A specific target of Dickeya solani, its development method and application
By using the PGCGAP platform to discover specific target sites, design specific primers and primer pairs, and combine isothermal amplification and lateral flow test strips, the problems of false positives and complex equipment in the detection of Dickeya solani were solved, achieving rapid and sensitive detection results.
Patent Information
- Application Number
- CN202511027267.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-24
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-07-24
AI Technical Summary
Existing methods for detecting Dickeya solani have high false positive rates, complex and expensive equipment, and cannot meet the rapid detection needs of port sites and primary screening laboratories. Furthermore, they lack a large amount of sample validation data to support their detection.
By calling the annotation and pangenomics modules through the PGCGAP platform, specific target sites are identified, specific primers and primer pairs are designed, and rapid detection is achieved by combining isothermal amplification and lateral flow test strips.
It enables rapid and specific detection of Dickeya solani, with high sensitivity, simple operation, meeting the detection rate requirements for low-copy templates, and fast detection speed.
Smart Images

Figure CN120888565B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to Dickeya This pertains to bacterial testing, specifically, it involves a type of... Dickeya solani Specific targets of bacteria, development methods and applications. Background Technology
[0002] Potato black shank fungus ( D. solani *Polygonum aviculare* is a newly discovered pathogen that can be transmitted through seed potatoes and fresh tubers, posing a serious threat to the potato industry in Europe recently. Van der Wolf et al. used multi-marker sequence analysis, fatty acid composition determination, and DNA-DNA hybridization, among other experimental methods, to ultimately identify it as... Dickeya solani Besides causing spoilage and losses to food crops such as potatoes, D. solani It can also cause wilting or tissue rot in many horticultural crops, including hyacinths, and has a devastating impact on flowering and ornamental plants.
[0003] van der Wolf designed a targeting based on the fliC sequence. D. solani Specific primers and MGB probes. Based on existing information from NCBI. Dickeya Sequence alignment of the genus revealed a sequence in GenBank. D. zeae strain LMG2497 (JN617650), designed by Van Vaerenbergh D. solani Specific primers and MGB probe sequences are located at the same position as D. solani The sequences are highly similar, with only a 1bp difference in the primers; the probes are completely identical. (This is due to the presence of NCBI...) Dickeya The number of sequences in this genus is not large, therefore Van Vaerenbergh designed a method based on the fliC sequence targeting... D. solani Specific primers and MGB probes may produce false positives in practical applications. This method also requires complex and expensive equipment and reagents, which cannot meet the testing needs of port sites and primary screening laboratories.
[0004] Aleksandr et al., based on sequences of standard strains from the NCBI genome database, screened for specific target sites in the recA gene, IGS, SOL-A region (FlgH gene fragment), and SOL-C region. Using a combination of recombinase polymerase amplification (RPA) technology and lateral flow detection (LFD), they established FAM-labeled IGS-sol-RPA and biotin-labeled SOL-C assays, enabling rapid, specific, and sensitive detection. D. solani However, this method only selects specific detection methods. DickeyaOne standard strain for each closely related species in the genus was tested and validated, but there is a lack of validation data from a large number of samples, which needs to be validated in port testing practice.
[0005] An ERIC-PCR method was developed based on ERIC sequences in bacterial genomes for the identification of... D. solani A specific fingerprint pattern was obtained. A PCR detection method was established by mining a unique, inverted repeat target site sequence of the ugpC-1 gene. However, the primers DSF1 / DSR2 used in this method lacked specificity. D. diffenbachia and D. paradisiaca All strains can be amplified. To reduce non-specific amplification of other strains, the annealing temperature needs to be increased to 68℃. In actual testing, this method is prone to false positive results. Currently, the commonly used method is to perform initial screening using primers ADE1 / ADE2 designed against pectin lyase PEL, followed by determination of recA or dnaX sequences. D. solani The identification process is time-consuming and complicated. Summary of the Invention
[0006] In response to the above Dickeya solani This invention addresses the challenge of detecting bacteria. Dickeya solani The study explores specific targets, development methods, and applications for bacteria, utilizing platforms such as PGCGAP to call annotation and pan-genomics modules to discover specific target sites and overcome challenges such as false positives.
[0007] To achieve the above objectives, the present invention provides, in one aspect, a... Dickeya solani A specific target of bacteria, which has a DNA sequence as shown in SEQ ID No. 1.
[0008] SEQ ID No. 1:
[0009] .
[0010] A second aspect of the present invention provides a method for developing the above-mentioned specific target, comprising the following steps:
[0011] S1. Call the pgcgap annotation module to... Dickeya The bacterial genome is annotated as fragments of varying lengths;
[0012] S2. Input the annotated file into the pgcgap pangenomics module to obtain individual gene names;
[0013] S3. Obtain the sequence corresponding to the gene based on its name;
[0014] S4. The obtained sequences are subjected to BLAST locally and compared with closely related species to find unique sequences;
[0015] S5. Unique sequences are compared online in the NCBI and nt databases using BLAST to determine uniqueness and select highly specific sequences, i.e., targets.
[0016] Specifically, in step S1, the Dickeya Bacteria include strains Dickeya dadantii pv dieffenbachiae , Dickeya dianthoicola , Dickeya chrysanthemi pv. Chrysanthemi , Dickeya paradisiaca , Dickeya acquatica , Dickeya solani , Dickeya zeae and Dickeya dadanti pv dadantii .
[0017] The third aspect of the present invention provides the above-mentioned specific target for detection Dickeya solani Applications in bacteria.
[0018] A fourth aspect of the present invention provides primers for detecting the above-mentioned specific targets, comprising a first primer pair as shown in SEQ ID No. 2 and SEQ ID No. 3, or a second primer pair as shown in SEQ ID No. 4 and SEQ ID No. 5, or a third primer pair as shown in SEQ ID No. 6 and SEQ ID No. 7.
[0019] Solani-F1 (SEQ ID No. 2):
[0020] GAAATTAATACGACTCACTATAGGGCCGTCAATATGTTTCTCCTATGTTTATGCC;
[0021] Solani-R1 (SEQ ID No. 3):
[0022] GTAGGCAGCATTGTTTTCATATATCTCGAC;
[0023] Solani-F2 (SEQ ID No. 4):
[0024] GAAATTAATACGACTCACTATAGGGCAACCTGACCGCGTCCATTAATTCAGAAGCG;
[0025] Solani-R2 (SEQ ID No. 5):
[0026] CTGGTGAAATTCACTATTGTATTCCGCTTTGACGG;
[0027] Solani-F3 (SEQ ID No. 6):
[0028] GAAATTAATACGACTCACTATAGGGCTGACGATAATGCCTATAAAGCACATATTGC;
[0029] Solani-R3 (SEQ ID No. 7):
[0030] CCGTTGCCGCATACATTGCCAGCGCACCGT.
[0031] The fifth aspect of the present invention provides the above-described primers for detection Dickeya solani Applications in bacteria.
[0032] The sixth aspect of the present invention provides a detection Dickeya solani A kit for bacteria, which includes the primers mentioned above.
[0033] The seventh aspect of the present invention provides the above-described reagent kit for detecting... Dickeya solani Applications in bacteria.
[0034] The eighth aspect of the present invention provides Dickeya solani A rapid detection method for bacteria includes the following steps:
[0035] (1) Extract DNA from the test sample;
[0036] (2) Using DNA as a template, perform isothermal amplification using the detection primers or kits described above;
[0037] (3) Detection of isothermal amplification products using chromatographic test strips: When two bands appear on the test strip, one in the control zone and one in the detection zone, the result is positive, indicating that the sample contains [the product name is missing]. Dickeya solani If only one band appears in the control area of the test strip, and no band appears in the test area, the result is negative, indicating that the sample does not contain bacteria. Dickeya solani bacteria.
[0038] Through the above technical solution, the present invention achieves the following beneficial effects:
[0039] 1. This invention is based on comparative genomics, utilizing the PGCGAP platform to call annotation and pan-genomics modules to mine specific target sites, overcoming... Dickeya The limitation that 16S and other common sequences of similar species are difficult to distinguish, establish D. solani Establishment of specific detection methods D. chrysanthemiReal-time fluorescence PCR and RPA-LFD multidimensional, visual detection system and D. solani The detection method can detect as few as 100 copies, improving amplification efficiency to achieve higher detection rates and meet the requirements for detecting low-copy templates. Furthermore, because the detection system utilizes the specificity of gene-editing probes, the detection exhibits high specificity.
[0040] 2. This invention is capable of... D. solani This method enables rapid detection of bacteria by using isothermal amplification combined with transverse flow test strips. It does not require complex temperature control and has many technical advantages such as simple operation, high sensitivity, strong specificity, and fast detection speed. Attached Figure Description
[0041] Figure 1 This is a primer-specific qPCR detection amplification curve;
[0042] Figure 2 The effectiveness of the three primer pairs in amplifying the target bacterial species was verified by the RPA+cas13a+LFD test strip.
[0043] Figure 3 The primer-specific RPA+cas13a+LFD was used to verify the test strip results;
[0044] Figure 4 This is the primer sensitivity qPCR detection amplification curve;
[0045] Figure 5 The primer sensitivity RPA+cas13a+LFD was used to verify the test strip results. Detailed Implementation
[0046] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0047] Example 1 D. solani Development of bacteria-specific primers
[0048] The development process is as follows:
[0049] S1. Call the pgcgap annotation module to... Dickeya dadantii pv dieffenbachiae , Dickeya dianthoicola , Dickeya chrysanthemi pv . chrysanthemi , Dickeya paradisiaca , Dickeya acquatica , Dickeya solani , Dickeya zeae and Dickeya dadantii subsp. dadantii, D. dadantii .subsp.dieffenbachiae The genomes of these strains were annotated as fragments of different lengths;
[0050] S2. Input the annotated GFF file into the pgcgap pan-genomics workflow (panarro) to obtain individual gene names;
[0051] S3. Obtain the sequence corresponding to the gene based on its name;
[0052] S4. The obtained sequences are subjected to BLAST locally and compared with closely related species to find unique sequences;
[0053] S5. Unique sequences are compared online in the NCBI and nt databases using BLAST to determine uniqueness and select sequences with high specificity.
[0054] S6. For the obtained highly specific sequences, i.e. targets, design specific detection primers.
[0055] Dickeya solani The primer pairs for the bacteria are shown in Table 1:
[0056] Table 1
[0057]
[0058] Example 2 Dickeya solani Detection of bacteria
[0059] (1) Probe preparation
[0060] The coding DNA sequence for the crRNA probe is designed as follows:
[0061]
[0062] The coding DNA probe was transcribed into a guide RNA probe (crRNA): 5 μL of each coding DNA probe was mixed and annealed at 95 °C for 5 min. The annealed DNA probe was then added to the transcription reaction system and mixed well; the reaction tube was incubated at 37 °C for 16 h. After the reaction, the reaction product was purified using magnetic beads or a column to obtain crRNA. The resulting product was then aliquoted and used for detection.
[0063] The transcription reaction system is as follows:
[0064]
[0065] Add 5 μL of the sample to be tested and 15.5 μL of nuclease-free water to the isothermal amplification reaction system and mix well. Place the reaction plate at 39℃ for 15 min. After the reaction is completed, the isothermal amplification reaction product of the sample to be tested is obtained.
[0066]
[0067] (3) Target detection
[0068] Take 1 μL of the isothermal amplification product for detection, wherein the detection reaction system is as follows:
[0069]
[0070] The non-specific reporter molecule is as follows: / 56-FAM / mArArUrGrGrCmAmArArUrGrGrCmA / 3Bio / .
[0071] After the reaction is complete, add 20 μL of test strip detection chromatography solution to the product, mix and centrifuge, then insert the sample-carrying area of the transversely flowing test strip into the detection solution. After 2-5 minutes, the difference in brightness of the detection line can be directly observed and interpreted with the naked eye.
[0072] (4) Specificity test
[0073] Mining through bioinformatics methods Dickeya solani The specific target sequence was determined, and RPA primers were designed for the specific target sequence (as shown in Table 1). A T7 promoter sequence was added to the 5' end of the upstream primer, resulting in three pairs of primers. These primers are also suitable for qPCR reactions.
[0074] (4.1) qPCR verification
[0075] The qPCR reaction system is as follows:
[0076]
[0077] qPCR reaction program: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; add the instrument's built-in melting curve program.
[0078] For ease of explanation, Dickeya The strains to be tested are numbered, with D1-D8 corresponding to the following species names:
[0079]
[0080] The results are shown in the table below. Figure 1 As shown:
[0081]
[0082] As can be seen from the figure and table, the three primer pairs corresponding to sample D6, Solani-F1&R1, Solani-F2&R2 and Solani-F3&R3, can all specifically amplify sample D6.
[0083] (4.2) RPA+cas13a+LFD Validation
[0084] S1: Remove F buffer from the kit, vortex to mix, and let stand for later use;
[0085] S2: Take out the selected crRNA (10 µM), upstream primer F (10 µM), downstream primer R (10 µM), and ssRNAReporter (100 µM), vortex to mix, and let stand for later use;
[0086] S3: Prepare crRNA, upstream primer F, downstream primer R, and ssRNAReporter according to the actual number of tests (n+1);
[0087] S3: Add 4.1 μL of crRNA, primers, ssRNA Reporter to the reaction unit tube containing the dry powder, then add 5 μL~5.9 μL of the sample to be tested and ddH2O to the reaction unit tube, and add 10 μL of FBuffer to the cap of the reaction unit tube;
[0088] S4: Cover the tube, centrifuge at low speed for 8 seconds, invert and mix thoroughly 10 times (or press and shake to mix for 10 seconds), then centrifuge at low speed for 8 seconds, and test on the machine.
[0089] S5: Place the reaction unit tube in a constant temperature metal bath (or constant temperature water bath, constant temperature incubator), set the temperature to 42℃, and the reaction time to 20 min;
[0090] S6: After the reaction is complete, test the amplification results according to the operating steps in the instructions for the CAS system's dedicated nucleic acid test strip.
[0091] The results are as follows Figure 2 and Figure 3 As shown in the figure, it can be seen that the three primer pairs Solani-F1&R1, Solani-F2&R2 and Solani-F3&R3 can all specifically amplify the D6 sample.
[0092] (5) Sensitivity test
[0093] The samples were diluted to 1 ng / μL, and then further diluted in 1 / 10 gradients to 10^-7 ng / μL. The samples at each gradient were first amplified using qPCR to obtain the corresponding Ct values for subsequent comprehensive comparison. After the qPCR test, the sensitivity of the test strip was tested using RPA+Cas13+LFD visualization.
[0094] The template concentrations (copies / μL) used in isothermal amplification are shown in the table below:
[0095]
[0096] (5.1) qPCR sensitivity test
[0097] The reaction system and procedure are the same as in (4.1), and the sample is replaced with the gradient template DNA described above.
[0098] The results are as follows Figure 4 As shown in the figure, the detection limit of qPCR can be as low as 100 copies / μL.
[0099] (5.2) Sensitivity test of RPA+cas13a+LFD
[0100] 5 μL of templates at different concentrations were used for isothermal amplification, followed by 1 μL of the isothermal amplification product for targeted detection. The results of the test strip detection are as follows: Figure 5 The results show that when the template concentration is higher than 100 copies / μL, the present invention can effectively detect the virus.
[0101] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0102] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.
[0103] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.
Claims
1. A kind Dickeya solani A method for developing specific targets of bacteria, characterized in that, Should Dickeya solani The bacterial specific target has a DNA sequence as shown in SEQ ID No. 1, and its development method includes the following steps: S1. Call the pgcgap annotation module to... Dickeya The bacterial genome is annotated as fragments of varying lengths; S2. Input the annotated file into the pgcgap pangenomics module to obtain individual gene names; S3. Obtain the sequence corresponding to the gene based on its name; S4. The obtained sequences are subjected to BLAST locally and compared with closely related species to find unique sequences; S5. Unique sequences are compared online in the NCBI and nt databases using BLAST to determine uniqueness and select highly specific sequences, i.e., targets.
2. The development method according to claim 1, characterized in that, In step S1, the Dickeya Bacteria include strains Dickeya dadantii py dieffenbachiae , Dickeya dianthoicola , Dickeya chrysanthemi pv. Chrysanthemi , Dickeya paradisiaca , Dickeya acquatica , Dickeya solani , Dickeya zeae and Dickeya dadanti py dadantii .
3. A specific target in detection Dickeya solani Its application in bacteria is characterized by, It has a DNA sequence as shown in SEQ ID No.
1.
4. The application according to claim 3, characterized in that, The detection primers for the target include a first primer pair as shown in SEQ ID No. 2 and SEQ ID No. 3, or a second primer pair as shown in SEQ ID No. 4 and SEQ ID No. 5, or a third primer pair as shown in SEQ ID No. 6 and SEQ ID No.
7.
5. The primers described in claim 4 for detecting... Dickeya solani Applications in bacteria.
6. A kit comprising the primers of claim 4 for detecting... Dickeya solani Applications in bacteria.
7. A kind Dickeya solani A rapid detection method for bacteria, characterized in that, Includes the following steps: (1) Extract DNA from the test sample; (2) Using DNA as a template, perform isothermal amplification using the detection primers described in claim 4 or the kit described in claim 6; (3) Detection of isothermal amplification products using chromatographic test strips: When two bands appear on the test strip, one in the control zone and one in the detection zone, the result is positive, indicating that the sample contains [the product name is missing]. Dickeya solani If only one band appears in the control area of the test strip, and no band appears in the test area, the result is negative, indicating that the sample does not contain bacteria. Dickeya solani bacteria.