Application of FveHDZ20 protein for regulating and controlling heat resistance of plants

By inhibiting the expression of FveHDZ20 protein in strawberry plants and using CRISPR/Cas9 technology for gene editing, the problem of insufficient research on the high temperature stress response of strawberry seedlings was solved. This study achieved the enhancement of heat tolerance and regulation of abiotic stress response in strawberry plants, and provided a breeding pathway for new heat-tolerant strawberry varieties.

CN120842341APending Publication Date: 2025-10-28CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510802796.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-16
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

There are few studies on the high temperature stress response of strawberry seedlings, and the existing functional analysis of high temperature response genes lacks stable genetic transformation technology, making it difficult to cultivate new strawberry germplasm with strong heat resistance.

Method used

By reducing or inhibiting the expression of FveHDZ20 protein in strawberry plants, gene editing was performed using CRISPR/Cas9 technology to construct recombinant vectors and carry out stable genetic transformation of strawberries, thereby improving the heat resistance of the plants.

Benefits of technology

It significantly improved the heat resistance of strawberry plants, enhanced their tolerance to high-temperature stress, regulated their response to abiotic stress, and provided a pathway for breeding new heat-resistant strawberry varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120842341A_ABST
    Figure CN120842341A_ABST
Patent Text Reader

Abstract

The invention relates to application of FveHD20 protein for regulating and controlling heat resistance of plants. The heat resistance of the plant is improved by reducing or inhibiting expression of the FveHDZ20 protein in the plant, specifically, tissue culture seedlings, in-vitro leaves and adult seedlings of a mutant plant with the FveHDZ20 gene knocked out show higher heat resistance compared with plants with normal expression or overexpression of the FveHDZ20 protein, and the heat resistance of the plant is improved. And the abiotic stress resistance of the plant can be further regulated and controlled by regulating and controlling the heat resistance of the plant. The application of the invention provides a new path for cultivating strawberry varieties with heat resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene breeding, specifically to the application of the FveHDZ20 protein, which regulates plant heat tolerance. Background Technology

[0002] Strawberry (Fragaria ananassa Duch.) is an important protected horticulture crop in my country, prized for its delicious flavor and high nutritional value. Currently, fresh strawberries are primarily grown in greenhouses, mainly through asexual reproduction via runners. This requires seedling cultivation under high temperature and humidity conditions in summer, which greatly increases the risk of heat stress during the seedling stage within greenhouses. This stress negatively impacts strawberry growth, seedling quality, flower bud differentiation, and ultimately, fruit quality and yield. Given global warming and the increasing frequency of extreme weather events, cultivating heat-resistant strawberry varieties is of great significance. Identifying key genes regulating high-temperature stress in strawberries and elucidating their molecular mechanisms can provide candidate genes and genetic material for creating high-quality, heat-resistant new strawberry germplasm using gene editing technology and other biological breeding methods.

[0003] Given the strawberry's high sensitivity to environmental factors, especially temperature, previous studies have analyzed its response to high-temperature stress, such as the reduction of chlorophyll content, photosynthetic rate, and leaf water potential, while increasing membrane permeability, superoxide dismutase, and catalase activity. However, research and functional validation analysis of key genes involved in strawberry's high-temperature stress response and regulation remain lacking.

[0004] The HD-Zip family is a class of transcription factors unique to plants, playing important roles in multiple life processes, primarily including photomorphogenesis, shade response, plant growth and development, fruit ripening, and responses to various biotic and abiotic stresses. Previous studies have shown that the strawberry HD-Zip family comprises 31 members (FveHDZ1-FveHDZ31), divided into four subfamilies based on structure and function; however, the specific biological functions of each member remain unclear.

[0005] Current research on the regulation of strawberry's response to high temperature stress mainly focuses on reproductive growth stages such as flower development and fruit quality. There is relatively little research on strawberry seedling response to high temperature stress, and the discovery of important regulatory genes for strawberry high temperature stress is insufficient. Functional analysis of existing high temperature response genes is mainly conducted through transient gene expression or heterologous transformation with the help of other species. There is a lack of evidence for functional analysis using strawberry intrinsic stable genetic transformation technology. There is an urgent need to discover key genes in strawberry that regulate high temperature stress response and create new high-temperature resistant and high-quality strawberry germplasm. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide an application of the FveHD20 protein for regulating plant heat tolerance.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] An application of the FveHDZ20 protein, characterized in that the heat resistance of the plant is improved by reducing or inhibiting the expression of the FveHDZ20 protein in the plant.

[0009] The amino acid sequence of the FveHDZ20 protein is shown in SEQ ID NO.2, which is encoded by the CDS sequence of the FveHDZ20 gene shown in SEQ ID NO.1.

[0010] The FveHDZ20 protein is derived from strawberry (Fragaria vesca, cv Fragola di Bosco).

[0011] Inhibition of FveHDZ20 protein expression in plants is achieved through regulation of the FveHDZ20 gene (FveHDZ20 gene knockout), specifically through one of the following methods:

[0012] 1) Regulation at the transcriptional level of the gene; 2) Post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) Regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) Regulation of translation of the gene; 5) Regulation of mRNA degradation of the gene; 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0013] Furthermore, those skilled in the art can readily mutate the nucleotide sequence encoding the protein FveHDZ20 of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein FveHDZ20 isolated in this invention, provided they encode and function as protein FveHDZ20, are derived from and equivalent to the nucleotide sequence of this invention.

[0014] The aforementioned 75% or higher identity can be 80%, 85%, 90%, or 95% or higher. In this text, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0015] In this invention, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0016] Primers for detecting FveHDZ20 gene knockout results are characterized in that the sequences of the primers are shown in SEQ ID NO. 14-15.

[0017] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0018] An FveHDZ20 mutant, characterized in that the CDS sequence of the FveHDZ20 mutant is:

[0019] (1) As shown in SEQ ID NO.16; or

[0020] (2) As shown in SEQ ID NO.17; or

[0021] (3) As shown in SEQ ID NO.18.

[0022] A target gene for preparing the above-mentioned FveHDZ20 mutant, characterized in that the sequence of the target gene is:

[0023] (1) As shown in SEQ ID NO.19; and

[0024] (2) As shown in SEQ ID NO.20; and

[0025] (3) As shown in SEQ ID NO.21.

[0026] An application of FveHDZ20 protein in the breeding of heat-resistant strawberry varieties, characterized in that the application breeds heat-resistant strawberry varieties by reducing or inhibiting the expression of FveHDZ20 protein in strawberry plants.

[0027] A biological agent, characterized in that the biological agent is:

[0028] (1) A recombinant vector containing the amino acid sequence described in SEQ ID NO.2 or the nucleotide sequence described in SEQ ID NO.1;

[0029] (2) Recombinant microorganisms containing the amino acid sequence or the nucleotide sequence described in SEQ ID NO.1.

[0030] The aforementioned plant gene editing recombinant vector can be the pYLCRISPR / Cas9Pubi-H vector. Vectors are well known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors.

[0031] Recombinant expression vectors containing the FveHDZ20 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0032] When constructing a recombinant plant expression vector using the FveHDZ20 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0033] As a specific embodiment, the recombinant vector is the recombinant vector fvehdz20-cr. The recombinant vector fvehdz20-cr is obtained by inserting the expression cassette sequences of sgRNA1 and sgRNA2 into the restriction endonuclease BsaI site of the vector pYLCRISPR / Cas9Pubi-H, while keeping the other nucleotide sequences of the vector pYLCRISPR / Cas9Pubi-H unchanged. The recombinant plasmid is named the recombinant vector fvehdz20-cr.

[0034] The sgRNA1 and sgRNA2 expression cassette sequences are the promoter sequences of the pYLsgRNA-AtU6-29 vector, which can be transcribed into the AtU6-29 snRNA promoter, target site 2 on FveHDZ20 (5'-TCTAATTCTTCTTCTCCCAGCGG-3'), and the pYLsgRNA-AtU3b vector sequence to form a complete sgRNA expression cassette. The Agrobacterium is EHA105. The recombinant Agrobacterium can be EHA105 / fvehdz20-cr.

[0035] The application of the above-mentioned biological agent is characterized in that the biological agent improves the heat resistance of the plant by reducing or inhibiting the expression of FveHDZ20 protein.

[0036] The beneficial effects of applying the FveHDZ20 protein, which regulates plant heat tolerance, as described in this invention are as follows:

[0037] This invention improves the heat tolerance of strawberry plants by reducing or inhibiting the expression of the FveHDZ20 protein. Specifically, tissue-cultured seedlings, detached leaves, and mature seedlings of mutant plants with the FveHDZ20 gene knocked out all exhibited stronger heat tolerance compared to plants with normal or overexpressed FveHDZ20 protein. Furthermore, by regulating plant heat tolerance, the abiotic stress response of the plant can be further controlled. This invention provides a new pathway for breeding heat-tolerant strawberry varieties. Attached Figure Description

[0038] The present invention includes the following figures:

[0039] Figure 1 This is a diagram of the pYLCRISPR / Cas9Pubi-H vector.

[0040] Figure 2 Phenotypic diagrams of WT, FveHDZ20-OE and fvehdz20-cr plants.

[0041] Figure 3 Phenotypic diagrams of WT, FveHDZ20-OE and fvehdz20-cr under high temperature stress. Detailed Implementation

[0042] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0044] Unless otherwise specified, all quantitative experiments in the following examples were performed in triplicate. The strawberry variety di Bosco used in the following examples was purchased from THE HEIRLOOM SEED STORE (https: / / www.theheirloomseedstore.com / product / strawberry-fragola-di-bosco). The pYLCRISPR / Cas9Pubi-H plasmid used in the following examples was kindly provided by Professor Liu Yaoguang's research group at South China Agricultural University (as described in: Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors [J]. Science in China: Life Sciences, 2018, 48(07):783-794). The public may obtain this biological material from the applicant. This biological material is only for the purpose of repeating the experiments of this invention and may not be used for other purposes. The AtU6-29 plasmid in the following examples was kindly provided by Professor Liu Yaoguang's research group at South China Agricultural University (as recorded in: Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors [J]. Science in China: Life Sciences, 2018, 48(07):783-794). The pDONR221 vector and the plant expression vector pH7WG2D in the following examples were preserved in our laboratory and have been recorded in: Mao W, Han Y, Chen Y, Sun M, Feng Q, Li L, Liu L, Zhang K, Wei L, Han Z, Li B. Low temperature inhibits anthocyanin accumulation instrawberry fruit by activating FvMAPK3-induced phosphorylation of FvMYB10 and degradation of Chalcone Synthase 1. Plant Cell. 2022 Mar 29; 34(4):1226-1249). The biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention and may not be used for any other purpose.

[0045] Example 1: Construction of CRISPR-Cas9 recombinant vector fvehdz20-cr and overexpression recombinant vector FveHDZ20-OE and obtaining strawberry transformed plants.

[0046] The coding sequence of the FveHDZ20 gene in the strawberry variety 'di Bosco' is shown in SEQ ID No. 1 (nucleotide sequence) and the amino acid sequence of the encoded protein is shown in SEQ ID No. 2 (amino acid sequence).

[0047] 1. Construction of recombinant vector Fvehdz20-cr

[0048] 1) Target design. Targets for the FveHDZ20 gene were designed on the website http: / / crispr.hzau.edu.cn / CRISPR / . High-scoring target sequences with no off-target effects were selected, and primers were synthesized for vector construction.

[0049] Using pYLCRISPR / Cas9Pubi-H as the plant expression vector, the reverse complementary sequence located at positions 166-185 of SEQ ID NO.1 in the CDS sequence of FveHDZ20 was selected as one target (target 1, target sequence: 5'-TCTAATTCTTCTTCTCCCAGCGG-3'SEQ ID NO.19) for primer design and vector construction; the reverse complementary sequence located at positions 258-277 of SEQ ID NO.1 was selected as one target (target 2, target sequence: 5'-AGAGGTAGAGAGAGTAAGCGAGG-3'SEQ ID NO.20) for primer design and vector construction.

[0050] The primer sequences are as follows:

[0051] AtU6-29HDZ20-:5'-CTGGGAGAAGAATTAGAATTAGACAATCTCTTAGTCGACT-3'(SEQ IDNO.3)

[0052] gRT HDZ20+: 5'-TCTAATTCTTCTTCTCCCAGGTTTTAGAGCTAGAAAT-3' (SEQ ID NO.4)

[0053] AtU3bHDZ20-: 5'-CGCTTACTCTCTCTACCTCTGACCAATGTTGCTCC-3' (SEQ ID NO.5)

[0054] gRT HDZ20+: 5'-GAGGTAGAGAGAGTAAGCGGTTTTAGAGCTAGAAAT-3' (SEQ ID NO.6)

[0055] UF:5'-CTCCGTTTTACCTGTGGAATCG-3'(SEQ ID NO.7)

[0056] 2) Construction of sgRNA expression cassette. Using sgRNA as a template, and with the corresponding target site (U#T# / gRT#) and adapter...

[0057] (UF / gR-R) was used as primers to prepare the PCR reaction system. The system is shown in Table 1 below.

[0058] Table 1. PCR reaction system for constructing sgRNA expression cassettes

[0059]

[0060] The PCR reaction conditions were: 98℃ for 30s; 98℃ for 10s, 56℃ for 5s, 72℃ for 10s, 32 cycles; 72℃ for 1min.

[0061] The PCR products were detected by 1% agarose gel electrophoresis, and a band of approximately 500 kb was excised. Tiangen agarose gel was used for detection.

[0062] The fragment was recovered using a recovery kit. Using this fragment as a template, a second round of PCR amplification was performed using primers Pps-GGL, Pgs-GG2, Pps-GG2, and Pgs-GGR. The PCR system was the same as above. Electrophoresis was performed for detection and recovery. The primer sequences are as follows:

[0063] Pps-GGL: 5'-TTCAGAGGTCTCCTCGACTAGTATGGAATCGGGCAGCAAAGG-3' (SEQ ID NO.8)

[0064] Pgs-GG2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO.9)

[0065] Pps-GG2: 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3' (SEQ ID NO.10)

[0066] Pgs-GGR: 5'-AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCTC-3' (SEQ IDNO.11)

[0067] 3) Assemble the sgRNA expression cassette (PCR gel recovery product) from step 2) into the pYLCRISPR / Cas9Pubi-H vector.

[0068] (abbreviated as pYLCRISPR / Cas9 vector). The sgRNA expression cassette was ligated to the expression vector using the Golden Gate method, and the system is shown in Table 2 below.

[0069] Table 2 Connection Reaction System

[0070]

[0071]

[0072] The PCR reaction conditions were: 37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min, 20 cycles, 37℃ for 5 min;

[0073] 4) The PCR product was transformed into DH5α Escherichia coli competent cells using the heat shock method. The transformation method was as follows: the gel-recovered product was added to 50 μL of DH5α Escherichia coli competent cells, placed on ice for 30 min, heat-shocked at 42℃ for 45 s, immediately cooled on ice for 2 min, 500 μL of antibiotic-free LB was added, and the cells were placed in a shaker at 37℃ for 180 rpm for 40 min, centrifuged at 5000 rpm for 5 min to collect the bacteria, 400 μL of supernatant was discarded, the bacterial resuspended, and spread on LB solid medium containing 50 mg / L kanamycin using a spreader. The cells were incubated overnight at 37℃. Single colonies were picked and placed in LB liquid medium containing 50 mg / L kanamycin, and incubated in a shaking incubator at 37℃ for 6-8 h. Primers SP-L1: 5'-GCGGTGTCATCTATGTTACTAG-3' (SEQ ID NO.12) and SP-R: 5'-TGCAATAACTTCGTATAGGCT-3' (SEQ ID NO.12) were used. NO.13) Perform bacterial culture PCR identification and select positive clones for sequencing. The positive bacteria were recombinant Escherichia coli DH5α / hdz20-cr containing the recombinant vector hdz20-cr. The correctly sequenced positive clones were cultured in shake flasks, and the plasmid was extracted using a plasmid miniprep kit to obtain the recombinant vector hdz20-cr.

[0074] 2. Construction of the recombinant vector FveHDZ20-OE

[0075] Upstream primer P1 and downstream primer P2 were designed based on the coding region sequence of the FveHDZ20 gene. PCR amplification was performed using the cDNA obtained from reverse transcription as a template, with primers P1 and P2 as the amplification system. The primer sequences and amplification system are as follows:

[0076] Upstream primer P1: 5'-ATGGGTTTGGATGAGCTTGGC-3' (SEQ ID NO.21);

[0077] Downstream primer P2: 5'-TGTAGATGGATGAGTAAAGG-3' (SEQ ID NO.22).

[0078] PCR system (total volume 25 μL): Q5 Buffer 5 μL, dNTP (2.5 mM) 2.5 μL, upstream primer 1.25 μL, downstream primer 1.25 μL, cDNA 2 μL, ddH2O 12.75 μL, Q5 enzyme 0.25 μL.

[0079] The PCR reaction conditions were: 98℃ for 3 min; 98℃ for 10 s, 55℃ for 15 s, 72℃ for 1 min / kb, 33 cycles; 72℃ for 2 min.

[0080] The PCR products were detected and recovered by agarose gel electrophoresis. Using the recovered fragments as templates, a second round of PCR amplification was performed using AttB1 and AttB2 primers. The system was the same as above. The second round of PCR products were detected and recovered by electrophoresis. The primer sequences are as follows:

[0081] Upstream primer AttB1: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGGTTTGGATGAGCTTGG-3' (SEQ ID NO.23);

[0082] Downstream primer AttB2: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGAGCGTAATCTGGAACGTCAT-3' (SEQ ID NO.24).

[0083] After electrophoresis and gel extraction of the PCR products, a backpropagation (BP) reaction was performed: 2.5 μL of the second-round PCR product, 1 μL of pDONR221, 1 μL of TE buffer, and BP Clonase. TM II 0.5μL.

[0084] The reaction was carried out at 25°C for 1 hour in a PCR instrument. Then, 1 μL of Proteinase K was added, and the reaction was terminated by incubating at 37°C for 10 minutes. The reaction product was transformed into competent *E. coli* cells DH5α, plated on LB agar containing Kan-resistant culture medium, and incubated at 37°C. After colonies grew, the colonies were transferred to 1 ml of liquid LB agar containing Kan-resistant culture medium for colony PCR identification. Positive clones were selected for sequencing. The primers used for colony PCR were:

[0085] RT-FveHDZ20-F(P3): 5'-TGACCAACTACTGCCGTCTG-3'(SEQ ID NO.25);

[0086] RT-FveHDZ20-R(P4):5'-AAACGATGAAATGGCTCCGC-3'

[0087] (SEQ ID NO.26).

[0088] The pDONR221-FveHDZ20 vector was successfully obtained. The structure of the pDONR221-FveHDZ20 vector is described as follows: it is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No. 1 between the recognition sequences 5'-AAAAAGCAGGCTGC-3' and 5'-AGAAAGCTGGGTG-3' of the pDONR221 vector, while keeping the other sequences of the pDONR221 vector unchanged.

[0089] The successfully sequenced pDONR221-FveHDZ20 was then expressed using the final expression vector pH7WG2D (see vector diagram). Figure 1 The lower part of the figure shows the LR reaction being performed. The reaction system consisted of: 1 μL of expression vector pH7WG2D, 2.5 μL of pDONR221-FvSPS3, 1 μL of TE buffer, and LR Clonase. TM II 0.5μL.

[0090] The reaction was carried out at 25°C for 1 hour in a PCR instrument. 1 μL of Proteinase K was added, and the reaction was terminated by incubation at 37°C for 10 minutes. The exchange product was transformed into competent E. coli DH5α cells, plated on LB solid medium containing Spe resistance, and cultured at 37°C. After the colonies grew, the colonies were picked and transferred to 1 ml of liquid LB medium containing Spe resistance. The positive colonies were identified by PCR using primers P3 and P4.

[0091] 3. Obtaining transgenic strawberry plants

[0092] 1) Obtaining recombinant Agrobacterium EHA105 / Fvehdz20-cr and recombinant Agrobacterium EHA105 / FveHDZ20-OE

[0093] The recombinant vectors Fvehdz20-cr or FveHDZ20-OE were transformed into Agrobacterium competent cells EHA105 (Shanghai Weidi Biotechnology Co., Ltd.). The transformation method was as follows: 5 μg of plasmid was added to 50 μL of EHA105 Agrobacterium competent medium, gently mixed, and placed on ice for 5 min; the cells were then flash-frozen in liquid nitrogen for 5 min, and incubated in a 37℃ water bath for 5 min; 700 μL of antibiotic-free LB liquid medium was added, and the cells were cultured at 28℃ with shaking at 180 rpm for 4 h; the cells were collected by centrifugation at 5000 rpm for 5 min, the supernatant was discarded, and the remaining 100 μL of the cells was resuspended and plated on plates containing 25 mg / L rifampin and 50 mg / L kanamycin, and cultured at 28℃ for 2 days. Single colonies were picked and shaken, and bacterial culture PCR was performed using SP-L and SP-R primers. The PCR product of the positive clone was 1000 bp in size (i.e., the length of two sgRNA expression cassettes). Recombinant Agrobacterium EHA105 / hdz20-cr, which was successfully transformed into the recombinant vector hdz20-cr with the hdz20 gene knocked out, and recombinant Agrobacterium EHA105 / FveHDZ20-OE, which was successfully transformed into the recombinant vector FveHDZ20-OE with the hdz20 gene overexpression, were obtained.

[0094] 2) Stable genetic transformation of diploid strawberries

[0095] Preparation and activation of the infecting bacterial suspension: Centrifuge the EHA105 / Fvehdz20-cr or EHA105 / FveHDZ20-OE bacterial suspension at 5000 rpm for 10 min under vigorous shaking. Discard the supernatant after centrifugation in a clean bench. Add MS activation solution (solvent is water, solute and its content is: MS 4.4 g / L, sucrose 30 g / L, pH adjusted to 5.8 with 1M NaOH, autoclaved, and acetylsyl syringone added to a final concentration of 100-200 μM before use) to suspend the bacterial cells, so that the OD value of the bacterial suspension is 0.4-0.6, and activate in a shaker at 28℃ for 40 min.

[0096] Healthy and plump di Bosco strawberry seeds were sterilized with 75% anhydrous ethanol and 1% NaCl O, then spotted onto 1 / 2 MS medium. After being kept in the dark for 4-7 days, the seeds were placed in a constant temperature and humidity tissue culture room for cultivation. The photoperiod was 12 / 12h, the temperature was 24℃, and the humidity was 45%. Diploid strawberry tissue culture seedlings were obtained after 40-50 days of cultivation.

[0097] Explant infection (leaf disc method): During the bacterial culture activation period, plant materials were cut as explants. Tissue culture seedlings of the diploid strawberry variety di Bosco (hereinafter referred to as wild strawberry, WT) that have grown for 50-60 days were taken. Tender leaves and petioles were cut into appropriate sizes and placed in MS activation solution. After a certain number of explants were cut, activated bacterial culture solution was added. Then, the solution was placed in a 50ml syringe and vacuumed until the leaves were water-soaked.

[0098] Explant culture: After infection, explants were transferred to co-culture medium (solvent: water; solutes and their concentrations: MS 4.4 g / L, sucrose 30 g / L, agar powder 7 g / L, 6-BA 0.1 mg / L, 2,4-D 0.01 mg / L, TDZ 2 mg / L; pH adjusted to 5.8 with 1M NaOH; autoclaved) and cultured in the dark for 2 days. After dark culture, explants were carefully transferred to selection medium (solvent: water; solutes and their concentrations: MS 4.4 g / L, sucrose 30 g / L, agar powder 7 g / L, 6-BA 0.1 mg / L, 2,4-D 0.01 mg / L, TDZ 2 mg / L; pH adjusted to 5.8 with 1M NaOH; autoclaved; and Hyg 2 mg / L and Temmetine 400 mg / L). After approximately 40 days of culture, shoot clusters emerged.

[0099] Callus rooting: When the callus sprouts, transfer it to rooting medium (solvent is water, solute and its content is MS 4.4g / L, sucrose 30g / L, agar powder 7g / L, 1M NaOH to adjust pH to 5.8, after high temperature and high pressure sterilization, add Hyg 2mg / L and Tim 400mg / L).

[0100] Transplanting of transgenic seedlings: Seedlings with roots that have grown to 4-5 cm and have well-developed fibrous roots are transplanted into the soil. The culture medium is carefully removed from the roots, and the seedlings are covered with plastic wrap to keep them moist. After 15 days, the plastic wrap is removed to obtain transgenic plants containing the recombinant vector FveHDZ20-cr to be identified.

[0101] 4. Identification of the fvehdz20-cr transgenic edited line

[0102] To identify positive fvehdz20-cr transgenic plants, leaves from the transgenic strawberry plants in step 2 were taken, DNA was extracted, and PCR detection was performed using genomic DNA as a template.

[0103] 1) Extract DNA from the transgenic plants to be identified that contain the recombinant vector FveHDZ20-cr, and identify them by PCR.

[0104] The primers are as follows:

[0105] HDZ20-cr-F: 5'-ACACGGTTCGTCACTCCT-3' (SEQ ID NO.14)

[0106] HDZ20-cr-R: 5'-ATCATGGAATGAAACTACACACC-3' (SEQ ID NO.15)

[0107] 2) Send the PCR stock solution for sequencing, and analyze the peaks using Snap Gene software. If the peaks show a double peak 3-4 nt before the PAM sequence, or if the target sequence cannot be found, the sequence may have been edited. The editing method can be determined using the MDSDecode website (http: / / skl.scau.edu.cn / dsdecode / ), which can detect multiple sequence files simultaneously.

[0108] 3) Based on the results of the analysis using the website and software, the following transgenic strawberry lines with different knockout types of FveHDZ20 were obtained: line 1, line 2 and line 3.

[0109] Compared to wild-type WT, the FveHDZ20 gene has undergone the following mutations in both homologous chromosomes:

[0110] The homozygous line with a 91-base deletion between target site 1 and target site 2 (fvehdz20-cr-1#) is 5'-AGAGGGTCTAATTCTTCTTCTCCCAGCGGAGCCATTTCATCGTTTTCTAACTCGTCTAGTTTCAAGAGGGTAGACAGAGATATACCGGGTTCCGGTGAAGAGGTAGAGAGTAAGCGAGGAGCTAT-3', which is a deletion of 183-274 bp in the sequence shown in SEQ ID NO.1.

[0111] The homozygous line with a two-base deletion at target site 1 (fvehdz20-cr-2#) mutated to 5'-TCTAATTCTTCTTCTCCCAGCGG-3'; that is, the sequence shown in SEQ ID NO.1 was deleted from the 182nd to 183rd bp, and an A was inserted after the 272nd bp.

[0112] 5. qRT-PCR identification of FveHDZ20 gene overexpression positive plants

[0113] RNA was extracted from T0 generation transgenic plants (numbered 1, 2, and 3) transformed with the EHA105 / pH7WG2D-FveHDZ20 vector and reversed to cDNA using M-MLV enzyme. The expression level of the FveHDZ20 gene was then identified using semi-quantitative PCR. The internal control gene Actin and the FveHDZ20 qRT-PCR primers (P3 and P4) are as follows:

[0114] Actin-F: 5'-TCAAACGAGCTTTTACCCTT-3';

[0115] Actin-R: 5'-GTCTACTATCCAGCGAAACCAC-3';

[0116] P3: 5'-TGACCAACTACTGCCGTCTG-3';

[0117] P4: 5'-AAACGATGAAATGGCTCCGC-3'.

[0118] Plants with higher FveHDZ20 gene expression levels than WT were identified. Figure 2 The strains numbered L1, L2, and L3 in the B series were used as T0 generation FveHDZ20 gene overexpression positive plants. The T0 generation overexpression plants were self-crossed once, and the expression level of the FveHDZ20 gene in the plants was further identified by qRT-PCR.

[0119] Example 2: Identification of Fvehdz20 gene overexpression and knockout mutant strawberry phenotype

[0120] The plants to be tested were homozygous plants of the diploid strawberry variety di Bosco (Fragaria vesca, cv. di Bosco) (abbreviated as wild-type WT), gene overexpression lines 1, 2, and 3, and gene knockout lines 1 and 3. Figure 2 (A and B). Five plants were planted for each line, and the experiment was set up with three replicates.

[0121] The strawberry plants to be tested were planted in pots with a diameter of 230 mm and a depth of 230 mm in a substrate containing nutrient soil, vermiculite, and peat moss (2:1:1, v / v / v). The growing environment was 25℃ / 18℃ (day / night), relative humidity 60%, photoperiod 16h / 8h (day / night), and light density 450 μmol / m³. -2 s -1 .

[0122] Using WT, FveHDZ20 overexpressing plants (FveHDZ20-OE), and the FveHDZ20 gene-edited mutant (fvehdz20-cr) as experimental materials, relevant phenotypic indicators of the plants were observed and measured. It was found that FveHDZ20 overexpression resulted in increased crown width (…). Figure 2 (C) Plant height ( Figure 2 (D) Number of leaves ( Figure 2 (E), leaf area ( Figure 2The levels of F (in the F) mutant were lower than those of WT, while the Fvehdz20 mutant plants showed no significant difference from WT, indicating that the FveHDZ20 gene mutation did not have an adverse phenotype on the vegetative growth of strawberry plants.

[0123] Example 3 Phenotypic diagrams of WT, FveHDZ20-OE, and fvehdz20-cr under high temperature stress. Tissue culture seedlings of WT, FveHDZ20 overexpressing plants (FveHDZ20-OE) and FveHDZ20 gene-edited mutant (fvehdz20-cr) Figure 3 (A) detached blades ( Figure 3 (B) and seedlings ( Figure 3 Using material C) as the experimental material, high-temperature treatment at 35℃ was conducted. Phenotypic observation results showed that, compared with WT, FveHDZ20-OE tissue-cultured seedlings, detached leaves, and mature seedlings were relatively less tolerant to high temperatures, while fvehdz20-cr tissue-cultured seedlings, detached leaves, and mature seedlings all exhibited stronger heat tolerance. This indicates that the FveHDZ20 gene plays an important role in the high-temperature stress response of strawberry plants, and fvehdz20-cr plants show significantly improved heat tolerance.

[0124] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

Claims

1. An application of the FveHDZ20 protein, characterized in that, The heat tolerance of plants can be improved by reducing or inhibiting the expression of the FveHDZ20 protein in the plants. The amino acid sequence of the FveHDZ20 protein is shown in SEQ ID NO.2, which is encoded by the CDS sequence of the FveHDZ20 gene shown in SEQ ID NO.

1.

2. Primers for detecting the results of FveHDZ20 gene knockout, characterized in that, The sequences of the primers are shown in SEQ ID NO. 14-15.

3. An FveHDZ20 mutant, characterized in that, The CDS sequence of the FveHDZ20 mutant is as follows: (1) As shown in SEQ ID NO.16; or (2) As shown in SEQ ID NO.17; or (3) As shown in SEQ ID NO.

18.

4. A target gene for preparing the FveHDZ20 mutant of claim 3, characterized in that, The sequence of the target gene is as follows: (1) As shown in SEQ ID NO.19; and (2) As shown in SEQ ID NO.20; and (3) As shown in SEQ ID NO.

21.

5. The application of an FveHDZ20 protein in the breeding of heat-resistant strawberry varieties, characterized in that, The application cultivates heat-resistant strawberry varieties by reducing or inhibiting the expression of the FveHDZ20 protein in strawberry plants.

6. A biological agent, characterized in that, The biological agent is: (1) A recombinant vector containing the amino acid sequence described in SEQ ID NO.2 or the nucleotide sequence described in SEQ ID NO.1; (2) Recombinant microorganisms containing the amino acid sequence or the nucleotide sequence described in SEQ ID NO.

1.

7. The application of the biological agent as described in claim 6, characterized in that, The biological agent improves the heat resistance of plants by reducing or inhibiting the expression of FveHDZ20 protein.