Application of gene CsPOD7 in cucumber haploid breeding

Abstract

The invention discloses application of a gene CsPOD7 in cucumber haploid breeding, and belongs to the technical field of molecular breeding. According to the invention, a parthenogenesis haploid induction gene CsPOD7 is cloned from cucumber, the CsPOD7 is knocked out through a CRISPR-Cas9 gene editing technology, and a cspod7 mutant is used as a male parent to be hybridized with other cucumber materials as a female parent, so that parthenogenesis haploid can be generated. The invention is the first application of the gene CsPOD7 in developing a parthenogenesis haploid induction line in dicotyledon, realizes the application of the haploid induction line based on the gene CsPOD7 in cucumber genetic breeding, accelerates the cucumber breeding process, and has huge potential application value and market prospect.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering and plant genetic breeding, in particular to the field of gene CsPOD7 Application in haploid breeding of cucumber. Background Art

[0002] cucumber( Cucumis sativus Cucumber (L.) is one of the most widely cultivated vegetable crops worldwide, boasting high economic and nutritional value and deeply loved by consumers. Cucumber is also an important vegetable crop in my country, playing a crucial role in agricultural production. According to data released by the Food and Agriculture Organization of the United Nations (FAO), China's cucumber planting area in 2022 was approximately 1.31 million hectares, with a total output of 77.31 million tons, accounting for 60.3% and 81.6% of the global cucumber planting area and total output, respectively. Therefore, cultivating new cucumber varieties with high yield, high resistance, and high quality is a major market demand. However, cucumber breeding still relies primarily on the traditional method of obtaining stable genetic material over multiple generations, a lengthy process that has severely hindered progress in cucumber genetic breeding. Haploid breeding, which can produce stable genetically pure material in just two generations, is a key technique in modern breeding. To date, cucumber haploid breeding has been used only sparingly, primarily through in vitro haploid induction, which is susceptible to factors such as genotype and culture conditions, resulting in very low haploid induction efficiency. Furthermore, we previously used genetic CsDMP A haploid induction line for in vivo parthenogenetic haploid induction of cucumber has been developed. In order to improve the promotion and application efficiency of the haploid induction line of cucumber, it is necessary to further develop more haploid induction lines for in vivo parthenogenetic haploid induction based on different genes. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a gene CsPOD7 Application in haploid breeding of cucumber.

[0004] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a gene CsPOD7 Application in haploid breeding of cucumber.

[0005] In the present invention, cucumber CsPOD7 The nucleotide sequence of the gene is: (a) the nucleotide sequence shown in SEQ ID NO: 1; or (b) a nucleotide sequence in which one or more nucleotides are substituted, deleted, and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function; (c) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions and expresses the same functional protein, the stringent conditions being hybridization in 0.1 x SSPE or 0.1 x SSC containing 0.1% SDS at 65°C, and washing the membrane with the same solution; or (d) a nucleotide sequence that has 80% or more homology to the nucleotide sequence of (a), (b) or (c) and expresses the same functional protein.

[0006] Cucumis sativus CsPOD7 The amino acid sequence of the protein encoded by the gene is: (a) the amino acid sequence set forth in SEQ ID NO: 2; or (b) an amino acid sequence that has equivalent functional activity of the amino acid sequence set forth in SEQ ID NO: 2 with substitution, deletion and / or addition of one or more amino acids.

[0007] (c) an amino acid sequence having 80% or more identity to any of the amino acid sequences defined in (a) or (b) and having the same function derived from Cucumis sativus.

[0008] Further, the application comprises: using at least one of mutagenesis, site-directed mutation, homologous recombination and the like to modify the Cucumis sativus gene CsPOD7 so that the function of the gene is lost or weakened.

[0009] In a second aspect, the application provides a method for constructing a Cucumis sativus parthenogenic haploid inducer line, using genetic engineering means to knock out the Cucumis sativus gene CsPOD7 , or silence or inhibit the expression of the Cucumis sativus gene CsPOD7 to obtain a positive transgenic plant, which is the Cucumis sativus parthenogenic haploid inducer line.

[0010] Further, the method for gene knockout, silencing or inhibition can be selected from at least one of CRISPR / Cas9, TALEN gene editing technology, EMS mutagenesis, T-DNA insertion, RNAi interference, promoter mutation and VIGS interference and the like.

[0011] The knockout CsPOD7 gene is to reduce the expression level of the Cucumis sativus gene CsPOD7 in the Cucumis sativus genome or to cause base insertion, deletion or substitution mutation of the Cucumis sativus gene CsPOD7 in the Cucumis sativus genome.

[0012] Preferably, the Cucumis sativus gene CsPOD7 is knocked out using CRISPR / Cas9 gene editing technology.

[0013] The method comprises: using the gene CsPOD7For the target, the sgRNA sequence based on CRISPR / Cas9 is designed, a DNA fragment containing the coding sequence of the sgRNA is connected to a vector carrying CRISPR / Cas9 (such as pKSE402 vector), and the cucumber is transformed.

[0014] Preferably, the nucleotide sequence of the sgRNA action site is 5'-TCGGTTATTACCAAAAAAC-3' and 5'-TGCTAAGACCAACCTCGAA-3'.

[0015] In a third aspect, the application provides the use of the transgenic plants obtained according to the method in cucumber breeding. The breeding methods include but are not limited to transgenesis, crossing, backcrossing, selfing or vegetative reproduction.

[0016] In a fourth aspect, the application provides a method for preparing and identifying cucumber haploids. The preparation method of the cucumber haploid induction line comprises: knocking out the cucumber CsPOD7 gene by using the CRISPR / Cas9 gene editing technology to obtain a pure and edited plant stably carrying green fluorescence, i.e. the cucumber haploid induction line. The cucumber haploid induction line or its selfed offspring obtained by the above method is used as the male parent, and is crossed with other cucumber materials as the female parent, and the haploid phenotype of the obtained hybrid offspring is identified or the fluorescence marker is identified or the ploidy is identified, and at least one method is selected to identify the hybrid offspring plant as haploid, i.e. the cucumber parthenocarpic haploid.

[0017] The beneficial effects of the application are: The application first discloses the biological function of the gene CsPOD7 , which is a cucumber parthenocarpic haploid induction gene, and uses the CRISPR / Cas9 gene editing technology to knock out the gene CsPOD7 , thereby creating a cucumber parthenocarpic haploid induction line, and further proving through crossing experiments that the mutation of the gene CsPOD7 can induce the generation of parthenocarpic haploids in cucumber. The application first successfully develops an in vivo haploid induction line based on knocking out the gene POD in the dicotyledonous plant cucumber, provides a basis for the application of the gene Figure 1 in haploid breeding of dicotyledonous plants, provides materials for improving the efficiency of cucumber haploid breeding, and has great significance in accelerating the breeding process of cucumber, and has great application value and market prospect. BRIEF DESCRIPTION OF DRAWINGS

[0018] cspod7 are the fruit and seed phenotype diagrams of the wild type cucumber material Changchunmiqi and cspod7 the mutant in the application. Among them, A and B are mature cucumber fruits and seeds of the wild type; C and D are cspod7Mature cucumber fruits and seeds of mutants; E and F are wild type and Figure 2 Statistics of mutant seed numbers. *** indicates that the differences between different treatment groups are statistically significant, *** indicates P <0.001. Aborted seeds refer to seeds that have not formed a normal embryo and are a normal phenotypic statistic.

[0019] Figure 3 These are the results of fluorescence screening of cucumber haploid seeds, where Figure A is a solid image under normal light and Figure B is a fluorescence image.

[0020] Figure 4 This is a phenotypic comparison diagram of diploid cucumber and haploid cucumber plants and leaves.

[0021] cspod7 This is the flow cytometry test results of cucumber diploid plants and haploid plants. DETAILED DESCRIPTION

[0022] The present invention provides a method for creating a cucumber parthenogenetic haploid induction line using gene editing technology, specifically CsPOD7 The gene mutant plants are used as parthenogenetic haploid induction lines to induce cucumber to produce parthenogenetic haploids.

[0023] The present invention adopts the following technical solutions: The present invention provides a method for preparing a cucumber parthenogenetic haploid induction line, the method comprising: knocking out CsPOD7 Gene silencing or suppression CsPOD7 The positive transgenic plants were obtained by expressing the gene, which was the cucumber parthenogenetic haploid induced line.

[0024] In the method, the knockout is to make the cucumber genome CsPOD7 The gene undergoes base insertion, deletion or substitution mutation, or is silenced or inhibited to make the cucumber genome CsPOD7 Gene expression levels are reduced.

[0025] In the method, the knockout of the cucumber genome CsPOD7 Methods include CRISPR / Cas9, EMS mutagenesis, T-DNA insertion or TALEN.

[0026] In the method, the silencing or inhibition of the cucumber genome CsPOD7 Ways to reduce expression levels include RNAi interference, promoter mutation or VIGS interference.

[0027] Further, the cucumber genome CsPOD7 The method for base insertion, deletion or substitution is CRISPR / Cas9 gene editing technology.

[0028] Further, the target sequence of the CRISPR / Cas9 is 86-104 and / or 324-342 of SEQ ID NO: 1.

[0029] In a specific embodiment of the present application, the method for making the base insertion or deletion or substitution mutation of the gene in the cucumber genome is as follows: CsPOD7 The method for making the base insertion or deletion or substitution mutation of the gene in the cucumber genome is as follows: CsPOD7 The target sequence is introduced into the CRISPR / Cas9 vector, and then the vector is introduced into the cucumber genome by the method of Agrobacterium infection of cucumber cotyledon, and the positive transgenic plants are obtained by green fluorescence screening.

[0030] The present application also provides a method for preparing cucumber parthenogenetic haploid, which comprises the following steps: crossing the cucumber parthenogenetic haploid inducer obtained by the above method with other cucumber materials as the female parent, identifying the hybrid offspring of each plant by green fluorescence marker screening or flow cytometry ploidy detection or phenotype observation, and selecting at least one method to identify the haploid plant of the hybrid offspring as the cucumber parthenogenetic haploid.

[0031] The method for screening the haploid by the green fluorescence marker comprises the following steps: the CRISPR / Cas9 vector containing the target sequence comprises the expression frame of the fluorescent protein EGFP, and the harvested hybrid offspring seeds are preliminarily screened for haploid by fluorescence irradiation. CsPOD7 The CRISPR / Cas9 vector containing the target sequence comprises the expression frame of the fluorescent protein EGFP, and the harvested hybrid offspring seeds are preliminarily screened for haploid by fluorescence irradiation. If the hybrid offspring seeds have no green fluorescence and are small and shriveled, they are considered as candidate haploids; if the seeds to be tested have green fluorescence and are normal and plump, they are hybrid diploids.

[0032] The method for identifying the ploidy of the haploid comprises the following steps: the candidate haploid is sown, and when it grows to an appropriate size, the 0.5 square centimeter tender leaf (about the size of a thumbnail) is taken to extract the cell nucleus, and the cell nucleus of the tender leaf of the wild type diploid cucumber material Zichunmici is used as a control. First, the cell nucleus signal of the control material is detected by flow cytometry, and 100 is set as the peak value of the diploid cell nucleus signal, and then the cell nucleus signal of the candidate haploid is detected by flow cytometry. If the detected signal peak value is at 50, it indicates that the plant is a haploid plant; if the detected signal peak is at 100, it indicates that the plant is a diploid plant.

[0033] The haploid phenotype identification method refers to the following method: if the growth of a single plant of hybrid offspring is weak, and the overall performance is dwarf, the various organs such as leaf and flower organs are small, and the male sterility and the like, the single plant is a candidate or haploid plant; if the growth of the plant of hybrid offspring is strong, the plant height is normal, the various organs such as leaf and flower organs are normally developed, the pollen activity is normal and the like, it is considered as a normal diploid plant.

[0034] The application further provides a recombinant expression vector containing the cucumber CsPOD7 gene.

[0035] The application further provides a recombinant expression vector containing the cucumber CsPOD7 gene.

[0036] The application further provides an engineering bacterium or a transgenic cell containing the cucumber CsPOD7 gene or the recombinant expression vector.

[0037] The application provides application of the cucumber CsPOD7 gene or the protein encoded by the gene in creating a cucumber parthenogenic haploid induction line.

[0038] The application further provides application of the cucumber CsPOD7 gene or the mutant of the protein encoded by the gene in cucumber parthenogenic haploid induction.

[0039] The following examples are used to illustrate the application, but not to limit the scope of the application. If not specifically indicated, the examples are all according to the conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions suggested by the manufacturer's instructions.

[0040] The cucumber materials used in the following examples are Changchunmiqi, 2073-1 and 2073-2, which are derived from the cucumber genetic improvement group of China Agricultural University, see Plant Physiology (Chen et al., 2016, 171: 1156-1168), Horticulture Research (Zhai et al., 2022, doi.org / 10.1093 / hr / uhac146), which are publicly available (only for scientific research and teaching purposes).

[0041] The pKSE402 vector is donated by Professor Huang Sanwen of Shenzhen Agricultural Genomic Institute, Chinese Academy of Agricultural Sciences.

[0042] Example 1: Obtain an edited plant of cucumber CsPOD7 gene 1. Target sequence design of sgRNA sequence The CRISPR-P v2.0 online website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) was used to CsPOD7 The nucleotide sequence of the gene was predicted and two specific target site sequences with a length of 19 bp were selected.

[0043] The first target site sequence is located at positions 86-104 of SEQ ID NO: 1, and the sequence of the sgRNA1 target site is 5'-TCGGTTATTACCAAAAAAC-3'.

[0044] The second target site sequence is located at positions 324-342 of SEQ ID NO: 1, and the sequence of the sgRNA2 target site is 5'-TGCTAAGACCAACCTCGAA-3'.

[0045] 2. CRISPR / Cas9-mediated CsPOD7 Construction of gene knockout vector The CRISPR / Cas9 vector is a recombinant vector obtained by connecting the first target site sgRNA1 sequence and the second target site sgRNA2 sequence to the pKSE402 vector.

[0046] 3. Obtain CsPOD7 transgenic plants The CRISPR / Cas9 vector plasmid constructed in the previous step was chemically transformed into GV3101 Agrobacterium competent cells to generate the recombinant strain GV3101 (CRISPR / Cas9). Specific steps were followed according to the Agrobacterium competent transformation instructions provided by the biotechnology company. Subsequently, using 9 Changchun Mici 9 as the starting material, the recombinant Agrobacterium was delivered to cucumbers by infecting their cotyledons. The resulting sprouts were screened for green fluorescent markers to initially identify positive transgenic cucumber plants.

[0047] 4. Targeting identification of transgenic plants Plant genomic DNA was extracted from young leaves of T0 transgenic plants and designed CsPOD7Transgenic targeting identification cloning and sequencing primers: CRCsPOD7-Seq-F: ATAGATAAGGAGGAAGCCATTAAG and CRCsPOD7-Seq-R: CCATGAAAGAGGTGTGATGGGAAATAT. Subsequently, the DNA of the obtained T0 generation transgenic plants was cloned using this pair of primers, the product was purified and connected to the pToPo vector, and transformed into DH5α colon competent cells. After incubation, LB solid medium containing ampicillin resistance was applied, and single clones were picked and incubated in LB liquid medium containing ampicillin resistance. The picked single clones were PCR verified using this primer, and the single clone culture containing the correct target band was selected for Sanger sequencing. The sequencing results were compared with those of the wild type. CsPOD7 Gene sequences are compared. Refer to the following principles for identification CsPOD7 Genotype of transgenic plants: If the sequencing results show only wild-type sequences, the strain is considered to have no targeted editing and is a wild-type plant; if the sequencing results show both wild-type sequences and sequences with mutations, the strain is considered to be a heterozygous mutant plant; if the sequencing results show only mutant sequences but no wild-type sequences, the strain is considered to be a homozygous mutant plant.

[0048] According to the above identification principles, four T0 generation cucumber transgenic plants were identified, of which two had heterozygous mutations and two had biallelic mutations. The results are shown in Table 1.

[0049] Table 1 Cucumber CsPOD7 Targeting identification results of T0 generation transgenic plants

[0050] Sequencing results showed that among the four T0 transgenic plants, the T0-3 mutant line was similar to the wild type of cucumber genome. CsPOD7 Compared with the gene sequence, the specific mutation type is: the base G in the first target site of the two chromosomes is replaced by the base T, and the base replacement position is the 89th position of SEQ ID NO: 1.

[0051] In addition, after analyzing the sequencing results, another transgenic plant T0-4 mutant line was found to be different from the wild type cucumber genome. CsPOD7 Compared with the gene sequence, the specific mutation type is: the 12bp base AAGACCAACCTC in the second target site of the two chromosomes is replaced by CACGCTCAGCT, and its position is between positions 328 and 339 of SEQIDNO:1.

[0052] 5. T2 generation CsPOD7 Identification of editing types in transgenic plants The T0 generation mutant plants T0-3 and T0-4 obtained in step 4 are selfed, and after the cucumber fruits mature, the T1 generation seeds are harvested and screened for green fluorescent seeds by green fluorescent marker, and the edited type is identified (the identification method is the same as that in step 4), and the plants with the edited type are selfed and the T2 generation seeds are harvested, and the seeds are screened by green fluorescent marker, and the plant lines with green fluorescent and homozygous mutation are used as the cucumber parthenocarpy haploid induction lines.

[0053] After screening, T1-3-6, T1-3-8 and T1-4-3, T1-4-5, T1-4-12 plant lines are finally determined as the plant lines with green fluorescent marker and homozygous editing. The edited types of each plant line are as follows: Sequencing identification analysis: compared with the wild type cucumber CsPOD7 gene sequence, the edited types of T1-3-6 and T1-3-8 homozygous editing plant lines are that the base G in the first target site of the two chromosomes is replaced by the base T, and the base replacement position is the 89th position of SEQ ID NO: 1.

[0054] Sequencing identification analysis: compared with the wild type cucumber CsPOD7 gene sequence, the mutation types of T1-4-3, T1-4-5 and T1-4-12 homozygous mutation plant lines are that the 12 bp bases AAGACCAACCTC in the second target site of the two chromosomes are replaced by CACGCTCAGCT, and the positions are between the 328th and 339th positions of SEQ ID NO: 1.

[0055] Example 2 T2 generation CsPOD7 Application of gene homozygous and edited plants in cucumber parthenocarpy haploid induction 1. Cucumber CsPOD7 Seed setting rate and development of fruits of homozygous and edited plants Compared with the wild type cucumber material Changchunmoci, CsPOD7 the number of fruit seeds of the gene homozygous and edited plants is significantly reduced, and the number of un-developed seeds of the edited plants is obviously increased CsPOD7 . This shows that Figure 1 the mutation of the gene will affect the normal development of the seeds of the edited plants, resulting in a decrease in the seed setting rate.

[0056] 2. Identification of haploid plants and CsPOD7 Probability of gene homozygous and edited plants to induce cucumber haploids With CsPOD7 ​T2 generation homozygous editing plants T1-3-6, T1-3-8 and T1-4-3, T1-4-5, T1-4-12 were crossed with different cucumber materials as female parent (Chunmici, 2073-1 and 2073-2) respectively, and the obtained hybrid offspring were subjected to haploid screening and ploidy identification by the following method: (1) Preliminary screening of haploid using green fluorescent marker In the above description, CsPOD7 The gene homozygous editing plants were crossed with different cucumber materials as female parent. Since the CRISPR / Cas vector carries an independently expressed EGFP green fluorescent protein tag, the chromosome from the male parent carries the green fluorescent protein tag. Therefore, the harvested hybrid seeds were preliminarily screened for haploid using green fluorescence. If the hybrid offspring has green fluorescence, it is a heterozygous diploid, and if the hybrid offspring has no green fluorescence, it is preliminarily considered to be haploid. CsPOD7 ).

[0057] (2) Ploidy identification using flow cytometry The seeds screened in step (1) above without green fluorescence were sown, and when they grew to the appropriate size, 0.5 square centimeters (about the size of a thumbnail) of tender leaves were taken to extract the cell nuclei. The cell nuclei of the wild-type diploid cucumber material Chunmici tender leaves were used as a control. First, the flow cytometer was used to detect the signal peak value of the cell nuclei of the diploid cucumber material Chunmici, and 100 was set as the signal peak value of the diploid. Then the flow cytometer was used to detect the plants preliminarily screened in step (1) above in turn. If the signal peak value of the detection appears around 50, the plant is a haploid plant; if the signal peak value of the detection appears around 100, the plant is a diploid plant. Figure 3 ).

[0058] (3) Observation and identification of plant phenotype The haploid plants identified in steps (1) and (2) above were observed for phenotype. Relative to the diploid plants, the overall plant of the haploid plant was small, and both the leaves and various organs showed a small characteristic. Figure 4 ).

[0059] (4) Figure 2 Statistical results of haploid induction rate of knockout plants According to the above identification results CsPOD7 The haploid induction rate of knockout plants (Table 2): Haploid induction rate (%) = (number of haploids / total number of hybrid seeds) x 100 Table 2 CsPOD7 cspod7 Haploid induction rate statistics

[0060] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof. It is therefore intended that whatever is described herein be considered in all its aspects as an example of the application and that the application be limited only by the scope of the appended claims.

Claims

1. Cucumis sativus CsPOD7 application of the gene in haploid breeding, characterized in that The cucumber CsPOD7 The nucleotide sequence of the gene is: (a) the nucleotide sequence shown in SEQ ID NO: 1; or (b) a nucleotide sequence that is derived from the substitution, deletion, and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 1, and that expresses the same functional protein; (c) a nucleotide sequence that has more than 80% homology with the nucleotide sequence of (a) or (b), and that expresses the same functional protein.

2. The cucumber plant of claim 1 CsPOD7 a protein encoded by the gene, characterized in that, The amino acid sequence of the protein is: (a) the amino acid sequence shown in SEQ ID NO: 2; or (b) an amino acid sequence that is derived from the substitution, deletion, and / or addition of one or more amino acids of the amino acid sequence shown in SEQ ID NO: 2, and that has equivalent functional activity; (c) an amino acid sequence that has more than 80% identity with any one of the amino acid sequences defined in (a) or (b), and that is derived from cucumber and has the same function.

3. Use according to claim 1, characterized in that, The application comprises: using at least one means of mutagenesis, site-directed mutagenesis, homologous recombination to the cucumber gene CsPOD7 is modified so that the function of the gene is lost or weakened.

4. A method for constructing a cucumber parthenogenic haploid inducing line, characterized in that, The specific steps are as follows: knocking out the cucumber gene CsPOD7 or silencing or inhibiting the expression of the cucumber gene CsPOD7 by using genetic engineering means to obtain a positive transgenic plant, i.e., a cucumber parthenocarpic haploid induction line. The method of knocking out, silencing or inhibiting the gene is selected from the group consisting of CRISPR / Cas9 gene editing technology to knock out the cucumber gene CsPOD7 ; Specifically, taking genes CsPOD7 as targets, sgRNA sequences based on CRISPR / Cas9 are designed, a DNA fragment containing the sgRNA sequence is connected to a vector carrying CRISPR / Cas9 to transform cucumber; The nucleotide sequences of the sgRNA action sites are 5'-TCGGTTATTACCAAAAAAC-3' and 5'-TGCTAAGACCAACCTCGAA-3'.

5. Use of the transgenic plant obtained by the method of claim 4 in the breeding of cucumber.

6. Use according to claim 5, characterized in that, The breeding method comprises transgenesis, hybridization, backcrossing, selfing, or vegetative reproduction. The breeding method comprises transgenesis, hybridization, backcrossing, selfing, or vegetative reproduction.

Images