450 Serum dilution.
[0105] FIG3 shows that, in the GnRH-I prepared in Example 1 Q -M1 and GnRH-I E In the male mice immunized with -M1 virus-like particles without adjuvant, the average titer reached 16,000 on day 28, and rose to 64,000 after the third booster dose, and then decreased again with time. Q -M1+adjuvant and GnRH-I E The average titer of the -M1+adjuvant group reached 32,000 on day 28, and then rapidly increased to 128,000 after the third injection, and began to decline to 64,000 after 56 days. Qand GnRH-I E After three immunizations, the titer of the adjuvant-containing group reached only 8,000, while no antibody titers were detected in the M1 mixed adjuvant and PBS mixed adjuvant immunization groups. These results clearly demonstrate that GnRH-I-M1 VLPs can induce high anti-GnRH-I antibody titers, and the adjuvant-containing group exhibits even greater efficacy, similar to that of GnRH-I-AP205 prepared in the comparative example.
[0106] Example 5 Determination of testosterone levels and testicular weight in mice
[0107] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using a testosterone-ELISA (IBL, Hamburg, Germany).
[0108] Figure 4 shows that the use of GnRH-I Q -M1 and GnRH-I E In mice immunized with -M1 virus-like particles without aluminum hydroxide adjuvant, the average testosterone level was significantly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 2 ng / ml on day 70. Q In mice immunized with GnRH-I supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to <1.5 ng / ml on the 28th day. After 42 days, the average testosterone level remained stable at around 0.21, which was about 25.7 times lower than the average level of the central nervous system hormone in the control group of mice immunized with GnRH-I + aluminum hydroxide at the same time. E In mice immunized with GnRH-I supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to <1.5 ng / ml on day 28, and remained stable at around 0.22 after 42 days, which was significantly higher than that of the control group GnRH-I at the same time. E The average central nervous system hormone level in mice immunized with GnRH-I-M1 plus aluminum hydroxide was approximately 25.21 times lower. This clearly demonstrates that the GnRH-I-M1 plus adjuvant immunization group has a strong inhibitory effect on mouse testosterone. However, the comparative product, which was prepared in the control group, had an average hormone level approximately 20.8 times lower than that of the GnRH-I plus adjuvant immunization group, making it less effective than the GnRH-I-M1 plus adjuvant immunization group.
[0109] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.
[0110] Figure 5 shows that on day 70, GnRH-I Q and GnRH-I E The testicular weight of immunized mice was not significantly reduced, while that of mice receiving GnRH-I Q-M1 virus-like particles and aluminum hydroxide adjuvant immunized mice had an 81% reduction in testicular weight, and GnRH-I E Mice immunized with GnRH-I-M1 VLPs and aluminum hydroxide adjuvant showed a 79.9% decrease in testicular weight, clearly demonstrating that the GnRH-I-M1 adjuvant-based vaccine has a significant inhibitory effect on the mouse testicles. The product prepared in the comparative example showed a 75.7% decrease in testicular weight after immunization, a less potent effect than the GnRH-I-M1 VLPs provided in the Examples.
[0111] Example 6: Testicular volume determination of experimental cats
[0112] Six healthy male rural cats aged 12 months were divided into two groups, 3 in each group, one of which was the injection group and the other was the control group. Q M1 virus-like particles were mixed with aluminum hydroxide adjuvant at a volume ratio of 1:1 for immunization. 200 μg was injected subcutaneously behind the ear and neck. A second injection was given 28 days later at the same dose and route. The control group received no injection. All experimental animals were housed individually under the same conditions and observation.
[0113] After the first vaccination, measure the width and length of the testicles with a vernier caliper or tape measure every 14 days and calculate the testicular volume using the following formula:
[0114] Testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.
[0115] As shown in Figure 6, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that GnRH-I Q -M1 vaccine combined with adjuvant has a significant inhibitory effect on the testicles of cats.
[0116] Example 7 Determination of pregnancy status of experimental animals
[0117] Six healthy rural male cats and four female dogs aged 12-24 months were divided into two groups, with three male cats and two female dogs in each group. One group was the injection group and the other was the control group.
[0118] The injection group received a subcutaneous injection of 200 μg GnRH-I behind the ear and neck. Q -M1 + adjuvant, 28 days later, the second injection was administered by the same route, while the control group was not injected. All experimental cats were housed and observed under the same conditions, and all cats were housed individually.
[0119] Eight healthy male dogs aged 12 to 24 months and 12 healthy female cats aged 12 to 14 months were cage-paired with the injected and control groups. Fourteen days after the second injection, the three male cats in the injected and control groups were cage-paired with two healthy female cats, respectively; and the four female dogs in the injected and control groups were cage-paired with two healthy male dogs, respectively. Each group was rotated to breed to minimize behavioral incompatibilities between cats and dogs that could affect successful pairing.
[0120] After the cohabitation test begins, examine the females in the experimental group and their cohabiting females for pregnancy. After 30 days of observation, perform ultrasound to check for pregnancy.
[0121] As can be seen from Table 1, none of the female animals in the injection group and the paired female animals became pregnant, while a large number of female animals in the control group and the paired female animals became pregnant, indicating that GnRH-I Q -M1+ adjuvant has a good effect on castration of cats and dogs and is suitable for the development of castration vaccines for cats and dogs.
[0122] Table 1 Pregnancy status of experimental animals
Claims
1. GnRH-VLP recombinant protein, It is characterized in that Including GnRH and influenza virus matrix protein M1.
2. The recombinant protein according to claim 1, It is characterized in that The influenza virus matrix protein M1 and GnRH were expressed in tandem, with GnRH located at the N-terminus; Among them, GnRH has the amino acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2; and influenza virus matrix protein M1 has the amino acid sequence shown in SEQ ID NO:
5.
3. Biomaterials, It is characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.
4. A method for preparing the recombinant protein according to claim 1 or 2, It is characterized in that A vector containing influenza virus matrix protein M1 encoding nucleic acid, a vector containing GnRH encoding nucleic acid, a vector containing hemagglutinin HA encoding nucleic acid and a vector containing neuraminidase NA encoding nucleic acid are constructed respectively, and after transfection into animal cells, a culture product containing the recombinant protein according to claim 1 is obtained through culture.
5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.
6. Vaccines, It is characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.
7. The vaccine according to claim 6, It is characterized in that The adjuvant is aluminum hydroxide adjuvant.
8. A method for preparing the vaccine according to claim 6 or 7, It is characterized in that The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.
9. The preparation method according to claim 8, It is characterized in that The volume ratio of the mixture is 1:
1.
10. Methods of castration of animals, It is characterized in that Comprising administration of the vaccine of claim 6 or 7.