Tremella fuciformis strain

Abstract

The invention provides a new tremella strain variety HT108, which is formed by space radiation induced variation breeding by taking'ancient tremella Tr21 'as an original strain. The Tremella fuciformis Tr21 has the characteristics of high mycelial growth speed, high polysaccharide content in spores and the like, the sporocarp is yellow, the flower shape is round and compact, the tremella slices are thick and are internally rolled, the yield is high, the active ingredient content is high, particularly the total polyphenol content and the total flavone content are respectively increased by more than 30% compared with those of the contrast Tremella fuciformis Tr21, and the Tremella fuciformis Tr21 has good production and application values.

Description

Technical Field

[0001] This invention relates to the field of edible fungi technology, specifically to a strain of Tremella fuciformis. Background Technology

[0002] Silver ear fungus ( Tremella fuciformis Berk. taxonomically belongs to the phylum Basidiomycota, class Tremellomycetes, order Tremellales, family Tremellaceae, and genus Tremello. Tremella Tremella fuciformis (white fungus) is a mesophilic, aerobic fungus with over 200 years of cultivation history in my country. Its development from wild to industrialized cultivation has been a long process, evolving from natural spore inoculation to the first acquisition of pure Tremella strains and associated fungi, then to mixed seed production; from log domestication to the establishment of bottle cultivation technology, and finally to the promotion of bag cultivation technology. These technological innovations have significantly increased Tremella yield. However, in the development and actual production of the Tremella industry, the severe underdevelopment of wild germplasm resources has resulted in a lack of germplasm resources, leading to significant homogenization of currently cultivated Tremella varieties with low molecular markers. Especially among high-quality cultivated Tremella varieties, molecular markers are mostly only present in appearance and color. With the rapid development of the national economy and the continuous improvement of residents' living standards and health awareness, the market demand for Tremella products is also developing towards diversification and molecular marker-based approaches. Therefore, breeding superior new Tremella varieties has become an important aspect of supporting the healthy development of the industry.

[0003] Space breeding, also known as space mutation breeding, is an effective method for creating new germplasm resources and varieties that has emerged in the last decade or so. It primarily utilizes the unique combined environment of space, such as strong ion radiation, microgravity, weak magnetic fields, and high vacuum, to induce mutations in the heritable material of the mutagenic material. The material is then returned to Earth to screen for new germplasm, thereby obtaining superior varieties with stable genetic characteristics. Compared with traditional breeding methods, it has advantages such as a high mutation rate, short breeding cycle, high heritability of superior traits, and ease of obtaining rare traits. Therefore, researchers have used the "Space Breeding Experimental Project" platform to conduct space breeding of Tremella fuciformis (silver ear fungus) in order to obtain new varieties with excellent and stable special genetic mutation traits to meet the increasingly diverse market demand in the development of Tremella fuciformis production. Summary of the Invention

[0004] This invention provides a Tremella strain with rapid mycelial growth and high content of polysaccharides in spores. The fruiting bodies of this Tremella strain HT108 are yellow, round and compact, with thick and involute ear-like structures. It has high yield, high content of active ingredients, and significantly higher content of total polyphenols and total flavonoids than the control, and has good production and application value.

[0005] In a first aspect of the present invention, a *Tremella fuciformis* strain, named HT108, is provided, and the differential nucleotide sequence of the *Tremella fuciformis* strain or its fruiting bodies is shown in SEQ ID NO:1: GGAGCTGAGTTGGCGGGATATCAATGGTGATGCTCGCGGTAGCACAGCTGCTCTCGGTGCAGCATGCACCCATCTCGCCGAGGTGTTCCGAAGATGAGGGACGATGCGAGATGGGCCGACGTCCGAGGGGGCGGCGACGAGCCACACTGACCTCCCGAGGCCAATGCCTTGTCTCAGGATCATCATGAAGATGCTCCAAAACCTCG CGCGTGGGTGCCAGTCCAGTGGAGGTAGACAGGCTAGGACGTGAACGACAACGTTTGCAACGATGCCGACTGACTTTCGTCTAACCCCACGAAGCTACTCCGGCCAGCCGAAGATTGGGATTAAATGGGAAAAATAGAGAGAGAATATCGAAAAGTCAGAACCAAGGTGGTCCGTTCTGCGTTTGGTATTGTTTTTTCCTCCCTCCAA And / or the differential nucleotide sequence of the *Tremella fuciformis* strain or its fruiting body is shown in SEQ ID NO:2: CGGGGACTGGATCGGACTGGATTCGTGCGATGGCTTGGCTCTGGCTCTGGCTCTTCAGCCTCAACAAGCTGAGCATGCCCCGGTTAGTCATGGCACCCTAGCCCTAGCCCCAGCCCCAGCCAGCCCAGCTCGACTCGACCCGCTGCACCTTTCCTTCGGATCTCCCTGCCTGCCTGGCTGCCCCGCGTGTCCGACGTCCGTCCCACCA TCCACCTCGGCCACGGCCTGCGGTCAACGGCACGGCCTACGGTCACACCCCTTCCCCTTCCTGATATAATAACAATCATGGCTGATCATGGCCGCCGCCGAGCGTCCATCCACCCTCTTGACTCTTCGCGATCCGTCCCGTTCCATTCCATTGACAACCACACTGAACATATCCCCCCATCCTCCACATCACCATCTATTACAGCCTGA Preferably, the Tremella fuciformis was deposited on April 9, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.41885, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] Preferably, the fruiting bodies of the *Tremella fuciformis* strain are yellow, with round and compact flower shapes, and thick, inwardly rolled ear-like lobes.

[0007] Preferably, the total polyphenol and total flavonoid content of the *Tremella fuciformis* strain is increased by more than 30% compared with the control strain *Tremella fuciformis* Tr21.

[0008] Secondly, the present invention provides the application of the Tremella strain HT108 described in the first aspect as a parent in the field of breeding.

[0009] Thirdly, the present invention provides the application of the Tremella strain HT108 described in the first aspect in food processing.

[0010] Food processing includes, but is not limited to, products containing HT108 from tremella: tremella polysaccharides, tremella yogurt, tremella dew, tremella prebiotics, tremella bird's nest, tremella beverages, freshly stewed tremella soup, herbal tremella, freeze-dried tremella soup, etc.

[0011] Compared with the prior art, the Tremella strain provided by the present invention has at least the following beneficial effects: The Tremella strain HT108 provided by this invention is derived from 'Gutian Tremella Tr21' (Minrenjun 2007002, No. Tr21) as the starting strain, and was selected through space radiation-induced mutation. It was carried out through the "Space Breeding Experiment Project" platform of Shenzhou-16 manned spacecraft on May 30, 2023, and was activated in 2024. After three rounds of preliminary screening through mycelial germination, the strain was obtained. The results of basic biological characteristic analysis, physicochemical analysis, and fruiting test analysis show that Tremella strain HT108 has a faster mycelial growth rate and a higher content of polysaccharides in spore cells compared with the main cultivated variety 'Gutian Tremella Tr21'.

[0012] Cultivation and production trials and agronomic trait identification conducted at research institutes, multiple tremella factories, and farmers showed that the fruiting bodies of the tremella strain HT108 provided by this invention are yellow, with round and compact fruiting bodies, and thick and involute ear lobes. The nutritional quality of the fruiting bodies is not significantly different from the control variety, and the total polyphenol content and total flavonoid content are more than 30% higher than those of the control group Tr21. It has high yield and high content of active ingredients, and has good production and application value. Attached Figure Description

[0013] Figure 1 This is a comparison chart of the 24-hour growth rate of Tremella fuciformis spores; Figure 2 This is a comparison chart of the growth rate of Tremella fuciformis spores over 48 hours; Figure 3 This is a comparison chart of the growth rate of Tremella mycelium; Figure 4 This is a comparison of the spore morphology of Tremella strains; Figure 5 These are comparative images of the hyphal morphology of different strains of Tremella fuciformis. Figure 6 These are microscopic morphological comparisons of spores from different strains of Tremella fuciformis. Figure 7 These are comparative images of the mycelial morphology of various Tremella strains. Figure 8 This is a comparison of the sub-entity feature maps of Tr21 (left) and HT108 (right); Figure 9 These are cross-sectional feature maps of sub-entities of Tr21 (left) and HT108 (right); Figure 10 These are the auricular feature images of the sub-entities of Tr21 (left) and HT108 (right); Detailed Implementation To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0014] Test strains Gutian Tremella Tr21 (No. Tr21): The main cultivated yellow variety is used as a control. It is a strain preserved by the Fujian Agriculture and Forestry University Characteristic Edible Fungus Variety Innovation and Metabolic Engineering Team (Minrenjun 2007002). Gutian Tremella Tr01 (No. Tr01): Mainly cultivated white variety, a strain preserved by the Fujian Agriculture and Forestry University Special Edible Fungus Variety Innovation and Metabolic Engineering Team (Minrenjun 2007001). Fuyin Yellow Fungus (No. TYH-SD1): Yellow variety, selected and preserved by the Fujian Agriculture and Forestry University Special Edible Fungus Variety Innovation and Metabolic Engineering Team (Minrenjun 2022007). Fuyin Snow Fungus (No. TWH-SD2): White variety, selected and preserved by the Fujian Agriculture and Forestry University Special Edible Fungus Variety Innovation and Metabolic Engineering Team (Minrenjun 2022006).

[0015] Example 1: Breeding of Tremella strain HT108 Tr21 spores were inoculated into 1.5 mL centrifuge tubes and cultured for 3 days. The tubes were then mailed to the Kunming Institute of Botany, Chinese Academy of Sciences. The institute then sent the strain into space aboard the Shenzhou-16 manned spacecraft using the "Space Breeding Experiment Project" platform. After 5 months of space mutagenesis, the strain returned to Earth. The brought-back mycelial blocks were directly inoculated onto PDA solid medium for activation. Mycelial germination was then screened using the medium. Mycelial blocks with obvious germination were selected as the target strain for further use and labeled HT108. This strain is easy to germinate, and mixing it with *Auricularia auricula-judae* (a type of fungus) makes spawn production easier and more likely to produce ear-like fruiting bodies. The breeding technology route and selection process of the *Auricularia auricula-judae* strain HT108 are as follows: Figure 1 As shown.

[0016] Example 2: Analysis of the characteristics of HT108 spores and hyphae 2.1 Determination of HT108 spore and mycelial growth rate The spores of Tremella fuciformis were inoculated into 150 mL of liquid culture medium and cultured at 25℃ with shaking at 110 rpm until OD600 = 1.8-2.0. A small amount of bacterial solution was taken and re-inoculated into CM liquid culture medium, and the OD600 was adjusted to 0.2. The absorbance of the bacterial solution at 600 nm was measured after 24 h and 48 h, respectively.

[0017] Using a 7 mm diameter punch, mycelial blocks were extracted from the edge of the hyphae on HT108 and Tr21 plates, inoculated onto the culture medium, and cultured in a 25℃ constant temperature incubator for 25 days. The mycelial growth diameter was measured and the growth rate was calculated. At the same time, the mycelial morphology characteristics were observed. Mycelial growth rate (mm / d) = Mycelial diameter (mm) / Culture time (d) The differences in spore and mycelial phenotypic characteristics and growth rates between easily germinating mycelial blocks HT108 and Tr21 were observed and analyzed. (Tables 1 and 2 are referenced.) Figure 1-3 It can be seen that there is a certain difference in growth rate between HT108 and Tr21. After 24 hours of culture, the spore growth rate of strain HT108 is significantly greater than that of Tr21 (P<0.05), while after 48 hours of culture, the spore growth rate of strain HT108 is significantly lower than that of Tr21 (P<0.05).

[0018] On the culture medium, HT108 had an average growth rate of 1.81 ± 0.04 mm / d, which was 39.23% faster than Tr21.

[0019] Table 1. Growth rate of Tremella fuciformis spores

[0020] Table 2. Growth rate of Tremella mycelium

[0021] 2.2 HT108 spore colony morphology 10 μL of HT108 and Tr21 spore suspensions (OD600=1.8-2.0) were inoculated onto CM solid medium and incubated in a 25℃ constant temperature incubator for 7 days. The colony morphology was then observed under a stereomicroscope.

[0022] Depend on Figure 4 , Figure 5 Tables 3 and 4 show that HT108 and Tr21 differ in morphology. Specifically, compared to Tr21, the colony surface of HT108 is less smooth, with granular protrusions; both HT108 and Tr21 spore colonies have some flatness, but the flatness of Tr21 is somewhat concave; HT108 and Tr21 are similar in color, both being pale yellow, but the edge regularity is significantly lower than that of Tr21. In terms of hyphal morphology, HT108 has a lower density and weaker aerial hyphae compared to Tr21.

[0023] Table 3 Evaluation of morphological characteristics of spores

[0024] Note: "+" indicates a weak degree, "++" indicates a moderate degree, and "+++" indicates a strong degree.

[0025] Table 4 Evaluation of hyphae morphological characteristics

[0026] Note: "+" indicates a weak degree, "++" indicates a moderate degree, and "+++" indicates a strong degree.

[0027] 2.3 Microscopic morphology of HT108 spores and hyphae HT108 and Tr21 spores were inoculated onto solid culture medium and cultured at 25°C for 7 days. After 7 days, the spores were scraped into 100 μL of sterile water, diluted and mixed, and then prepared into slides for observation of the spore morphology under an optical microscope. The spore size was measured using the size measurement function of the OptikaVision Lite software, with 5 replicates per group. Figure 6 As shown in Table 5, there was no significant difference in spore size between HT108 and Tr21; in terms of morphology, both HT108 and Tr21 were spindle-shaped with no obvious difference.

[0028] After 20 days of cultivation, appropriately sized mycelial blocks with attached hyphae at the edges were carefully cut. The clamp connections of the hyphae were observed under a microscope, and the hyphal diameter was measured. Hyphae diameter measurements were performed using the built-in size measurement function of Optika Vision Lite software, with four replicates per group. Figure 7As shown, on the culture medium, the mycelial diameter of HT108 was 3.21±0.27 mm, with relatively uniform thickness and clamp connections and septa. The diameter of HT108 mycelium was significantly higher than that of Tr21 (P<0.05).

[0029] Table 5 Microscopic morphology of Tremella fuciformis spores

[0030] 2.4 Determination of HT108 spore polysaccharides 1 mL of HT108 and Tr21 spore suspensions (OD600 = 1.8–2.0) were inoculated into 150 mL of CM liquid medium and cultured at 25 °C with shaking at 110 rpm for 7 days. The supernatant was collected by centrifugation at 8000 rpm for 10 min and filtered through a PES membrane for subsequent extracellular polysaccharide determination.

[0031] The total sugar concentration of Tremella fuciformis was determined by the phenol-sulfuric acid method, and the reducing sugar concentration was determined by the DNS method. The extracellular polysaccharide content of HT108 and Tr21 was obtained by subtracting the two methods.

[0032] 1 mL of HT108 and Tr21 spore suspensions (OD600 = 1.8-2.0) were inoculated into 150 mL of CM liquid medium and cultured at 25 °C with shaking at 110 rpm for 7 days. The spores were collected by centrifugation at 8000 rpm for 10 min, washed three times with 30 mL of sterile water, dried at 65 °C to constant weight, and ground into powder for intracellular polysaccharide determination.

[0033] The content of crude polysaccharides in cells was determined using the phenol-sulfuric acid method.

[0034] The polysaccharide content of each Tremella strain is shown in Table 6. As can be seen from Table 6, the extracellular crude polysaccharide concentration of HT108 is significantly lower than that of Tr21; the intracellular crude polysaccharide content of HT108 is 48.29±0.57g / 100g, which is significantly higher than that of Tr21.

[0035] Table 6. Polysaccharide content of various Tremella strains

[0036] Example 3 Antagonism experiment of HT108 strain Using an 8 mm diameter sterile punch, mycelial blocks were extracted from the edge of appropriately aged HT108 colonies. These blocks were then inoculated onto 90 mm diameter culture media, one block facing off against mycelial blocks of five other tested strains, with a distance of approximately 0.5 cm between them. The media were incubated at 25°C, and the mycelial distribution at the colony-to-colony junctions was observed. The results are shown in Table 7. It can be seen that the mycelial junctions between HT108 and Tr01, Tr21, TYH-SD1, and TWH-SD2 exhibited clear gaps and a groove-like antagonistic pattern, indicating strong antagonism. This suggests that HT108 exhibits significant antagonism with these strains, indicating that this strain differs from the identified varieties in terms of metabolites or genetics.

[0037] Table 7. Antagonistic experiments between HT108 and five other strains.

[0038] Note: "+" indicates a weak degree, "++" indicates a moderate degree, and "+++" indicates a strong degree.

[0039] Example 4: Analysis of the main nutrient components of HT108 fruiting bodies The total polyphenol and total flavonoid contents were determined according to the methods in "Extraction and Separation Study of Total Polyphenols from Ganoderma lucidum" and "Optimization of Extraction Process of Total Flavonoids from Okra Flowers by Response Surface Method". The standards also included: GB 5009.5-2016 National Food Safety Standard - Determination of Protein in Food; GB / T 5009.10-2003 Determination of Crude Fiber in Plant-Based Foods; SN / T4260-2015 Determination of Crude Polysaccharides in Exported Plant-Based Foods - Phenol-Sulfuric Acid Method; and NY / T 3676-2020 Determination of Total Triterpenoids in Ganoderma lucidum - Spectrophotometric Method.

[0040] Table 8 shows the main nutritional components of the new varieties of Tremella fuciformis HT108 and Gutian Tremella fuciformis Tr21 under the same cultivation conditions. Both varieties have certain advantages in nutritional composition, especially HT108, where the total polyphenol and total flavonoid content is significantly higher than the control, with total polyphenols increasing by 55.56% and total flavonoids by 60%. After multiple batches of experiments, and with variations in each batch or formula, the above data may differ, but the increase in total polyphenols and total flavonoids compared to Tr21 is consistently above 30%.

[0041] Table 8. Main nutritional components of Tremella fruiting bodies

[0042] Example 5: Growth period and yield performance 5.1 Reproductive period Testing revealed that the new cultivar HT108 of white fungus is a mesophilic fruiting fungus, with an optimal fruiting temperature of 20-26℃. The entire cultivation cycle of white fungus is 35-45 days. The mycelial growth stage lasts approximately 15-20 days, requiring a temperature of 20-26℃, not exceeding 28℃ in the mycelium incubation room. The fruiting body growth period is generally around 18 days, requiring a room temperature not exceeding 26℃. Current factory-style cultivation, with its temperature control equipment, is less affected by seasonal climate limitations, allowing for year-round cultivation and is suitable for bag cultivation.

[0043] 5.2 Key Production Performance Fruiting experiments were conducted simultaneously on HT108 and Tr21. The fruiting bodies of *Tremella fuciformis* were carefully collected, and their texture and morphology were observed using an optical microscope. Analysis of the fruiting experiments showed that HT108 had a mycelial growth cycle of 20 days and a fruiting period of 24 days. The fruiting bodies were yellow, with a relatively dark color, elastic yet firm, round and compact in shape, resembling a chrysanthemum. The fruiting bodies were thick, resulting in high yield and good uniformity. The fruiting body yield results are shown in Table 9. The average fresh weight of a single bag of fruiting bodies was 325.20 g, representing a 21.16% increase compared to the control variety Tr21.

[0044] Table 9 Comparison of fruiting yield between HT108 and control variety Tr21

[0045] Example 6 Comparison of agronomic traits The agronomic traits of HT108 fruiting bodies are shown in Tables 10 and 11. The fruiting bodies of Tr21, after removing the stem tip, had significantly higher weight, diameter, and ridge degree than those of HT108. Morphological characteristics of the fruiting bodies are shown in [Tables 10 and 11]. Figure 8-10 The fruiting body of HT108 is yellowish in color, and the whole silver ear is very firm, with the ear lobes rolled inward and relatively thick, measuring 0.31 mm. There is no significant difference in the diameter and thickness of the ear core between the two.

[0046] Table 10 Morphological characteristics of HT108 and control variety Tr21

[0047] Table 11 Agronomic traits of HT108 and control variety Tr21

[0048] Note: *** indicates significant differences in agronomic traits among different experimental groups (P<0.001). Example 7 Differential Nucleotide Sequence Analysis The total DNA extracted from Tremella fuciformis Tr21 and HT108 was sent to Sangon Biotech (Shanghai) Co., Ltd. for whole-genome sequencing. The Genome Anlysis Toolkit (GATK) software and the HaplotypeCaller algorithm were used for analysis. The genome sequence information of Tr21 and HT108 were compared to obtain differentially expressed nucleotide sequence fragments. After sequencing and alignment, fragments amplified using different primers showed partial differences between HT108 and Tr21 sequences. The fragment amplified using primer 44 (44F 5'-ACTCAAGCCGACCCTATTCA-3', 44R 5'-GAGGAGCAACGCAATACCAA-3') showed a partial difference in the Tr21 sequence, with HT108 exhibiting a 35 bp InDel deletion compared to Tr21. Similarly, the fragment amplified using primer 54 (54F 5'-CGTCCTTCGGTGTTGTGTC-3', 54R 5'-AGGCTGTATAGATGGTGATGTG-3') showed partial differences between HT108 and Tr21 sequences, with HT108 exhibiting a 27 bp InDel deletion compared to Tr21.

[0049] The above results were tested by the Institute of Edible Fungi of the Fujian Academy of Agricultural Sciences, which issued a "Fingerprint Detection Report for the New Variety of Tremella fuciformis HT108". The conclusion was: "There are significant differences in the DNA fingerprints between HT108 and Tr121, which can confirm that they are different varieties." The differential sequence information between HT108 and Tr121 is shown in Table 12.

[0050] Table 12 Differential sequence information between HT108 and Tr21 The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A strain of Tremella fuciformis, named HT108, characterized in that, The differential nucleotide sequence of the Tremella strain or its fruiting body is shown in SEQ ID NO:1: GGAGCTGAGTTGGCGGGATATCAATGGTGATGCTCGCGGTAGCACAGCTGCTCTCGGTGCAGCATGCACCCATCTCGCCGAGGTGTTCCGAAGATGAGGGACGATGCGAGATGGGCCGACGTCGAGGGGCGGCGACGAGCCACACTGACCTCCCGAGGCCAATGCCTTGTCTCAGGATCATCATGAAGATGCTCCAAAACCTCGC GCGTGGGTGCCAGTCCAGTGGAGGTAGACAGGCTAGGACGTGAACGACAACGTTTGCAACGATGCCGACTGACTTTCGTCTAACCCCACGAAGCTACTCCGGCCAGCCGAAGATTGGGATTAAATGGGAAAAATAGAGAGAGAATATCGAAAAGTCAGAACCAAGGTGGTCCGTTCTGCGTTTGGTATTGTTTTTTCCTCCCTCCAA; and / or the differential nucleotide sequence of the Tremella fuciformis strain or its fruiting body such as SEQ ID NO:2 shows: CGGGGACTGGATCGGACTGGATTCGTGCGATGGCTTGGCTCTGGCTCTGGCTCTTCAGCCTCAACAAGCTGAGCATGCCCCGGTTAGTCATGGCACCCTAGCCCTAGCCCCAGCCCCAGCCAGCCCAGCTCGACTCGACCCGCTGCACCTTTCCTTCGGATCTCCCTGCCTGCCTGGCTGCCCCGCGTGTCCGACGTCCGTCCCA CCATCCACCTCGGCCACGGCCTGCGGTCAACGGCACGGCCTACGGTCACACCCCTTCCCCTTCCTGATATAATAACAATCATGGCTGATCATGGCCGCCGCCGAGCGTCCATCCACCCTCTTGACTCTTCGCGATCCGTCCCGTTCCATTCCATTGACAACCACACTGAACATATCCCCCCATCCTCCACATCACCATCTATTACAGCCTGA.

2. The *Tremella fuciformis* strain according to claim 1, characterized in that, The described Tremella strain was deposited on April 9, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.41885. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

3. The *Tremella fuciformis* strain according to claim 1 or 2, characterized in that, The fruiting bodies of the described Tremella strain are yellow, with round and compact flower shapes, and thick, inwardly rolled ear-like lobes.

4. The *Tremella fuciformis* strain according to claim 1 or 2, characterized in that, The total polyphenol and total flavonoid content of the strain was more than 30% higher than that of the control strain, Gutian Tremella fuciformis Tr21.

5. The application of the Tremella strain HT108 as a parent in the field of breeding, as described in any one of claims 1-4.

6. The application of the Tremella strain HT108 according to any one of claims 1-4 in food processing.

Images