Single-tube one-step nucleic acid detection method of pectobacterium brazilianum and kit used by same

Abstract

The invention discloses a single-tube one-step nucleic acid detection method of pectobacterium brazilianum and a kit used by the same. The invention relates to the field of vegetable disease detection, and provides a nucleic acid detection reagent for detecting pectobacterium brazilianum, which comprises a reagent A and a reagent B, the reagent A is a reagent for performing RPA amplification on target nucleic acid of pectobacterium brazilianum; the reagent B is a reagent for carrying out CRISPR / Cas detection on the target nucleic acid; the reagent B contains polyvinyl alcohol. According to the invention, prefabrication and room temperature storage of a reaction system are realized, on-site preparation is not needed, operation is simple, reaction only needs one-step pipetting, aerosol pollution is avoided, cost is low, and detection of pectobacterium brazilianum can be completed without large-scale instruments and equipment and temperature control equipment with relatively high energy consumption. The invention provides an efficient, reliable and economical field detection solution for diagnosing vegetable diseases caused by pectobacterium brazilianum.

Description

Technical Field

[0001] This invention relates to the field of vegetable disease detection, specifically to a single-tube one-step nucleic acid detection method for *Pectinobacter brasiliensis* and the reagent kit used therein. Background Technology

[0002] Brazilian pectinobacterium ( Pectobacterium brasiliense Pectinase is a pathogenic bacterium that seriously harms vegetable crops, causing soft rot in various vegetables and resulting in significant losses to agricultural production. This bacterium primarily works by secreting pectinase, which destroys plant cell walls, leading to water-soaked softening and rotting of affected tissues, accompanied by a foul odor. Initial symptoms manifest as small water-soaked spots on leaves or stems, which rapidly expand into brown or black rotten patches; in severe cases, the entire plant wilts and dies.

[0003] Current disease management faces a dual challenge: on the one hand, long-term reliance on chemical control has led to pathogens developing resistance; on the other hand, existing detection technologies each have their limitations.

[0004] Traditional bacterial detection methods involve isolating and culturing pathogens, then observing the colony morphology under a microscope to form a preliminary identification of the pathogen. Immunological methods are limited by the antibody preparation cycle (several months). While molecular detection is sensitive and specific, it requires specialized equipment (such as PCR instruments) and skilled personnel. Especially for grassroots applications, existing technologies struggle to meet the needs for "on-site, rapid, and convenient" detection.

[0005] In recent years, the combination of CRISPR-Cas systems and isothermal amplification technology has provided new ideas for field detection. However, key bottlenecks still exist in technology integration: 1) Direct mixing of RPA and CRISPR / Cas12a inhibits amplification efficiency; 2) Stepwise operations are prone to aerosol contamination; 3) Existing solutions (such as paraffin isolation and temperature-controlled gels) have stringent operational requirements and must be prepared and used immediately. Although patent applications have attempted to address these issues (such as CN117512215A and CN118834977A), their complex temperature control requirements and immediate preparation characteristics limit their applicability in the field. Summary of the Invention

[0006] The purpose of this invention is to provide a single-tube, one-step nucleic acid detection method for *Pectinobacter brasiliensis* and the kit used therein.

[0007] In a first aspect, the present invention claims protection for a nucleic acid detection reagent for detecting *Pectinobacter brasiliensis*.

[0008] The nucleic acid detection reagent for detecting *Pectinobacter brasiliensis* claimed in this invention comprises (or consists of) reagent A and reagent B; wherein reagent A is a reagent for RPA amplification of the target nucleic acid of *Pectinobacter brasiliensis*; wherein reagent B is a reagent for CRISPR / Cas detection of the target nucleic acid; and wherein reagent B contains polyvinyl alcohol.

[0009] Furthermore, reagent A may contain a recombinase, a single-strand binding protein, a strand displacement DNA polymerase, and an RPA primer pair; the RPA primer pair is used to specifically amplify the target nucleic acid. Even further, reagent A may also contain a reaction buffer and / or magnesium ions (such as magnesium acetate) for RPA amplification.

[0010] Furthermore, reagent B may contain polyvinyl alcohol, Cas12a protein, crRNA, and a fluorescent probe; the crRNA targets the target nucleic acid. Even further, reagent B may also contain a reaction buffer for CRISPR / Cas detection.

[0011] In some embodiments, the RPA primer pair consists of two single-stranded DNA molecules as shown in SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the nucleotide sequence of the crRNA is shown in SEQ ID NO:3.

[0012] In some implementations, the ratio of polyvinyl alcohol, Cas12a protein, crRNA and fluorescent probe in reagent B is 30g:1μmol:1μmol:10μmol.

[0013] In some embodiments, the fluorescent probe is a single-stranded DNA probe labeled with a fluorescent group at one end and a quencher group at the other end. In some embodiments, the fluorescent probe is FAM-TTATT-BHQ1 (FAM fluorescent group, labeled at the 5' end; BHQ1 quencher group, labeled at the 3' end). Accordingly, during detection, a 488 nm laser light source can be used for illumination, and a 510 nm long-pass filter can be used to observe whether the product after the RPA-CRISPR / Cas12a system reaction emits fluorescence to determine whether the sample contains the target nucleic acid. The upstream and downstream primers in the RPA amplification reaction system are characterized by their ability to specifically amplify the target nucleic acid, and this fragment can be recognized by crRNA, thereby activating the cleavage activity of Cas12a, causing the fluorescent reporter probe with both fluorescent and quencher groups to be cleaved and emit fluorescence.

[0014] In some implementation cases, the nucleic acid detection reagent is a pre-prepared reagent (e.g., a ready-to-use reagent). Pre-prepared attribute: The reagent components are prepared, mixed, and their stability optimized in advance (e.g., lyophilized packaging), eliminating the need for on-site preparation by the experimenter (balancing "readiness" and "long shelf life"). Pre-packaged attribute: The pre-prepared reagent is directly loaded into a dedicated container (e.g., a PCR tube), forming a "reagent-carrier" integrated unit.

[0015] In some implementation examples, reagent A exists in the form of lyophilized microspheres, denoted as RPA lyophilized microspheres; reagent B exists in the form of lyophilized microspheres, denoted as CRISPR lyophilized microspheres. Specifically, in some implementation examples, the RPA lyophilized microspheres are obtained by adding 29.4 μL of buffer A, 2.5 μL of buffer B, 2 μL of 10 μM RPA amplification upstream primer, and 2 μL of 10 μM RPA amplification downstream primer to the dry powder reaction tube of the DNA isothermal rapid amplification kit (this kit is from Weifang Anpu Future Biotechnology Co., Ltd., product number: WLB8201KIT), mixing them evenly, and then freeze-drying them (wherein, buffer A and buffer B are products from the above kit). The freeze-drying can be: rapid freezing in liquid nitrogen to form the microspheres, then using (Alpha 1-4 LSC) (The basic) freeze dryer was set to a program of 12 hours of analytical drying followed by 3 hours of sublimation drying. The CRISPR freeze-dried microspheres were prepared by mixing the polyvinyl alcohol, the Cas12a protein, the crRNA, and the fluorescent probe in the following ratio: 0.5 μL of polyvinyl alcohol solution (60 g / L): 0.1 μL of Cas12a protein (10 μM): 0.1 μL of crRNA (10 μM): 0.1 μL of fluorescent probe (100 μM) and then drying at 4 °C for 24 h.

[0016] The pre-prepared reagent or the pre-packaged pre-prepared reagent can be stored at room temperature under dry and light-protected conditions.

[0017] Secondly, the present invention claims protection for a pre-loaded detection tube for nucleic acid detection of Pectinobacter brasiliensis.

[0018] The present invention claims a pre-loaded detection tube for nucleic acid detection of *Pectinobacter brasiliensis*, which contains RPA lyophilized microspheres and CRISPR lyophilized microspheres as described in the first aspect above.

[0019] Thirdly, the present invention claims a kit for nucleic acid detection of *Pectinobacter brasiliensis*.

[0020] The present invention claims a kit for nucleic acid detection of *Pectinobacter brasiliensis*, comprising the nucleic acid detection reagent described in the first aspect above or the pre-loaded detection tube described in the second aspect above.

[0021] Furthermore, the kit may also contain a lysis buffer for lysing *Bacillus brasiliensis* or a nucleic acid extraction buffer for extracting the genome of *Bacillus brasiliensis*.

[0022] Fourthly, this invention claims protection for the application of the nucleic acid detection reagent described in the first aspect, the pre-loaded detection tube described in the second aspect, or the kit described in the third aspect in the nucleic acid detection of *Pectinus brasiliensis*; wherein the nucleic acid detection of *Pectinus brasiliensis* involves RPA amplification and CRISPR / Cas detection of the target nucleic acid of *Pectinus brasiliensis* within a reaction vessel without opening the reaction vessel during the entire reaction process. Furthermore, no external power is required and / or the reaction temperature does not need to be changed during the entire reaction process.

[0023] Fifthly, the present invention claims a method for nucleic acid detection of *Pectinobacter brasiliensis*.

[0024] The method for nucleic acid detection of *Pectinobacter brasiliensis* claimed in this invention may include the following steps: adding a nucleic acid solution from the sample to be tested into the pre-loaded detection tube described in the second aspect above, and carrying out a reaction, without opening the reaction vessel during the entire reaction process; and determining whether the sample to be tested contains *Pectinobacter brasiliensis* based on the fluorescence signal after the reaction. Furthermore, no external power is required and / or the reaction temperature does not need to be changed during the entire reaction process.

[0025] Furthermore, determining whether the sample to be tested contains the target nucleic acid based on the fluorescence signal can specifically be as follows: if the fluorescence signal changes (significantly changes), then the sample to be tested contains or is a candidate for containing the target nucleic acid.

[0026] Furthermore, the reaction conditions are a constant temperature reaction at 37°C for 30-50 minutes.

[0027] In some implementation cases, the amount of nucleic acid from the sample to be tested is 50 μL.

[0028] In some implementation cases, after the reaction is completed, a fluorescent excitation light source is used to irradiate the area, and a filter is worn to observe whether fluorescence is produced.

[0029] In some implementation examples, the polyvinyl alcohol mentioned above is polyvinyl alcohol type 1788.

[0030] This invention involves adding polyvinyl alcohol to a CRISPR / Cas12a detection system to create lyophilized microspheres, which are then packaged together with pre-lyophilized RPA amplification microspheres in the same detection tube. During detection, only the sample lysis buffer or DNA extraction solution needs to be added to the detection tube. Under constant temperature conditions of 37°C, the RPA lyophilized microspheres first dissolve and initiate an isothermal amplification reaction (at this time, the CRISPR lyophilized microspheres absorb water, forming a CRISPR / Cas12a detection system with a high surface viscosity; due to the lack of strong convection within the system, the inhibition of the RPA reaction is weak). After approximately 15 minutes of reaction, the CRISPR lyophilized microspheres fully absorb water and dissolve, and the CRISPR / Cas12a detection system and RPA amplification products are thoroughly mixed, resulting in a specific reaction within the tube. The results can be interpreted via fluorescence signals after the reaction is complete.

[0031] The beneficial effects of this invention are as follows: (1) The present invention realizes the pre-preparation and room temperature storage of the reaction system, without the need for on-site preparation of the reaction system, and the activity is still detectable after 30 days at room temperature.

[0032] (2) The present invention is simple to operate, and the reaction only requires one step of liquid transfer, which simplifies the on-site detection work and reduces the requirements for operators, while avoiding aerosol pollution.

[0033] (3) The present invention has low cost, does not require large instruments and equipment, does not require high-energy temperature control equipment, and only requires a fluorescence excitation light source and a fluorescence observation filter to complete the detection.

[0034] This invention provides an efficient, reliable, and economical on-site detection solution for the diagnosis of vegetable diseases caused by *Braziliana brassicae*. Attached Figure Description

[0035] Figure 1 This is a visualization of the detection results of RPA-CRISPR / Cas12a for *Pectinobacter brasiliensis*. The symbols marked "-" represent negative controls.

[0036] Figure 2 The effect of different amounts of polyvinyl alcohol (PVA) added on the fluorescence intensity of the RPA-CRISPR / Cas12a detection system is shown in the figure. The concentrations shown in the figure represent the PVA concentration in 1 μL of CRISPR detection reagent solution before freeze-drying. Figure 3 The image shows the results of RPA-CRISPR / Cas12a detection of the specificity of *Brazilian pectinobacterium*.

[0037] Figure 4 The result of RPA-CRISPR / Cas12a detection limit for Brazilian pectinobacterium. Figure 5The graph shows the changes in the activity of RPA-CRISPR / Cas12a at different storage times. Detailed Implementation

[0038] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0040] The polyvinyl alcohol (PVA) used in the following examples is polyvinyl alcohol 1788, CAS number 9002-89-5.

[0041] The CRISPR / Cas12a protein used in the following examples is a product of NEB England biolabs, catalog number M0653T.

[0042] The RPA lyophilized microspheres used in the following examples contain recombinase, single-strand binding protein, strand displacement DNA polymerase, MgoAc, and RPA primer pairs. Specifically, one RPA lyophilized microsphere is obtained by adding 29.4 μL of buffer A, 2.5 μL of buffer B, 2 μL of 10 μM RPA amplification upstream primer, and 2 μL of 10 μM RPA amplification downstream primer to a dry powder reaction tube of a DNA isothermal rapid amplification kit (from Weifang Anpu Future Biotechnology Co., Ltd., product number: WLB8201KIT). After thorough mixing, the mixture is freeze-dried (specifically: rapidly frozen in liquid nitrogen, then freeze-dried using an Alpha 1-4LSC basic freeze dryer, with the program set to analytical drying for 12 hours and sublimation drying for 3 hours). Buffer A and buffer B are products from the aforementioned kit.

[0043] The following examples use *Braziliana spp.* (pectinobacterium brasiliensis). Pectobacterium brasiliense ): Recorded in "Rapid Detection and Quantification of Viable Cells of Pectobacterium brasilienseThe article “Using Propidium Monoazide Combined with Real-Time PCR. J. Li, R. Chen, R. Yang, X. Wei, H. Xie, Y. Shi, et al. Microorganisms 2023 Vol. 11 Issue 11 Pages 2808” is available to the public from the applicant and may only be used to repeat the experiments of this invention and may not be used for other purposes.

[0044] Syringomorphic lacrimation disease ( Pseudomonas syringae pv. lachrymans ): This is recorded in the article “Li Huanling, Li Baoju. Dr. Li Baoju’s Diagnosis Notes (53) Symptom Diversity and Integrated Prevention and Control of Bacterial Angular Leaf Spot of Cucumber [J]. China Vegetables, 2012(21):23-25.” It can be obtained from the applicant and is only for repeating the experiments of this invention and may not be used for other purposes.

[0045] Xanthomonas aureae, a pathogenic species of wild rapeseed ( Xanthomonas campestris pv. campestris ): This is recorded in the article "Zhang Yang, Li Jinping, Zhou Huimin, Li Baoju. Dr. Li Baoju's Diagnostic Notes (39) Occurrence Pattern and Control of Bacterial Black Rot in Cruciferous Vegetables. China Vegetables 2011, 17:23-25." The public can obtain it from the applicant and it can only be used to repeat the experiments of this invention and may not be used for other purposes.

[0046] Corynebacterium micranthae subsp. micranthae ( Clavibacter michiganensis subsp. michiganens is ): This is recorded in the article "Li Huanling, Shi Yanxia, ​​Xie Xuewen, Li Baoju. Dr. Li Baoju's Diagnostic Notes (42): Occurrence Pattern and Prevention and Control Techniques of Tomato Ulcer Disease. China Vegetables 2011, 23:24-27." The public can obtain it from the applicant and it can only be used to repeat the experiments of this invention and may not be used for other purposes.

[0047] Rhizoctonia solani ( Rhizoctonia solani The information is recorded in the article "Huang Yishuo, Xie Xuewen, Shi Yanxia, ​​Chai Ali, Li Lei, Li Baoju. Control effect of Bacillus polymyxa ZF197 on stem base rot of Chinese cabbage. Journal of Horticulture: 1-13." It is available to the public from the applicant and may only be used to repeat the experiments of this invention and may not be used for other purposes.

[0048] Phytophthora capsici ( Phytophthora capsiciThe information is recorded in the article “Cheng Yingchao, Kang Huajun, Shi Yanxia, ​​Chai Ali, Zhang Hongjie, Xie Xuewen, Li Baoju. Establishment and application of RT-PCR detection technology for Phytophthora capsici [J]. Journal of Horticulture, 2018, 45(05): 997-1006.” It is available to the public from the applicant and may only be used to repeat the experiments of this invention and may not be used for other purposes.

[0049] Eggplant stalk mold ( Stemphylium solani ): This is recorded in the article "Li Baoju, Zhou Yanfang, Li Jinping, Xie Xuewen. Dr. Li Baoju's Diagnostic Notes (30) Diagnosis and Control of Tomato Stinger Fungus Leaf Spot (Gray Leaf Spot). China Vegetables, 2010(23):24-26." The public can obtain it from the applicant and it can only be used to repeat the experiments of this invention and may not be used for other purposes.

[0050] Botrytis cinerea ( Botrytis cinerea ): This is recorded in the article "Shi Yanxia, ​​Tang Ming, Jin Zhiwen, Xie Xuewen, Chai Ali, Li Baoju. Evaluation of resistance of Botrytis cinerea to different types of fungicides in vegetable crops. China Vegetables, 2016(03):60-65.", which is available to the public from the applicant and may only be used to repeat the experiments of this invention and may not be used for other purposes.

[0051] Fusarium oxysporum ( Fusarium oxysporum The information is recorded in the article “Shi Yanxia, ​​Zhang Xiaohui, Xu Yufang, Xie Xuewen, Chai Ali, Li Baoju. Induction of resistance to Fusarium wilt in cucumber by pyrazolopyrimidine derivative BDO-1 [J]. Journal of Horticulture, 2019, 46(05):877-890.” It is available to the public from the applicant and may only be used to repeat the experiments of this invention and may not be used for other purposes.

[0052] Example 1: RPA-CRISPR detection of *Brazilian pectinobacterium* The RPA primer pair used in this invention for detecting *Pectinobacter brasiliensis* is as follows: Upstream primer: GCAGTGGTTGCGTGAACGGTGGTCATCAGTG (SEQ ID NO:1); Downstream primer: CGTTCTGACTGGTCCATCTAAAGATGATACC (SEQ ID NO:2).

[0053] The nucleotide sequence of crRNA is as follows: UAAUUUCUACUAAGUGUAGAUCUGACCAGCGUAAGUUUUGU (SEQ ID NO:3).

[0054] Fluorescent probe: FAM-TTATT-BHQ1 (FAM is the fluorescent group, labeled at the 5' end; BHQ1 is the quenching group, labeled at the 3' end).

[0055] I. Preparation of pre-loaded detection tubes for nucleic acid detection of Pectinobacter brasiliensis 1. Preparation of CRISPR lyophilized microspheres 0.1 μL of a 10 μM CRISPR / Cas12a protein solution, 0.1 μL of a 10 μM crRNA solution (see above), 0.1 μL of a 100 μM fluorescent probe solution (see above) (all solvents are DEPC water), 0.5 μL of a 6% (60 g / L) polyvinyl alcohol (PVA) solution (solvent is water), and 0.2 μL of distilled water, for a total of 1 μL (i.e., the final concentration of PVA is 3%, i.e. 30 g / L), were mixed and coated onto the bottom of a 200 μL reaction tube. The tube was then dried using a drying box (a sealed box filled with desiccant, dried at 4°C for 24 hours) to obtain CRISPR lyophilized microspheres.

[0056] 2. Preparation of pre-loaded detection tubes Add an RPA lyophilized microsphere (RPA amplification primers have been added) to the tube containing the CRISPR lyophilized microspheres prepared in step 1, and cap the tube to obtain a pre-loaded detection tube for nucleic acid detection of Pectinobacter brasiliensis.

[0057] II. Single-tube RPA-CRISPR detection of *Pectinobacter brasiliensis* Bacillus brasiliensis was cultured in LB liquid medium. When the medium became turbid, 20 μL of bacterial cells were placed in a 1.5 mL centrifuge tube containing lysis buffer (AMP Future product, catalog number: WLR8203-ES-S). After shaking, the tube was gently centrifuged and the supernatant was collected to obtain the lysate containing genomic DNA.

[0058] Add 50 μL of the lysis product to the pre-packed detection tube prepared in step one, incubate at 37°C for 30 min, and then observe the detection results using a 488 nm laser light source and a 510 nm long-pass filter. The presence of a clear fluorescence signal indicates a positive result for the sample, meaning it contains *Pectinobacter brasiliensis*; the absence of a clear fluorescence signal indicates a negative result for the sample, meaning it does not contain *Pectinobacter brasiliensis*.

[0059] At the same time, 50 μL of sterile water was set up to replace the genomic DNA in the sample as a negative control.

[0060] like Figure 1 As shown, the RPA primers and crRNA designed above using this method can specifically recognize *Pectinobacter brasiliensis*.

[0061] Example 2: Effect of different concentrations of polyvinyl alcohol on fluorescence signal intensity Brazilian pectinobacterium was cultured in LB liquid medium. When the medium became turbid, 20 μL of bacterial cells were taken and placed in a 1.5 mL centrifuge tube containing lysis buffer (AMP Future product number: WLR8203-ES-S). After shaking, the tube was gently centrifuged and the supernatant was collected to obtain the lysis product containing genomic DNA.

[0062] (1) Adding protective agent: a total of 7 groups, the pre-loaded detection tubes were prepared according to Example 1, the only difference being that the concentration of 0.5 μL polyvinyl alcohol (PVA) solution (solvent is DEPC water) was set to 16%, 12%, 10%, 8%, 6%, 4%, 2% (% means g / 100mL, taking 16% as an example, it means that the concentration of PVA in 0.5 μL polyvinyl alcohol solution is 160 g / L), that is, the concentration of PVA in 1 μL CRISPR detection reagent solution of the 7 groups before freeze drying is 8%, 6%, 5%, 4%, 3%, 2%, 1% (% means g / 100mL, taking 8% as an example, it means that the concentration of PVA in 1 μL CRISPR detection reagent solution is 80 g / L).

[0063] (2) No protective agent control: 1 group, the corresponding pre-loaded detection tubes were prepared according to Example 1, the only difference being that the 0.5 μL polyvinyl alcohol (PVA) solution was replaced with an equal volume of distilled water.

[0064] Add 50 μL of the prepared *Brazilian pectinobacterium* lysis product to each of the above 8 pre-loaded detection tubes, react at 37°C for 50 min using an ELISA reader, and collect fluorescence signals every 1 min.

[0065] Meanwhile, a traditional RPA-CRIPSR / Cas12a stepwise detection of the prepared *Pectinobacter brasiliensis* lysate was set up as a positive control. The specific operation was as follows: First, the RPA reaction was performed at 37°C for 20 minutes. The reaction system was as follows: 29.4 μL of Buffer A, 2 μL each of forward and reverse primers (concentration of 10 μM), 2 μL of lysate, 11.2 μL of DEPC H2O, and 2.5 μL of Buffer B were added to a dry powder reaction tube (wherein, the dry powder reaction tube, Buffer A, and Buffer B are all products of the kit, which is from Weifang Anpu Future Biotechnology Co., Ltd., product number: WLB8201KIT). After the RPA reaction, 12.5 μL of the RPA reaction solution was transferred to the CRISPR / Cas12a detection system for detection. The system was incubated at 37°C for 20 minutes. The CRISPR detection system consisted of: 1 μL of Cas12a (1 μM), 1 μL of crRNA (1 μM), 4.5 μL of DEPC H2O, 1 μL of fluorescent probe (10 μM), and 12.5 μL of RPA amplification product.

[0066] likeFigure 2 As shown, with the addition of an appropriate concentration of polyvinyl alcohol as a protective agent, the RPA reagent and CRISPR reagent can react in a single tube. The fluorescence signal at a concentration of 3% (the concentration of PVA in 1 μL of CRISPR detection reagent solution before freeze-drying) is closest to that of the positive control, and the amplification curve is good. The control group without protective agent showed no obvious fluorescence signal after the reaction.

[0067] Example 3: Specificity verification of single-tube RPA-CRISPR detection of *Pectinobacter brasiliensis* Using Brazilian pectinobacterium ( Pectobacterium brasiliense ), lilac pseudomonas lacrimal lesion ( Pseudomonas syringae pv. lachrymans ), Xanthomonas aurea, a pathogenic species of wild rapeseed ( Xanthomonas campestris pv. campestris ), Corynebacterium micranthae subsp. micranthae ( Clavibacter michiganensis subsp. michiganensis Rhizoctonia solani ( )), Rhizoctonia solani ( Rhizoctonia solani ), Phytophthora capsici ( Phytophthora capsici ), eggplant stalk mold ( Stemphylium solani ), Botrytis cinerea ( Botrytis cinerea Fusarium oxysporum ( Fusarium oxysporum Genomic DNA of *Pectinobacter brasiliensis* was used as the test sample. 50 μL of the sample genomic DNA was added to a pre-loaded detection tube prepared in Example 2 for nucleic acid detection of *Pectinobacter brasiliensis* (the concentration of PVA in 1 μL of CRISPR reagent solution before freeze-drying was 3%, % represents g / 100 mL). The tube was incubated at 37°C for 30 min. After the reaction, the detection results were observed using a blue laser light source and a filter. Simultaneously, 50 μL of sterile water was used as a negative control (i.e., a template-free control) to replace the sample genomic DNA.

[0068] like Figure 3 As shown, *Pseudomonas brasiliensis* exhibited green fluorescence after the reaction, while *Pseudomonas syringae*, *Xanthomonas spp.*, *Corynebacterium miltanense* subsp. *miltanense*, *Rhizoctonia solani*, *Phytophthora capsici*, *Stemona solani*, *Botrytis cinerea*, *Fusarium oxysporum*, and the negative control all showed no fluorescence. This indicates that the method for detecting *Pseudomonas brasiliensis* in this invention has high specificity.

[0069] Example 4: Sensitivity verification of single-tube RPA-CRISPR detection of *Pectinobacter brasiliensis* *Pectinus brasiliensis* was cultured in LB liquid medium. After the medium became turbid, bacterial cells were collected from the liquid medium, and genomic DNA of *Pectinus brasiliensis* was extracted. The DNA concentration was determined using a nanodrop 2000 and then serially diluted to prepare test samples containing different concentrations of *Pectinus brasiliensis* DNA (1 to 1 × 10⁻⁶). -6 (ng / μL).

[0070] Add 50 μL of test samples containing different concentrations of *Pectinus brasiliensis* DNA to the pre-loaded test tubes prepared in Example 2 for nucleic acid detection of *Pectinus brasiliensis* (the concentration of PVA in 1 μL of CRISPR test reagent solution before freeze-drying was 3%, % represents g / 100 mL). Incubate at 37°C for 30 min. After the reaction, observe the detection results using a blue laser light source and a filter. Simultaneously, set up 50 μL of sterile water to replace the sample genomic DNA as a negative control (i.e., a template-free control).

[0071] like Figure 4 As shown, 1 to 1×10 -5 Fluorescence was observed at DNA concentrations of ng / μL and 1×10⁻⁶. -6 No fluorescence signal was generated in ng / μL and the negative control. This method can detect 1×10 -5 ng / μL of *Pectinobacter brasiliensis* DNA. This indicates that the method for detecting *Pectinobacter brasiliensis* in this invention has high sensitivity.

[0072] Example 5: Changes in the activity of single-tube RPA-CRISPR after 30 days of storage Brazilian pectinobacterium was cultured in LB liquid medium. When the medium became turbid, 20 μL of bacterial cells were taken and placed in a 1.5 mL centrifuge tube containing lysis buffer (AMP Future product number: WLR8203-ES-S). After shaking, the tube was gently centrifuged and the supernatant was collected to obtain the lysis product containing genomic DNA.

[0073] 50 μL of the above lysis product was added to the pre-loaded detection tubes for nucleic acid detection of Pectinobacter brasiliensis prepared in Example 2 (the concentration of PVA in 1 μL of CRISPR detection reagent solution was 3% before freeze-drying, % means g / 100mL) that had been stored at room temperature for different times (1, 3, 7, 15, 30 days). The tubes were then reacted at 37°C for 40 min using an ELISA reader, and the fluorescence signal was collected every 1 min.

[0074] like Figure 5 As shown, the reagent remained active after 30 days of storage. This result indicates that the pre-loaded detection tube of the present invention can be stored at room temperature for more than 30 days.

[0075] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A nucleic acid detection reagent for detecting *Pectinobacter brasiliensis*, characterized in that: The nucleic acid detection reagent includes reagent A and reagent B; reagent A is a reagent for RPA amplification of the target nucleic acid of *Pectinobacter brasiliensis*; reagent B is a reagent for CRISPR / Cas detection of the target nucleic acid; reagent B contains polyvinyl alcohol.

2. The nucleic acid detection reagent according to claim 1, characterized in that: Reagent A contains a recombinase, a single-strand binding protein, a strand displacement DNA polymerase, and an RPA primer pair; the RPA primer pair is used to specifically amplify the target nucleic acid; and / or Reagent B contains polyvinyl alcohol, Cas12a protein, crRNA, and a fluorescent probe; the crRNA targets the target nucleic acid.

3. The nucleic acid detection reagent according to claim 2, characterized in that: The RPA primer pair consists of two single-stranded DNA molecules shown in SEQ ID NO:1 and SEQ ID NO:2; and / or The nucleotide sequence of the crRNA is shown in SEQ ID NO:

3.

4. The nucleic acid detection reagent according to claim 2 or 3, characterized in that: In reagent B, the ratio of polyvinyl alcohol, Cas12a protein, crRNA and fluorescent probe is 30g:1μmol:1μmol:10μmol.

5. The nucleic acid detection reagent according to any one of claims 1-4, characterized in that: The reagent A exists in the form of lyophilized microspheres, denoted as RPA lyophilized microspheres; and / or, the reagent B exists in the form of lyophilized microspheres, denoted as CRISPR lyophilized microspheres.

6. A pre-loaded detection tube for nucleic acid detection of *Pectinobacter brasiliensis*, characterized in that: The pre-loaded detection tube is encapsulated with the RPA freeze-dried microspheres and the CRISPR freeze-dried microspheres as described in claim 5.

7. A kit for nucleic acid detection of *Pectinobacter brasiliensis*, comprising the nucleic acid detection reagent of any one of claims 1-5 or the pre-loaded detection tube of claim 6.

8. The reagent kit according to claim 7, characterized in that: The kit also contains a lysis buffer for lysing *Bacillus brasiliensis* or a nucleic acid extraction buffer for extracting the genome of *Bacillus brasiliensis*.

9. The application of the nucleic acid detection reagent according to any one of claims 1-5, the pre-loaded detection tube according to claim 6, or the kit according to claim 7 or 8 in the nucleic acid detection of *Pectinobacter brasiliensis*; wherein the nucleic acid detection of *Pectinobacter brasiliensis* involves RPA amplification and CRISPR / Cas detection of the target nucleic acid of *Pectinobacter brasiliensis* in a reaction vessel without opening the reaction vessel during the entire reaction process.

10. A method for nucleic acid detection of *Pectinobacter brasiliensis*, comprising the following steps: adding a nucleic acid solution from the sample to be tested into the pre-loaded detection tube of claim 6, reacting, without opening the reaction container during the entire reaction process, and determining whether the sample to be tested contains *Pectinobacter brasiliensis* based on the fluorescence signal after the reaction.

Images