Application of KASP molecular marker in identification of muskmelon tendril traits

Abstract

The invention discloses application of a KASP molecular marker in identification of muskmelon tendril traits, and belongs to the technical field of molecular markers. According to the application, a BSA-seq technology is used for preliminarily positioning a gene interval related to the muskmelon tendril-free character, a KASP marker is further designed for fine positioning, and a key gene for controlling the character is finally determined to be MELO3C022091. The key gene has an InDel site with polymorphism between a parent HMC-1226 without tendrils and a parent hornhoney with tendrils, and the InDel site is shown as an insertion difference of five basic groups. The genotype and phenotype of the InDel site of the KASP molecular marker have significant correlation, wherein when the basic group is T, tendrils exist, and when the basic group is TATTAT, tendrils do not exist. The KASP molecular marker developed on the basis of the InDel site can efficiently and accurately perform genetic typing on a muskmelon population, early prediction of whether a filial generation has a tendril character or not is realized, the breeding selection efficiency is remarkably improved, and an important technical means is provided for muskmelon molecular marker-assisted breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to application of a KASP molecular marker in identifying tendril traits of melon. BACKGROUND

[0002] Melon (Cucumis melo L.) is an important horticultural crop of the Cucurbitaceae family and is widely cultivated in the global temperate to tropical regions. Its fruit morphology and quality are diverse, including common melon, Hami melon and other strains. Under natural growth conditions, melon relies on tendrils to climb supports to obtain sufficient light and ventilation, while enhancing the stability of the plant and preventing lodging. However, in modern facility cultivation modes, melon is mostly managed by artificial vine climbing, and the tendrils not only lose their original climbing function, but also become nutrient consumers, especially the tendrils at the same node as female flowers, which are prone to compete with fruits for nutrients, affecting yield and quality. In addition, artificial removal of tendrils not only increases labor costs, but also causes wounds and increases the risk of disease infection.

[0003] Therefore, breeding of non-tendril melon varieties has become an important breeding goal for facility cultivation. At present, the breeding of melon tendrils mainly relies on phenotypic selection, which has problems such as long breeding cycle and low efficiency. SUMMARY

[0004] The purpose of the present application is to provide application of a KASP molecular marker in identifying tendril traits of melon, which aims to identify the tendril traits of melon seedlings by using the KASP molecular marker, so as to improve the breeding efficiency of melon with target traits and further shorten the breeding cycle.

[0005] To achieve the above purpose, the present application provides application of a KASP molecular marker in identifying tendril traits of melon, and the identification of the tendril traits of melon comprises the following steps: extracting genomic DNA of a target melon, PCR amplifying based on the genomic DNA of the target melon as a template, and performing fluorescence detection based on primers of a KASP molecular marker InDel to obtain the gene type of the target melon; judging the traits of the target melon based on the detected gene type; The KASP molecular marker InDel is designed according to an InDel site at chr09:1176447-chr09:1176448, and the InDel site is located at 1008bp-1009bp of the nucleotide sequence shown in SEQ ID NO. 1.

[0006] As some optional embodiments of the present application, the polymorphism of the KASP molecular marker InDel is T or TATTAT, the T genotype is the tendril type, and the TATTAT genotype is the non-tendril type.

[0007] As some optional embodiments of the present application, the PCR amplification comprises the following steps: 95℃ pre-denaturation 10 min; 95℃ denaturation 15 s; 61℃ annealing 1 min, 10 cycles and annealing temperature decreasing by 0.6℃ per cycle; 95℃ denaturation 15 s; 55℃ annealing 1 min, 35 cycles.

[0008] As some optional embodiments of the present application, the gene type is detected based on the following reaction system: KASP Master mix 220 μL, 0.44 μL of each of primers A1 and A2 at a concentration of 100 μM, 1.32 μL of primer C1, and 1 μL of DNA.

[0009] As some optional embodiments of the present application, the primer pair of the KASP molecular marker InDel comprises two forward primers and one reverse primer, and a fluorescent reporter group FAM and HEX is added to the 5' end of the two forward primers.

[0010] As some optional embodiments of the present application, the two forward primers comprise a first forward primer A1 as shown in SEQ ID NO. 2 and a second forward primer A2 as shown in SEQ ID NO. 3, and the reverse primer is a reverse primer C1 as shown in SEQ ID NO. 4.

[0011] As some optional embodiments of the present application, the primer pair of the KASP marker InDel can be used to prepare a kit of KASP molecular markers for identifying the tendril trait of melon.

[0012] As some optional embodiments of the present application, the primer pair of the KASP marker InDel can be used for melon tendril germplasm breeding.

[0013] In summary, the present application has the following advantages: Compared with the prior art, the present application successfully develops a KASP molecular marker InDel for identifying whether melon has a tendril trait or not. The KASP molecular marker InDel is composed of two forward primers A1 and A2, each having a length of 53 bp, and one reverse primer C1 having a length of 30 bp. The site of the KASP molecular marker InDel is located at 1008-1009 bp of SEQ ID NO. 1, and the polymorphism is T / TATTAT. The insertion of five bases ATTAT will cause a frameshift mutation, affecting the development of tendrils, and when the base is T, the melon has tendrils, and when the base is TATTAT, the melon has no tendrils.

[0014] The application utilizes KASP molecular marker InDel to genotype whether the melon has tendril or not, and only needs to extract melon genomic DNA, PCR amplification, read fluorescence data by KASP fluorescence analyzer and analyze genotype to identify whether the melon has tendril or not. Moreover, the molecular marker has strong specificity and good stability; without complex steps such as enzyme cutting, electrophoresis and sequencing, the operation is simple and fast. Therefore, the KASP molecular marker InDel in the application can be simply, quickly and efficiently applied to melon molecular assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The figure is a schematic diagram of the tendrilled honeydew involved in the embodiments of the application; Figure 2 The figure is a schematic diagram of the HMC-1226 without tendrils, which is derived from Xinjiang Uygur Autonomous Region Academy of Agricultural Sciences; Figure 3 The figure is a schematic diagram of the HMC-1226 without tendrils, which is derived from Xinjiang Uygur Autonomous Region Academy of Agricultural Sciences; Figure 4 The figure is a schematic diagram of the KASP marker in the backcross population BC3 of the tendrilled honeydew and the non-tendrilled HMC-1226. Figure 5 The figure is a schematic diagram of the KASP marker in the backcross population BC3 of the tendrilled honeydew and the non-tendrilled HMC-1226. DETAILED DESCRIPTION

[0016] The principles and characteristics of the application are described below in combination with the embodiments, and the examples are only used to explain the application and not to limit the scope of the application. If the specific conditions are not mentioned in the embodiments, the conventional conditions or the conditions recommended by the manufacturer are used. If the manufacturers of the reagents or instruments are not mentioned, they are all conventional products that can be purchased on the market.

[0017] Curling is a remarkable morphological feature of Cucurbitaceae, and the curling phenomenon is formed by the asymmetric contraction of the internal fiber bands of specialized cells. Due to the slender internodes and less mechanical tissue of melon, it cannot achieve upright growth, so it must rely on the tendril to climb other objects to ensure that the plant gets enough light and ventilation conditions, and plays an important role in fixing plants and preventing lodging. However, with the popularization of modern agriculture, melon is now mostly cultivated in protected areas. In order to make more efficient use of space, melon usually uses artificial hanging vines, at which time the tendrils become redundant organs that consume nutrients, especially the tendrils on the same node as female flowers. Therefore, during cultivation, the tendrils need to be manually removed, the purpose of which is to reduce nutrient consumption and avoid the competition for nutrients between tendrils and fruits, and also to facilitate the control of the spatial distribution of plants and prevent disordered climbing growth caused by tendrils. However, the removal of tendrils not only increases labor costs, but also leaves wounds that are prone to bacterial growth, and for these reasons, tendril-free breeding has become an important breeding direction to meet the needs of facility horticulture cultivation.

[0018] InDel (insertion-deletion) marker refers to the insertion or deletion of a small piece of sequence at a certain position in the genome, usually less than 50 bp in length. According to the insertion-deletion site in the genome, PCR primers that can amplify these insertion-deletion sites are designed, which is the InDel marker. KASP technology, which stands for kompetitive allele-specific PCR, is a molecular marker technology developed in recent years. It is mainly based on SNP and InDel data at specific sites, and uses specific fluorescent primers to accurately amplify target SNPs and InDel sites. Genotyping is performed by scanning the fluorescence signal, without the need for time-consuming and laborious electrophoresis, photography, and band reading analysis. This technology is not only suitable for rapid detection of a large number of samples and a small number of sites, but also can achieve automation and high-throughput detection, with the advantages of speed, accuracy, and low cost. It is currently widely used in fine mapping of horticultural plants.

[0019] At present, the molecular mechanism of melon tendril-free traits has not been fully elucidated, and there is a lack of stable markers that can be used for molecular marker-assisted breeding. Therefore, the development of InDel markers closely associated with the tendril-free trait and the corresponding KASP detection system is of great significance for the efficient breeding of melon tendril-free varieties.

[0020] Based on this, the present application describes and provides a KASP molecular marker for identifying the tendril trait of C. melo. The KASP molecular marker is based on BSA-seq preliminary positioning and KASP fine positioning, identifies the key gene and InDel site controlling the tendril trait of C. melo, and develops the corresponding KASP molecular marker, providing an efficient and precise technical means for C. melo molecular breeding. In addition, the present application also relates to primer pairs related to the KASP molecular marker, and a kit containing these specific primer pairs, which are designed to efficiently identify the tendril trait of C. melo under laboratory conditions. The present application is not only limited to providing these molecular markers and kits, but further describes the specific application method of these tools in the tendril germplasm breeding process of C. melo. At the same time, based on the KASP molecular marker, primer pair and kit provided above, the present application describes a method for identifying the tendril trait of C. melo in detail, which comprises the steps of extracting DNA from C. melo samples, performing PCR amplification, and using KASP technology for genotype analysis, thereby achieving accurate identification of the tendril trait of C. melo.

[0021] Specifically, in the first aspect, the KASP molecular marker for identifying the tendril trait of C. melo in the present application is determined as KASP molecular marker InDel, which is designed based on the frameshift mutation (InDel) located at 1176447 and 1176448 on chromosome chr09, specifically based on the bases located at 1008bp-1009bp of SEQ ID NO. 1.

[0022] Further analysis shows that the base polymorphism is T / TATTAT, and the insertion of five bases ATTAT causes gene frameshift mutation, which further affects the development of tendrils, and the nucleotide sequence is shown in detail in SEQ ID NO. 1.

[0023] The sequence identifier SEQ ID NO. 1 and its corresponding variation site (see 1008bp-1009bp in the sequence 1188bp group below) are as follows:

[0024] In the second aspect, the primer pair of the KASP molecular marker for identifying the tendril trait of C. melo described in the present application comprises a first forward primer A1 as shown in SEQ ID NO. 2, a second forward primer A2 as shown in SEQ ID NO. 3, and a reverse primer C1 as shown in SEQ ID NO. 4. Among them, the first forward primer A1 has a FAM fluorescent group, and the second forward primer A2 has a HEX fluorescent group. Among them: SEQ ID NO. 2 is specifically: GAAGGTGACCAAGTTCATGCTGAAGCTGGAAAATAGAAATTATTGCAATAATT.

[0025] SEQ ID NO. 3 is specifically as follows: GAAGGTCGGAGTCAACGGATTGAAGCTGGAAAATAGAAATTATTGCAATAATA.

[0026] SEQ ID NO. 4 is specifically as follows: AAAAGGAGAGAGTTGTAATTACAACAATTA.

[0027] In a third aspect, the kit for identifying the KASP molecular marker of the tendril trait of C. melo provided by the present application comprises the primer pair of the KASP molecular marker as described above, i.e. the first forward primer A1 as shown in SEQ ID NO. 2, the second forward primer A2 as shown in SEQ ID NO. 3 and the reverse primer C1 as shown in SEQ ID NO. 4.

[0028] In a fourth aspect, the method for identifying the tendril trait of C. melo provided by the present application comprises the following steps: (1) extracting the genomic DNA of C. melo of parents and segregating population; (2) using the above-mentioned primer to perform PCR amplification on the genomic DNA of C. melo to obtain an amplification product; (3) using the KASP fluorescence analyzer to perform fluorescence data reading, wherein the homozygous genotype with tendrils presents a red fluorescence signal, the homozygous genotype without tendrils presents a blue fluorescence signal, and the heterozygous type presents a green fluorescence signal, and the genotype of C. melo can be analyzed according to different fluorescence signals.

[0029] Specifically, if the base of the InDel site detected is T, the C. melo is normal with tendrils; and when the base is TATTAT, the C. melo shows no tendrils.

[0030] In the embodiment, the PCR reaction system used for PCR amplification is shown in Table 1: Table 1

[0031] The components of KASP Master Mix (typical formula) include Taq DNA polymerase, dNTPs and MgCl2.

[0032] In the embodiment, the PCR amplification comprises the following steps: (1) pre-denaturation at 95℃ for 10 min; (2) 95℃ denaturation for 15s, 61℃ annealing for 1min, 10 cycles and annealing temperature decreasing by 0.6℃ every cycle; (3) 95℃ denaturation for 15s, 55℃ annealing for 1min, 35 cycles.

[0033] In the specific embodiment, the PCR amplification reaction procedure is shown in Table 2: Table 2

[0034] In summary, the application provides an InDel site for screening the tendril gene of melon, which is at 1008bp-1009bp as shown in SEQ ID NO. 1, and the polymorphism is T / TATTAT, the insertion of five bases ATTAT will cause a frame shift mutation, affecting the development of tendrils, and when the base is T, the melon has tendrils, and when it is TATTAT, the melon has no tendrils. The application also provides a KASP primer set for identifying the presence or absence of tendrils in melon, including a first forward primer A1 as shown in SEQ ID NO: 2 (with FAM fluorescent group), a second forward primer A2 as shown in SEQ ID NO: 3 (with HEX fluorescent group) and a reverse primer C1 as shown in SEQ ID NO: 4. The application also provides the application steps for identifying the presence or absence of tendrils in melon using the above primer set, i.e. extracting melon genomic DNA, PCR amplification, reading fluorescence data with KASP fluorescence analyzer and analyzing genotype, wherein homozygous tendrils (T / T) show red fluorescence, homozygous no tendrils (TATTAT / TATTAT) show blue fluorescence, and heterozygous (T / TATTAT) show green fluorescence.

[0035] The identification method provided by the application is suitable for early screening of melon breeding populations, does not need to rely on phenotype observation, shortens the breeding cycle, and can be used for rapid identification of the no-tendril parent HMC-1226 and its hybrid offspring.

[0036] The above technical solutions of the application will be described in detail below in combination with specific embodiments.

[0037] Example 1 This embodiment mainly further describes the BSA-seq positioning analysis of the melon tendrils trait gene.

[0038] Step 1, construction of F2 generation separation population The no-tendril material HMC-1226 is used as the father (as shown in SEQ ID NO. 1), and the tendrils material Yangjiaomeng is used as the mother (as shown in SEQ ID NO. 2). Figure 2 Figure 1 ​As experimental materials, the F1 generation plants were successfully obtained by crossing the no tendril material HMC-1226 and the tendril material Honeycomb as parents, and all the F1 generation plants showed tendril. Then, the F1 plants were self-crossed to generate a F2 population of 188 plants. When the plants entered the reproductive growth stage, the tendril type phenotype of the F2 population was identified. The identification results showed that in the F2 population, 143 plants had tendrils, and 45 plants had no tendrils, which was verified by chi-square test to be consistent with the segregation ratio of 3:1.

[0039] In the specific embodiment, the genetic rule analysis of the six-generation population without tendrils is shown in Table 3: Table 3

[0040] Step 2, fine mapping of the no-tendril gene In order to further determine the specific position of the melon tendril trait gene, the present application constructs a F2 population by crossing the tendril material Honeycomb with the no-tendril material HMC-1226. In order to identify the genomic region related to the target trait, we use the bulked segregant analysis (BSA) strategy based on whole-genome resequencing. According to the principle of extreme phenotypic differentiation, 25 single plants showing no tendrils and 25 single plants showing tendrils are selected from the F2 population, and the genomic DNA is mixed in equal amounts to construct two trait extreme subpopulation pools (referred to as no-tendril pool and tendril pool). At the same time, the parent materials (Honeycomb and HMC-1226) are sequenced to provide control information. All samples are subjected to high-throughput sequencing on the ILLUMINA Novaseq 6000 sequencing platform of Beijing Nuowuzhuyuan Technology Co., Ltd. to generate 150 bp double-end sequencing data.

[0041] The raw data is subjected to quality control by Fastp (version 0.20.1), and the adapter sequences and low-quality reads are removed. The obtained high-quality data is aligned to the melon reference genome DHL92v4, and BWA-MEM (version 0.7.17) is used for alignment, and SAMtools (version 1.15.1) is used for file format conversion and statistical alignment information, and then GATK (version 4.2.0.0) is used for deduplication, variant detection and filtering. The filtering standard of SNP site is: “QD<2.0||MQ<40.0||QUAL<30.0||FS>60.0||SOR>3.0||MQRankSum<-12.5||ReadPosRankSum<-8.0”.

[0042] On this basis, VCFtools (version 0.1.16) was used to further screen homozygous and different sites in the parent materials (sequencing depth ≥ 7 and genotype quality score ≥ 30), and then MutPlot (version 2.3.3) and QTL-plot (version 2.2.4) were used to calculate the SNP-index (i.e. the sequencing depth proportion of the variant allele in the site) of each site in the two offspring pools. The difference in allele frequency was measured by the difference in SNP-index (ΔSNP-index) between the two pools. In order to reduce noise, sliding window analysis (window size 1 Mb, step size 100 kb) was used to calculate the average value of ΔSNP-index within the window. Based on the confidence interval (95% and 99%) in the analysis results, potential QTL intervals were determined, and the genes in the candidate intervals were annotated and functionally analyzed to screen potential candidate genes related to the target traits.

[0043] According to the BSA-seq results, the no tendril trait regulating gene was initially located, and the initial location interval was the 0Mb-2.1Mb region of chromosome 9, and the location results are shown in Figure 3

[0044] In the initial location interval, KASP markers were designed according to the difference SNPs between the parents to fine map the no tendril trait gene, and it was determined that the tendril regulating gene was MELO3C022091. The difference site between the tendril and no tendril was at 1008bp-1009bp of SEQ ID NO. 1, which was an InDel site, and the polymorphism was T / TATTAT. When the base at this position was T, the melon phenotype was normal tendril, and when the base at this position was TATTAT, the melon phenotype was no tendril.

[0045] Example 2 This example mainly further explains the development of KASP markers for identifying melon tendril trait genes in detail.

[0046] Step 1, extract the no tendril material HMC-1226, the tendril material Yangjiaomeng and the F1 genomic DNA.

[0047] ​Specifically comprising the following steps: 1) take the parents and F1 young tissue into a 2 mL centrifuge tube, add 1 steel ball, then add 500 μL CTAB solution; 2) break at 60 Hz for 90 seconds and then centrifuge instantly; 3) add 500 μL chloroform and mix for 50 times up and down; 4) centrifuge at 12000 r / min for 5 min; 5) add 300 μL isopropanol in a new 1.5 mL centrifuge tube, and take 300 μL supernatant to the new centrifuge tube and mix for 50 times up and down; 6) centrifuge at 12000 r / min for 5 min; 7) pour off the supernatant; 8) add 400 μL 70% ethanol, shake, let the precipitate float, centrifuge at 12000 r / min for 1 min, and pour off the supernatant; 9) add 400 μL 70% ethanol, shake, let the precipitate float, and use 200 μL pipette to suck off the liquid; 10) stand for 10 min to dry, and after there is no alcohol smell, add double distilled water to dissolve.

[0048] In the specific embodiment, the CTAB component (a typical formula for extracting DNA) comprises 2 wt% CTAB (cetyltrimethylammonium bromide), 1.4 M NaCl, 100 mM Tris-HCl (pH 8.0), and 20 mM EDTA (pH 8.0).

[0049] Step 2, respectively, with no tendril material HMC-1226, with tendril material honeycomb and its F1 genomic DNA as a template, the primer shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4 was amplified by PCR. Among them, the KASP reaction was carried out in the reaction plate, and the reaction system included: KASP Master mix 220 μL, 0.44 μL of each of 100 μM primer A1 and A2, 1.32 μL of primer C1, 1 μL of DNA.

[0050] Specifically comprising the following steps: 1) 95℃ pre-denaturation for 10 min; 2) 95℃ denaturation for 15 s, 61℃ annealing for 1 min, 10 cycles and the annealing temperature decreases by 0.6℃ each cycle; 3) 95℃ denaturation for 15 s, 55℃ annealing for 1 min, 35 cycles.

[0051] Step 3, after amplification, the fluorescence value was read by FAM and HEX light beam scanning of KASP fluorescence analyzer, and the parent and F1 genotypes were judged according to the fluorescence signal color, and the genotyping diagram capable of identifying the parent, the parent and the hybrid at the same time was obtained, as shown in Figure 4 .

[0052] The results show that the output of the non-tendril is blue, the output of the homozygous genotype with tendril is red, and the output of the heterozygous type with tendril F1 is green. It can be known that the KASP marker designed according to the InDel site is effective.

[0053] Example 3 This example is mainly directed to further detailed description of the application of KASP marker for identifying melon tendril trait gene.

[0054] Melon non-tendril mutant material HMC-1226 and normal type with tendrils material honeycomb were crossed. Combined with molecular marker assisted selection, the non-tendril gene was introduced into the honeycomb with tendrils through multiple backcrosses. Figure 5 BC3 generation hybrid seedlings were screened, green was the heterozygous genotype, red was the honeycomb with tendrils genotype, and blue was the non-tendril parent control.

[0055] This example screens the BC3 (third generation backcross population) hybrid seedlings, uses the fluorescence signal of KASP marker (green for heterozygous genotype, red for tendrils genotype, and blue for non-tendril parent control), directly displays whether the marker can accurately distinguish different genotypes of individuals, proves that it can still play a stable role in multiple generations of breeding, and can ensure the accuracy of the screening results. And with tendrils honeycomb as the target improved variety, the non-tendril gene (from HMC-1226) is introduced into it through multiple backcrosses, the heterozygous genotype individuals (green fluorescence) are quickly identified by the marker, which provides accurate selection basis for subsequent continued backcrossing or selfing, and finally obtains the stable inherited non-tendril honeycomb variety, and accelerates the breeding process.

[0056] In summary, the InDel site related to the melon non-tendril gene is successfully screened in this application, and the site is converted into a KASP molecular marker, which can be used to detect the population and can mass predict the presence or absence of tendrils in hybrid offspring, greatly improving the selection efficiency. Using the identification method of the present application to identify whether the melon is non-tendril, the identification of the sample can be completed by simple DNA extraction, PCR specific amplification, and KASP genotyping detection. No restriction enzyme digestion is required, the marker has high specificity and stability, and the screening method of the marker is simple, fast, and low cost, suitable for large batches, high throughput, and automation, which is very suitable for the realization of modern agricultural molecular breeding.

[0057] Although the specific embodiments of the present application are described in detail, it should not be understood as limiting the scope of protection of the present application. Various modifications and variations made by those skilled in the art without creative labor within the scope described in the claims are still within the scope of protection of the present application.

Claims

1. The application of a KASP molecular marker in identifying melon tendril traits, characterized in that, The identification of melon tendrils includes the following steps: Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was then performed using primers based on the KASP molecular marker InDel to obtain the gene type of the target melon. Based on the detected gene type, the traits of the target melon were determined. The KASP molecular marker InDel was designed based on the InDel sites at chr09:1176447 to chr09:1176448, which are located at 1008bp-1009bp of the nucleotide sequence shown in SEQ ID NO.

1.

2. The application of the KASP molecular marker according to claim 1 in identifying the tendril trait of melon, characterized in that, The polymorphism of the KASP molecular marker InDel is T or TATTAT, with the T genotype being the tendril type and the TATTAT genotype being the non-tendril type.

3. The application of the KASP molecular marker according to claim 1 in identifying the tendril trait of melon, characterized in that, The PCR amplification includes the following steps: Pre-denaturation at 95℃ for 10 min; Denaturation at 95℃ for 15 seconds; Anneal at 61℃ for 1 minute, for 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle; Denaturation at 95℃ for 15 seconds; Anneal at 55℃ for 1 minute, 35 cycles.

4. The application of the KASP molecular marker according to claim 1 in identifying the tendril trait of melon, characterized in that, The gene type was obtained based on the following reaction system: 220 μL KASP Master mix, 0.44 μL each of primers A1 and A2 (100 μM), 1.32 μL primer C1, and 1 μL DNA.

5. The application of the KASP molecular marker according to claim 1 in identifying the tendril trait of melon, characterized in that, The primer pair for the KASP molecular marker InDel includes two forward primers and one reverse primer, with fluorescent reporter groups FAM and HEX added to the 5' ends of the two forward primers.

6. The application of the KASP molecular marker according to claim 5 in identifying the tendril trait of melon, characterized in that, The two forward primers include a first forward primer A1 as shown in SEQ ID NO.2 and a second forward primer A2 as shown in SEQ ID NO.3, and the reverse primer is a reverse primer C1 as shown in SEQ ID NO.

4.

7. The application of the KASP molecular marker according to claim 6 in identifying the tendril trait of melon, characterized in that, The primer pair for the KASP marker InDel can be used to prepare a kit for identifying KASP molecular markers for melon tendrils.

8. The application of the KASP molecular marker according to claim 6 in identifying the tendril trait of melon, characterized in that, The primer pair of the KASP marker InDel can be used for the breeding of melon tendrils.

Images