InDel molecular marker closely associated with salt tolerance of barley and application of InDel molecular marker
By developing InDel molecular markers and primers closely related to barley salt tolerance, and utilizing PCR amplification and agarose gel electrophoresis, the problem of identifying barley salt tolerance was solved, thus accelerating the breeding process with high efficiency and low cost.
Patent Information
- Application Number
- CN202510830763.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-11-04
AI Technical Summary
Existing technologies make it difficult to quickly, accurately, and easily identify barley salt tolerance, resulting in slow progress in barley salt tolerance breeding, a lack of efficient screening markers, and high costs.
We developed InDel molecular markers closely associated with barley salt tolerance and designed amplification primer pairs (InDel-P1 upstream primer: 5′-CATCGAAGACGTGGATGCATG-3′, downstream primer: 5′-GGAAGCTGTAGTAACTGTAGCC-3′). We then used PCR amplification and agarose gel electrophoresis to distinguish between salt-tolerant and salt-sensitive varieties.
It enables rapid, accurate, and low-cost screening and identification of barley salt tolerance, improving breeding efficiency and simplifying the testing process.
Smart Images
Figure CN120888684A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of crop molecular marker assisted breeding, and particularly relates to an InDel molecular marker closely related to barley salt tolerance and application thereof. BACKGROUND
[0002] Soil salinization is a serious problem affecting agricultural production and ecological environment. The most effective way to utilize saline-alkali land is to breed and promote salt-tolerant varieties. Developing salt-tolerant major gene closely linked molecules combined with molecular marker assisted selection technology can improve the accuracy and efficiency of salt tolerance selection and accelerate the transfer and breeding utilization of salt-tolerant genes.
[0003] Barley is a strong salt-tolerant cereal crop and is one of the pioneer crops for the development and utilization of saline-alkali beach. Plant salt tolerance is a complex quantitative trait controlled by multiple genes, which is easily affected by genetic background and environmental factors, and is difficult to accurately identify. At present, only an excellent natural variation has been found in barley HvHKT1;5. Due to the lack of excellent salt-tolerant germplasm and efficient screening markers, the progress of barley salt-tolerant breeding is slow. Therefore, developing barley salt-tolerance linkage molecular markers suitable for high-throughput requirements is an urgent need for barley salt-tolerance molecular marker assisted selection.
[0004] Exploring natural variations of salt-tolerance key genes and designing associated molecular markers can be used for assisting barley salt-tolerance molecular breeding. However, SNP difference sites can only be genotyped by designing CAPs or KAPS markers, which is complicated and costly. However, if an InDel difference that co-segregates with a SNP site significantly associated with a salt-tolerance major gene is identified, the detection efficiency can be significantly improved and the cost can be saved.
[0005] Therefore, it is of great significance to quickly, accurately and simply identify the salt-tolerance characteristics of barley for screening and breeding new salt-tolerant barley varieties. SUMMARY
[0006] The application aims to provide an InDel molecular marker closely related to barley salt tolerance, which is applied to screening salt-tolerant barley germplasm and can be used for molecular marker assisted selection breeding in the field of barley genetic breeding, thereby accelerating the breeding process of salt-tolerant barley varieties.
[0007] In order to achieve the above-mentioned purpose, the technical scheme of the application is:
[0008] The InDel molecular marker closely related to the salt tolerance of barley is located at 10623423-10623551 bp of 2H chromosome of barley; the nucleotide sequence where the InDel molecular marker is located is shown as SEQ ID NO: 2 in a salt-sensitive barley variety; the nucleotide sequence where the InDel molecular marker is located is shown as SEQ ID NO: 3 in a salt-tolerant barley variety. The InDel difference thereof is located at the 42nd bp of the amplified fragment, and the base difference is shown as SEQ ID NO: 1.
[0009] SEQ ID NO: 1
[0010] GACAAGCTCCC;
[0011] SEQ ID NO: 2
[0012] CATCGAAGACGTGGATGCATGCATGCATGGCGCCACGCTCCCCTGCTTCTGCTTCTGCTGGCACAGCTCTCCGCCGCCGTGGCGTCGTCCTTCTCCGGCTACAGTTACTACAGCTTCC;
[0013] SEQ ID NO: 3
[0014] CATCGAAGACGTGGATGCATGCATGCATGGCGCCACGCTCCCGACAAGCTCCCCTGCTTCTGCTTCTGCTGGCACAGCTCTCCGCCGCCGTGGCGTCGTCCTTCTCCGGCTACAGTTACTACAGCTTCC.
[0015] Further, the present application designs an amplification primer according to the site of the above-mentioned InDel-P1 molecular marker, and the primer pair sequence for amplifying the InDel-P1 molecular marker is as follows:
[0016] InDel-P1 upstream primer: 5'-CATCGAAGACGTGGATGCATG-3' (SEQ ID NO: 4);
[0017] InDel-P1 downstream primer: 5'-GGAAGCTGTAGTAACTGTAGCC-3' (SEQ ID NO: 5).
[0018] The amplification product is 129 bp, and the InDel site is located at the 42nd bp of the amplified fragment.
[0019] The different barley genotypes are amplified by using the primers, and are genotyped by using 4% agarose gel, so that the barley germplasm resources with good salt tolerance can be effectively screened, specifically, the barley varieties containing "GACAAGCTCCC" are salt-tolerant, and the barley varieties lacking "GACAAGCTCCC" are salt-sensitive.
[0020] The application further provides application of the InDel molecular marker closely related to salt tolerance of barley and the amplification primer in identifying salt-tolerant barley varieties or assisting in screening salt-tolerant barley varieties or lines.
[0021] Further, it is detected whether the to-be-tested barley genomic DNA contains the sequence as shown in SEQ ID NO:1; if yes, the to-be-tested barley is determined as a salt-tolerant variety, and if not, the to-be-tested barley is determined as a salt-sensitive variety.
[0022] Further, the to-be-tested barley genomic DNA is used as a template, and the primers as shown in SEQ ID NO:4 and SEQ ID NO:5 are used for PCR amplification, and the amplification product is detected; when the amplification product is a single band of 129bp, the to-be-tested barley is a salt-tolerant variety; when the amplification product is a single band of 118bp, the to-be-tested barley sample is a salt-sensitive variety.
[0023] Further, the barley genomic DNA is extracted from a barley seedling leaf.
[0024] Further, the PCR reaction program comprises: 95℃ pre-denaturation for 5min; 95℃ denaturation for 5s, 55℃ annealing for 20s, 72℃ extension for 30s, 32 cycles; 72℃ extension for 5min, and 4℃ preservation.
[0025] Further, the PCR amplification reaction system is as follows: 2x Rapid Taq Master Mix 5 μL, 10 μmol / L Primer each 0.5 μL, template DNA 0.02-0.2 μg, and sterile water is added to 10 μL.
[0026] The application further provides application of the InDel molecular marker and the primer in screening salt-tolerant barley germplasm resources.
[0027] The application further provides application of the InDel molecular marker and the primer in barley molecular marker-assisted breeding.
[0028] Specifically, the application comprises the following steps:
[0029] (1) extracting genomic DNA of a to-be-tested barley plant;
[0030] (2) using the genomic DNA of step (1) as a template, performing PCR amplification reaction by using the primer pair;
[0031] (3) using 4% agarose gel to perform genotyping on the PCR product, if the base of "GACAAGCTCCC" is carried, the to-be-tested barley plant is a salt-tolerant material; if the "GACAAGCTCCC" is missing, the to-be-tested barley plant is a salt-sensitive material.
[0032] The Indel molecular marker can be detected in each tissue and development stage of the barley, and can be screened in the barley seedling stage, so that the selection breeding process is accelerated. Preferably, in step (1), the leaf of the to-be-tested barley in the seedling stage is taken for genomic DNA extraction.
[0033] In step (2), the position and size of the amplified product band are determined by 4% agarose gel electrophoresis. If the amplified product contains an 11bp sequence, the to-be-tested barley salt-tolerant material is obtained; if the amplified product does not contain an 11bp sequence, the to-be-tested barley is a salt-sensitive material.
[0034] The application further provides a method for screening a salt-tolerant barley variety, comprising the following steps: using the genomic DNA of the to-be-tested barley as a template, and performing PCR amplification by using the amplification primer, and selecting the barley variety as a parent or a female parent for breeding of salt-tolerant barley when a specific band appears at 129bp.
[0035] The application further provides a kit for detecting the salt tolerance of barley, comprising the amplification primer.
[0036] Advantages
[0037] (1) The InDel-P1 marker closely related to the salt tolerance of barley provided by the application has stable amplification, high sensitivity and strong specificity.
[0038] (2) The InDel-P1 marker provided by the application can be detected by using 4% agarose gel, without enzyme cutting, and the detection method is simple and low in cost.
[0039] (3) The InDel-P1 marker provided by the application can efficiently distinguish the salt-tolerant variety and the salt-sensitive variety of barley, and improve the breeding efficiency of the salt-tolerant new variety of barley. BRIEF DESCRIPTION OF DRAWINGS
[0040] Figure 1 The agarose gel map of the InDel-P1 marker (T carries 11bp, and S lacks 11bp).
[0041] Figure 2InDel-P1 and InDel-P2 were used to analyze the salt tolerance of 395 barley varieties (T: carrying 11bp, S: lacking 11bp).
[0042] Figure 3 Figure 3 is an agarose gel map of InDel-P1 marker of 30 barley germplasms (M: Marker; S: salt-sensitive variety; T: salt-tolerant variety).
[0043] Figure 4 Figure 4 is the two haploid salt injury indexes and leaf Na content of 30 barley germplasms (T: carrying 11bp, S: lacking 11bp). + DETAILED DESCRIPTION
[0044] In order to illustrate the technical solutions and technical purposes of the present application, the present application will be further described below in combination with the drawings and specific embodiments.
[0045] Example 1
[0046] The present application provides a molecular marker InDel-P1 for assisting in salt tolerance identification, using barley genomic DNA as a template, performing PCR amplification on the template by using InDel-P1 primer pair to obtain a DNA fragment, detecting the DNA fragment by using 4% agarose gel, and identifying the salt tolerance of the material according to the polymorphic differences on the agarose. The sequence of the InDel-P1 primer is as follows: the upstream primer 5'-CATCGAAGACGTGGATGCATG-3' (SEQ ID NO: 4), and the downstream primer 5'-GGAAGCTGTAGTAACTGTAGCC-3' (SEQ ID NO: 5).
[0047] The specific steps are as follows:
[0048] 1. Test material
[0049] The CTAB method was used to extract the leaf genomic DNA of 395 barley varieties in a natural population.
[0050] 2. Salt tolerance identification
[0051] The mixed substrate soil culture method was used to culture seedlings, 4 seeds of each variety were sown in a pot, and the seedlings were grown to the 2-leaf 1-heart stage, and then treated with 300mM NaCl. According to the death and survival of the plants, the leaf discoloration and wilting degree, the salt injury of each line of the population was scored and evaluated, 0 indicating normal growth of the plants without obvious symptoms, and 10 representing death of the plants. The salt tolerance identification was repeated 4 times.
[0052] 3. Correlation analysis
[0053] With 395 barley varieties of genomic DNA as template, InDel-P1 forward and reverse primers were used for PCR amplification, and the PCR system was as follows: 2x Rapid Taq Master Mix 5 μL, 10 μmol / L Primer 0.5 μL each, template DNA 0.02-0.2 μg, sterile water to 10 μL. The PCR reaction program included: 95℃ pre-denaturation 5 min; 95℃ denaturation 5 s, 55℃ annealing 20 s, 72℃ extension 30 s, 32 cycles; 72℃ extension 5 min, 4℃ storage; the PCR amplification product was detected by 4% agarose gel electrophoresis, when the amplification product was a single band of 129 bp, the tested barley was a salt-tolerant variety; when the amplification product was a single band of 118 bp, the tested barley sample was a salt-sensitive variety. The polymorphism differences between 395 varieties were photographed and recorded, and the correlation between the salt tolerance phenotype and the genotype was analyzed, and the correlation coefficient reached 0.63 Figure 2 ).
[0054] Example 2
[0055] 30 domestic and foreign core germplasm were used as materials (Table 1) for salt tolerance identification, leaf sodium ion content determination and InDel-P1 genotype analysis. The germplasm containing 11 bp base in the InDel-P1 PCR amplification segment had better salt tolerance, and accumulated less Na + in the leaves, while the germplasm lacking 11 bp base showed salt sensitivity, with higher Na + content in the leaves Figure 3 ).
[0056] Table 1 InDel-P1 genotype of 30 barley germplasms and their salt tolerance index
[0057] (T for carrying 11 bp, S for lacking 11 bp)
[0058]
Claims
1. An InDel molecular marker closely associated with salt tolerance in barley, characterized in that, The InDel molecular marker is located at 10623423-10623551 bp on barley chromosome 2H. In salt-sensitive barley varieties, the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:2; in salt-tolerant barley varieties, the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:
3.
2. The amplification primers for the InDel molecular marker closely associated with barley salt tolerance as described in claim 1, characterized in that, The amplification primer sequences are as follows: Upstream primer: 5′-CATCGAAGACGTGGATGCATG-3′; Downstream primer: 5′-GGAAGCTGTAGTAACTGTAGCC-3′.
3. The application of the InDel molecular marker closely associated with barley salt tolerance as described in claim 1 or the amplification primers as described in claim 2 in identifying salt-tolerant barley varieties or assisting in the screening of salt-tolerant barley varieties or lines.
4. The application according to claim 3, characterized in that, The test detects whether the genomic DNA of the barley to be tested contains the sequence shown in SEQ ID NO:1; if it does, the barley to be tested is determined to be a salt-tolerant variety, otherwise it is determined to be a salt-sensitive variety.
5. The application according to claim 4, characterized in that, Using the genomic DNA of the barley to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:4 and SEQ ID NO:5, and the amplification products were detected. When the amplification product was a single band of 129 bp, the barley to be tested was a salt-tolerant variety; when the amplification product was a single band of 118 bp, the barley sample to be tested was a salt-sensitive variety.
6. The application according to claim 4, characterized in that, The barley genomic DNA was extracted from barley seedling leaves.
7. The application according to claim 5, characterized in that, The PCR reaction procedure included: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 5 s, 55℃ annealing for 20 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min, and storage at 4℃.
8. The application according to claim 5, characterized in that, The PCR amplification reaction system consisted of: 5 μL of 2×Rapid TaqMaster Mix, 0.5 μL of each of 10 μmol / L Primer, 0.02-0.2 μg of template DNA, and 10 μL of sterile water.
9. A method for screening salt-tolerant barley varieties, characterized in that, Includes the following steps: Using the barley genomic DNA to be tested as a template, PCR amplification was performed using the amplification primers described in claim 2. When a specific band appeared at 129 bp in the amplification product, the barley variety was selected as the male or female parent for breeding salt-tolerant barley.
10. A reagent kit for detecting salt tolerance in barley, characterized in that, Includes the amplification primers as described in claim 2.