ShRNA interference sequence of targeted silencing PCSK9 gene and construction method and lipid-lowering application of recombinant adeno-associated virus vector of shRNA interference sequence

Abstract

The invention relates to an shRNA (short hairpin Ribonucleic Acid) interference sequence of a targeted silence PCSK9 gene and a construction method and lipid-lowering application of a recombinant adeno-associated virus vector of the shRNA interference sequence. Hyperlipidaemia is a metabolic disease characterized by abnormal rising of cholesterol and triglyceride levels in blood, and the design of lipid-lowering drugs is the focus of attention to improvement of hyperlipidaemia. Proprotein convertase subtilisin / kexin type 9 (PCSK9) can be combined with a low-density lipoprotein receptor (LDL-R) and degrade the LDL-R, so that accumulation of LDL-C in blood is further promoted, and hyperlipidemia is caused. Aiming at the key target PCSK9, a specific shRNA interference sequence is designed, and a recombinant adeno-associated virus vector (rAAV) carrying the sequence is constructed by an enzyme digestion-connection method. In-vitro experiments prove that the vector can remarkably reduce the expression level of PCSK9 protein, so that the cyclic utilization of a low-density lipoprotein receptor (LDL-R) is promoted, and the concentration of low-density lipoprotein cholesterol (LDL-C) in plasma is reduced. The rAAV vector provided by the invention has the characteristics of low production cost, high transfection efficiency, lasting action time and the like, and provides a new thought for gene therapy of hyperlipidemia.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a method for constructing a shRNA interference sequence that targets and silences the PCSK9 gene and its recombinant adeno-associated virus vector, and its lipid-lowering application. Background Technology

[0002] Hyperlipidemia is a metabolic disorder characterized by abnormally high levels of lipids (mainly cholesterol and triglycerides) in the blood. These lipids are transported in the blood and participate in various bodily functions, such as cell membrane formation and hormone synthesis. However, excessively high lipid levels can lead to atherosclerosis and increase the risk of chronic diseases such as coronary heart disease, hypertension, diabetes, and fatty liver.

[0003] The design of lipid-lowering drugs is a key focus in improving hyperlipidemia. Currently, statins are the primary clinical treatment for hyperlipidemia. Statins lower total cholesterol and low-density lipoprotein cholesterol (LDL-C) by inhibiting 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase. However, while statins have long been the cornerstone of treatment for hypercholesterolemia and mixed hyperlipidemia, they can cause numerous adverse reactions, including gastrointestinal events, musculoskeletal pain, respiratory infections, and headaches. Furthermore, patients with a familial history of hyperlipidemia cannot achieve their lipid-lowering goals with statins. Therefore, further exploration and development of new drugs that can effectively lower hyperlipidemia are of great value.

[0004] Proprotein convertase subtilisin / kexintype 9 (PCSK9) is a serine protease mainly synthesized and secreted by the liver. After being secreted by the liver, PCSK9 binds to low-density lipoprotein receptors (LDL-R) both intracellularly and extracellularly, and degrades LDL-R via the lysosomal pathway, reducing the regeneration and utilization of LDL-R in the liver. This further promotes the accumulation of LDL-C in the blood, leading to hyperlipidemia.

[0005] Adeno-associated virus (AAV) is the simplest single-stranded DNA virus discovered to date. Compared to adenovirus, it has lower immunogenicity, but also boasts advantages such as good safety, a wide range of host cells, and long-term expression of exogenous genes in vivo. These characteristics give it unique advantages in vaccine development. Currently, rAAV vectors have been successfully used in the development of vaccines for HIV and influenza, and will further expand their application in the vaccine therapy of metabolic diseases.

[0006] AAVs used for gene therapy are all recombinant adeno-associated viruses (rAAVs), which are AAVs whose genome encoding viral proteins has been replaced by promoters and therapeutic genes. AAVs have been used in more than 300 human trials, covering thousands of patients, and are one of the most common therapeutic gene vectors currently available.

[0007] Therefore, this invention designs adeno-associated virus (AAV) as a vector and constructs a recombinant adeno-associated virus vector (rAAV) carrying an shRNA interference sequence targeting the PCSK9 gene using enzyme digestion and ligation methods. A series of in vitro experiments have demonstrated the successful construction of the vector. At the same time, using the HepG2 cell model, the protein level was demonstrated to show that the vector plays a role in silencing the PCSK9 gene and ultimately reduces the level of LDL-C in plasma, thereby improving hyperlipidemia.

[0008] This invention provides a method for constructing a recombinant adeno-associated virus vector and a shRNA interference sequence that targets and silences the PCSK9 gene, and its lipid-lowering application. It achieves a lipid-lowering effect through a gene silencing mechanism, overcomes the medication adherence problem of existing lipid-lowering drugs, and constructs an rAAV with low production cost, high transfection efficiency, and efficient and precise editing of PCSK9 in hepatocytes. At the same time, it provides a new approach for the treatment of hyperlipidemia. Summary of the Invention

[0009] Based on the principle that blocking the binding of PCSK9 to LDL-R can reduce LDL-C, this invention creatively develops a recombinant adeno-associated virus (rAAV) vector for the treatment of hyperlipidemia. This invention relates to a shRNA interference sequence that targets and silences the PCSK9 gene, a method for constructing the recombinant adeno-associated virus vector, and its lipid-lowering application. The vector carries an shRNA fragment encoding the PCSK9 gene, which can be administered in vitro to continuously silence the PCSK9 gene in the body, thereby reducing the PCSK9 content in the body, increasing the LDL-R content, and achieving the goal of reducing LDL-C content.

[0010] Accordingly, in a first aspect, the present invention provides a nucleic acid construct for gene therapy comprising an shRNA interference sequence targeting and silencing the PCSK9 gene, the shRNA interference sequence comprising a positive strand sequence and an anti strand sequence, the positive strand sequence being shown in SEQ ID NO.1 and the anti strand sequence being shown in SEQ ID NO.2.

[0011] Secondly, the present invention also provides a recombinant adeno-associated virus vector comprising the shRNA interference sequence that targets and silences the PCSK9 gene.

[0012] And the application of the recombinant adeno-associated virus vector in the preparation of treatments for hyperlipidemia.

[0013] Preferably, the recombinant adeno-associated virus vector includes various serotypes of viruses including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9.

[0014] This invention also provides a method for constructing a recombinant adeno-associated virus vector, comprising:

[0015] S1. Select the interference vector for the construction of the recombinant adeno-associated virus vector;

[0016] S2. Interference target design: Design specific vector shRNA sequences based on the target gene PCSK9 sequence;

[0017] S3. Primer annealing to form double-stranded fragments with sticky ends: The primers are oligo sequences synthesized by a biotechnology company and purified by PAGE. They are annealed according to a certain procedure to generate sticky ends.

[0018] S4. Vector digestion: Select a suitable restriction endonuclease to digest the vector, and recover the purified linearized vector by agarose gel.

[0019] S5. Interference fragment and vector ligation: The linearized vector and the target fragment are ligated according to the T4 ligation method;

[0020] S6. Transformation: Transform competent DH5a cells, spread bacterial culture on plates, and incubate for 12-16 hours;

[0021] S7. Screening and Validation: Select single clones for colony validation, and sequence positive clones that have passed colony validation.

[0022] S8. Plasmid extraction: Plasmid extraction is performed on cloned samples that have been correctly sequenced.

[0023] S9. Co-transfection: Co-transfect 293T cells with the three plasmids;

[0024] S10. Virus collection and purification: 72 h after transfection, cell pellet was collected and purified by density gradient centrifugation with iodixanol to obtain a high-titer adeno-associated virus preservation solution.

[0025] S11. Determination of viral titer: Real-time quantitative PCR is used to detect AAV genome content. Preferably, the interference vector used in step S1 is pAAV-U6-SERPINA1(human)-shRNA1-ZsGreen1 vector.

[0026] The viral vector shRNA sequence in step S2 is as follows:

[0027] Forward strand sequence:

[0028] GATCCGGCCGTAGACAACACGTGTGTATTCAAGAGATACACACGTGTTGTCTACG GCTTTTTA(SEQ ID NO.1)

[0029] Reverse strand sequence:

[0030] AGCTTAAAAAGCCGTAGACAACACGTGTGTATCTCTTGAATACACACGTGTTGTCT ACGGCCG(SEQ ID NO.2)

[0031] Among them, the sequencing result in step S7 is as follows:

[0032] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGGTTTATATATCTTGTGGAAAGGACGCGGGATCCGGCCGTAGACAACACGTGTGTATTCAAGAGATACACACGTGTTGTCTACGGCTTTTTAAGCTTGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTT

[0033] GCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGG

[0034] GGATCCGGCCGTAGACAACACGTGTGTATTCAAGAGATACACACGTGTTGTCTACGGCTTTTTA

[0035] GCCGTAGACAACACGTGTGTA, which is completely consistent with the target sequence.

[0036] The three-plasmid adeno-associated virus system used in step S9 includes the following plasmids: a vector plasmid carrying the target gene or shRNA, a pAAV-RC vector plasmid, and a pHelper vector plasmid.

[0037] In step S11, the titer of rAAV-U6-PCSK9-shRNA-ZsGreen1 was measured to be 1*10^12 vg / mL.

[0038] The beneficial effects achieved by this invention are as follows:

[0039] This invention utilizes adeno-associated virus (AAV) as a vector to carry the PCSK9-shRNA sequence. It features low cost, high titer, and ease of use and simple operation.

[0040] The adeno-associated virus vector of this invention carries an interference sequence of PCSK9. This invention reduces LDL-C levels by targeting PCSK9 and knocking down the gene, thereby playing a key regulatory role in the progression of hyperlipidemia. Attached Figure Description

[0041] Figure 1 The map of the selected interference vector pAAV-U6-SERPINA1(human)-shRNA1-ZsGreen1;

[0042] Figure 2 This is a diagram showing the enzyme digestion results of the pAAV-U6-shRNA-ZsGreen1 vector;

[0043] Figure 3 This is a comparative analysis of the sequencing results of selected positive clones that have passed colony verification.

[0044] Figure 4 This is a graph showing the results of density gradient centrifugation purification of rAAV-U6-shPCSK9 iodixanol;

[0045] Figure 5 This is a standard curve diagram for virus titer determination;

[0046] Figure 6 This is a graph showing the results of Western blot quantitative detection of PCSK9 protein expression in the liver. Detailed Implementation

[0047] The present invention will be further described in detail below with reference to the accompanying drawings, embodiments, and experimental examples. Although many materials and methods of operation used to achieve the objectives of the present invention are well known in the art, the present invention is still described in as much detail as possible herein. The following embodiments are further illustrative of the present invention, but not limiting of it. Based on the implementation examples of the present invention, any formal but not substantive equivalent modifications made according to the inventive concept should be considered within the scope of the technical solution of the present invention. All other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of the present invention.

[0048] Unless otherwise specified, the test methods or experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are obtained from conventional commercial sources or prepared by conventional methods.

[0049] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0050] The present invention demonstrates through the following examples that inhibiting PCSK9 expression in the liver via a recombinant adeno-associated virus vector can significantly downregulate PCSK9 protein levels.

[0051] To achieve the above objectives, the technical solution adopted by the present invention includes the following steps, and the specific embodiments of the present invention will be described below with reference to the accompanying drawings.

[0052] Example 1: Construction of a recombinant adeno-associated virus targeting and silencing the PCSK9 gene

[0053] 1. Design of interference vectors and interference sequences

[0054] Interference vector information: pAAV-U6-SERPINA1(human)-shRNA1-ZsGreen1, vector map see Figure 1 .

[0055] Interference sequence:

[0056] Positive chain sequence:

[0057] GATCCGGCCGTAGACAACACGTGTGTATTCAAGAGATACACACGTGTTGTCTACGGCTTTTTA(SEQID NO.1)

[0058] Anti-chain sequence:

[0059] AGCTTAAAAAGCCGTAGACAACACGTGTGTATCTCTTGAATACACACGTGTTGTCT ACGGCCG(SEQID NO.2)

[0060] The PCSK9 shRNA fragment was purchased from Sangon Biotech Co., Ltd., and the above nucleotide sequence was synthesized first.

[0061] 2. Vector digestion: Prepare a 50 μL digestion system including: 41 μL ddH2O, 5 μL 10×FastDigest, 1 μL viral vector DNA (1 μg / μL), 1.5 μL restriction endonuclease, and 1.5 μL restriction endonuclease. Add each reagent sequentially in a specific order, gently pipette and mix, and incubate at 37℃ in a metal bath for 1-2 hours. After digestion, perform agarose gel electrophoresis to recover the target fragment. Figure 2 This is a diagram of the enzyme digestion results.

[0062] 3. Ligation of interference fragments with vector: Prepare a 20 μL ligation system, including: 2 μL of annealing product, digested vector (≥50 ng), 1 μL of T4 buffer, 3 μL of ddH2O, and 1 μL of T4 ligase. Ligate the above ligation solution at 22℃ for 1-2 h, or at 16℃ overnight.

[0063] Transformation: 1) Remove one tube of DH5α E. coli competent cells from the -80℃ freezer and immediately place it on ice to thaw. Handle the competent cells gently during the aliquoting process to minimize mechanical damage. 2) After the competent cells have thawed, aliquot them into 50μL tubes. After aliquoting, add ligation product (currently 5μL) to no more than 1 / 10 of the competent cell volume and place on ice for 30 min. 3) Set the temperature of the constant temperature metal bath to 42℃ and heat for 1 min. Then immediately place it on ice for incubation. On a clean bench, add 500μL of LB liquid medium and gently invert 3-5 times. 4) Incubate at 37℃ and 180rpm with shaking for 45-60 min. 5) Spread the bacterial culture onto solid plates of the appropriate resistance, spreading evenly. Then invert the plates and incubate at 37℃ for 12-16 h.

[0064] Colony validation and sequencing: Configure a bacterial culture PCR identification system, and sequence the positive clones that have passed colony validation. Figure 3 These are sequencing verification results; the alignment results indicate that the sequencing was accurate.

[0065] Example 2: Packaging and Virus Titer Detection of Recombinant Adeno-Associated Virus

[0066] 2.1 Cell line: The packaging cell line was 293T, adeno-associated virus packaging cells, which are adherent epithelioid cells. The growth medium used was 10% FBSDMEM.

[0067] 2.2 Adeno-associated virus packaging system: a three-plasmid system, pAAV-RC, pHelper, and recombinant plasmids (carrying the target gene or shRNA).

[0068] 2.3 Adeno-Associated Virus Packaging: For transfection, AAV-293T cells were passaged into a 100 mm diameter culture dish. After passage, the dish was placed in an incubator at 37°C, 5% CO2, and 95% relative humidity until the cell density reached approximately 80-90% confluence, at which point transfection could be performed. The polyethyleneimine (PEI) transfection procedure is as follows: PEI needs to be preheated in a 37°C water bath, and the PEI transfection reagent needs to be brought to room temperature before use. It must be shaken well before use. The transfection complex components required for transfecting a 100 mm plate are as follows:

[0069]

[0070]

[0071] Six hours post-transfection, the culture medium was replaced once with fresh complete medium containing 10% fetal bovine serum (FBS). Forty-eight hours post-transfection, cells containing AAV virus particles were gently pipetted and collected into a 15 mL centrifuge tube. The tube was centrifuged at 2000 × g for 20 min to collect the cells. The culture supernatant was removed, and the cells were washed once with PBS and resuspended in AAV lysis buffer (150 mM NaCl, 50 mM Tris, pH 8.4). A 37°C water bath and liquid nitrogen were prepared. The centrifuge tube containing the cells was subjected to three freeze-thaw cycles between liquid nitrogen and the 37°C water bath. The cell lysates were then treated with 10 U of benzonase per mL of crude lysate at 37°C for 30 min. Cell debris was removed by centrifugation at 1600 × g for 5 min at room temperature and then at 16600 × g for 10 min at 4°C. The lysis supernatant containing AAV particles was collected and stored at -20°C until further analysis.

[0072] 2.4 Adeno-associated virus purification:

[0073] First, prepare iodixanol Opti Prep (60%) using 10×PBS-MK, PBS-MK, and PBS-MKN solutions. Starting from the bottom of the centrifuge tube, use a syringe to add Solution 54%, 40%, 25%, and 15% solutions sequentially from bottom to top. Add appropriate amounts of phenol red solution to the 25% and 54% solutions. Slowly add the previously pretreated sample dropwise to the top layer until the centrifuge tube is full. Centrifuge at 350,000×g, 64,000 rpm, 18℃ for 1-3 hours. Collect the sample; rAAV will be in the 40%–60% liquid level region. The results are as follows: Figure 4 As shown. The virus-containing sample was subjected to dialysis and ultrafiltration, and the purified virus was collected and stored at -80°C.

[0074] 2.5 Adenoma-associated disease titer detection:

[0075] In this embodiment, the SYBR Green method is used to detect AAV genome content, thereby determining AAV titer. The standard curve used to calculate viral titer is as follows: Figure 5 As shown. The viral titers calculated from the standard curve are as follows:

[0076] rAAV-U6-PCSK9-shRNA-ZsGreen1 1.0*10^12vg / mL

[0077] Implementation Example 3: In vitro characterization and transduction study of PCSK9-shRNA recombinant adeno-associated virus preparation

[0078] 3.1 Western blot

[0079] Western blot quantitative detection of hepatic PCSK9 protein expression, such as Figure 6 rAAV-U6-PCSK9-shRNA-ZsGreen1 can be efficiently expressed in liver tissue and significantly reduce PCSK9 protein levels in liver tissue.

Claims

1. A shRNA interference sequence targeting and silencing the PCSK9 gene, characterized in that: The shRNA interference sequence includes a positive strand sequence and an anti strand sequence, the positive strand sequence being shown in SEQ ID NO.1 and the anti strand sequence being shown in SEQ ID NO.

2.

2. The application of the shRNA interference sequence for targeting and silencing the PCSK9 gene as described in claim 1 in the preparation of a treatment for hyperlipidemia.

3. A recombinant adeno-associated virus vector comprising the shRNA interference sequence of claim 1 that targets and silences the PCSK9 gene.

4. The recombinant adeno-associated virus vector according to claim 3, characterized in that: The recombinant adeno-associated virus vector includes various serotypes of viruses, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9.

5. A method for constructing a recombinant adeno-associated virus vector as described in claim 3, characterized in that, include: S1. Select the interference vector for the construction of the recombinant adeno-associated virus vector; S2. Design the interference target; S3. Anneal the primers to form a double-stranded fragment with sticky ends; S4. Digest the vector with enzymes; S5. Ligate the interference fragment to the vector; S6. Transformation; S7. Screening and validation; S8. Plasmid extraction; S9. Co-transfection; S10. Virus collection and purification; S11. Determination of virus titer.

Images