Primer probe combination based on food-borne pathogenic bacterium detection and kit thereof

Abstract

The invention discloses a primer probe combination based on food-borne pathogenic bacterium detection and a kit thereof. The detection sensitivity is high, the specificity is good, multiple food-borne pathogenic bacteria can be detected at the same time at a time, the quantitative potential is achieved, a basis is provided for food-borne disease diagnosis, and the method can play an important role in the fields of food safety, quality control and food-borne pathogen disease prevention and diagnosis.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to primer-probe combinations and kits for detecting foodborne pathogens. Background Technology

[0002] In recent years, the incidence of foodborne diseases has been increasing year by year. Foodborne pathogens are causing a large number of diseases and have a significant impact on human health and the economy. They have become a major public health problem worldwide, and bacterial pathogens are the most common cause of disease.

[0003] Common foodborne pathogens include Salmonella, Staphylococcus aureus, Listeria monocytogenes, diarrhea-causing Escherichia coli, Vibrio parahaemolyticus, and Cronobacter spp. (Cronobacter sakazakii). Timely and accurate detection of foodborne pathogens allows for early identification of harmful microorganisms, providing a crucial advantage in developing effective control measures and minimizing their harmfulness. Efficient detection technologies hold significant practical importance in ensuring food safety and protecting consumer health.

[0004] For a long time, food microbiological testing has followed traditional methods, including enrichment culture, isolation and purification, and morphological, biochemical, and serological identification. While these traditional methods offer high accuracy and sensitivity, they suffer from cumbersome procedures, long testing times, and low efficiency. This is particularly problematic for certain food categories with short shelf lives, where traditional methods severely impact and restrict market sales and distribution. Furthermore, traditional methods cannot detect microorganisms that are difficult or impossible to culture. To overcome the limitations of traditional culture-based methods, immunological detection methods have been developed for the detection of foodborne pathogens. These methods utilize the fundamental principle of specific binding between antigens and antibodies for microbial detection. Different microorganisms have specific antigens, which can be detected using specific monoclonal antibodies. Immunological detection methods mainly include enzyme-linked immunosorbent assay (ELISA), immunochromatography (ICA), immunomagnetic separation (IMS), and immunofluorescence. These immunological detection techniques have shown significant advantages in the field of point-of-care testing for foodborne pathogens due to their simplicity, speed, and convenience. However, the sensitivity of immunological detection methods is not yet high enough, sometimes failing to meet the requirements for detecting foodborne pathogens, and the detection specificity depends on antibody specificity, making them susceptible to interference from other substances in food.

[0005] In summary, developing, applying, and promoting more accurate and efficient methods for detecting food microorganisms is one of the important goals of food safety testing. Nucleic acid detection technologies, primarily based on PCR (polymerase chain reaction), have become powerful tools for the rapid detection of foodborne pathogens due to their high sensitivity and specificity. However, some shortcomings remain in practical applications. For example, most nucleic acid detection methods for foodborne pathogens can only detect one pathogen per tube. Screening for foodborne pathogens requires multiple tubes for different pathogens, leading to cumbersome operations, low detection efficiency, and increased costs. Although gene chips or gene sequencing can achieve parallel detection of multiple pathogens, these methods require opening the PCR product tubes, which can easily lead to cross-contamination of amplified products. Furthermore, the detection operations are cumbersome and time-consuming, making them unsuitable for routine testing laboratories. Developing single-tube closed-tube multiplex nucleic acid detection methods for foodborne pathogens has broad application prospects for food pathogen screening.

[0006] Although current PCR multiplex amplification technology can amplify dozens of targets in a single tube, distinguishing and detecting the amplification products of each target within a single tube without opening the tube remains a challenge. Melting curve analysis is an effective method for distinguishing and detecting multiplex amplification products within a single tube. It utilizes the difference in melting temperature of amplification products of different targets. After amplification, the fluorescence of the nucleic acid saturated intercalation dye intercalating into double-stranded DNA is measured at different temperatures to plot the melting curve of the amplification products. The shape of the melting curve is then analyzed to determine which target is present in the product. Although this method requires only one fluorescence channel, the lack of sequence specificity of DNA intercalation dyes leads to non-specific amplification products (such as primer dimers) that often appear during multiplex amplification, interfering with the results analysis and making it difficult to distinguish and detect more than ten targets. To improve specificity, some studies have designed target-specific fluorescently labeled probes, utilizing the difference in melting temperature of the probes with and without the target to differentiate multiplex amplification products. While this improves specificity due to the correlation between the fluorescent probes and the target sequence, it also makes probe design and reaction condition optimization difficult, especially when the target sequence difference is only a single base, where the specificity of probe hybridization alone is insufficient for differentiation. Furthermore, the lack of universality of fluorescent probes makes the optimization of new target detection reagents costly, time-consuming, and inconvenient. An ideal multiplex detection method for foodborne pathogens should be able to identify different targets with high sensitivity and specificity in a single-tube closed-tube setting, and the fluorescently labeled probes and reaction conditions should be universal, thus shortening the development cycle and reducing detection costs. The reaction should be performed in routine quantitative PCR without special equipment, making it suitable for screening foodborne pathogens in routine testing institutions. Summary of the Invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide a primer-probe combination for the detection of foodborne pathogens.

[0008] Another technical problem that this invention aims to solve is to provide a single-tube multiplex detection kit for foodborne pathogens.

[0009] Technical solution: In order to solve the above technical problems, the present invention provides a primer and probe combination for the detection of foodborne pathogens, wherein the primer and probe combination includes at least one or more of the following combinations;

[0010] The upstream primer shown in SEQ ID NO.1, the downstream primer shown in SEQ ID NO.2, the downstream probe shown in SEQ ID NO.3, and the hairpin probe shown in SEQ ID NO.4;

[0011] The upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.6, the downstream probe shown in SEQ ID NO.7 and the hairpin probe shown in SEQ ID NO.8;

[0012] The upstream primer shown in SEQ ID NO. 9 and the downstream primer shown in SEQ ID NO. 10, the downstream probe shown in SEQ ID NO. 11 and the hairpin probe shown in SEQ ID NO. 12;

[0013] The upstream primer shown in SEQ ID NO.13 and the downstream primer shown in SEQ ID NO.14, the downstream probe shown in SEQ ID NO.15 and the hairpin probe shown in SEQ ID NO.16;

[0014] The upstream primer shown in SEQ ID NO.17 and the downstream primer shown in SEQ ID NO.18, the downstream probe shown in SEQ ID NO.19 and the hairpin probe shown in SEQ ID NO.20;

[0015] The upstream primer shown in SEQ ID NO. 21 and the downstream primer shown in SEQ ID NO. 22, the downstream probe shown in SEQ ID NO. 23 and the hairpin probe shown in SEQ ID NO. 24;

[0016] The upstream primer shown in SEQ ID NO.25 and the downstream primer shown in SEQ ID NO.26, the downstream probe shown in SEQ ID NO.27 and the hairpin probe shown in SEQ ID NO.28;

[0017] The upstream primer shown in SEQ ID NO. 29 and the downstream primer shown in SEQ ID NO. 30, the downstream probe shown in SEQ ID NO. 31 and the hairpin probe shown in SEQ ID NO. 32;

[0018] The upstream primer shown in SEQ ID NO. 33 and the downstream primer shown in SEQ ID NO. 34, the downstream probe shown in SEQ ID NO. 35 and the hairpin probe shown in SEQ ID NO. 36;

[0019] The upstream primer shown in SEQ ID NO. 37 and the downstream primer shown in SEQ ID NO. 38, the downstream probe shown in SEQ ID NO. 39 and the hairpin probe shown in SEQ ID NO. 40;

[0020] The upstream primer shown in SEQ ID NO.41 and the downstream primer shown in SEQ ID NO.42, the downstream probe shown in SEQ ID NO.43 and the hairpin probe shown in SEQ ID NO.44;

[0021] The upstream primer shown in SEQ ID NO.45 and the downstream primer shown in SEQ ID NO.46, the downstream probe shown in SEQ ID NO.47 and the hairpin probe shown in SEQ ID NO.48;

[0022] The upstream primer shown in SEQ ID NO.49 and the downstream primer shown in SEQ ID NO.50, the downstream probe shown in SEQ ID NO.51 and the hairpin probe shown in SEQ ID NO.52;

[0023] The upstream primer shown in SEQ ID NO. 53 and the downstream primer shown in SEQ ID NO. 54, the downstream probe shown in SEQ ID NO. 55 and the hairpin probe shown in SEQ ID NO. 56;

[0024] The upstream primer shown in SEQ ID NO. 57 and the downstream primer shown in SEQ ID NO. 58, the downstream probe shown in SEQ ID NO. 59 and the hairpin probe shown in SEQ ID NO. 60;

[0025] The upstream primer as shown in SEQ ID NO. 61 and the downstream primer as shown in SEQ ID NO. 62, the downstream probe as shown in SEQ ID NO. 63 and the hairpin probe as shown in SEQ ID NO. 64.

[0026] The downstream probe is connected to a Flap fragment and phosphorylated at its 3' end. The hairpin probe is labeled with a fluorescent group at its 5' end and a blocking group at its 3' end. Preferably, the first base at the 5' end of the hairpin probe is labeled with a fluorescent group, the fourth base at the 5' end is labeled with a quenching group, and the 3' end is labeled with a blocking group.

[0027] The fluorescent reporter probe contains fluorescent groups including various commonly used fluorescent markers, preferably FAM, VIC, ROX, TXR, CY3 or CY5; the quenching group includes various commonly used quenching agents, preferably BHQ-1, BHQ-2, DABCYL or ECLIPE; and the blocking group includes various commonly used blocking groups, preferably C7-NH2 or C6-Spacer.

[0028] The concentrations of the upstream and downstream primers are both 0.1–0.5 μM, and the concentrations of the downstream probe and hairpin probe are both 0.05–0.5 μM.

[0029] The present invention also includes a single-tube multiplex detection kit for foodborne pathogens, the detection kit comprising the primer-probe combination described above.

[0030] The test kit also includes PCR Buffer, dNTPs, hot-start DNA polymerase, Flap endonuclease 1, negative control, and positive control.

[0031] The negative control of this invention is distilled water. The positive control of this invention includes plasmids containing the artificial sequences shown in SEQ ID NO. 65 to SEQ ID NO. 80. Preferably, the positive control includes inserting the artificial sequences shown in SEQ ID NO. 65 to SEQ ID NO. 80 into the EcoRI / HindIII restriction sites of the pUC57 plasmid.

[0032] The PCR Buffer of the present invention is a PCR reaction buffer with pH 8.5, specifically containing 300mM Tris-HCl, 75mM MgCl2 and 0.5% Tween-20.

[0033] The concentration of the dNTPs is 0.2 mM.

[0034] The concentration of the hot-start DNA polymerase is 0.15–1.5 U.

[0035] The concentration of Flap endonuclease 1 is 4000 U.

[0036] The reaction procedure for the single-tube multiplex detection of foodborne pathogens is as follows:

[0037] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0038] b) Amplification cycle: 60 cycles, each cycle consisting of denaturation at 94℃ for 15 seconds and annealing extension at 68-70℃ for 40 seconds;

[0039] c) Melting curve analysis: Subsequently, the temperature was reduced from 68-70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a fluorescence PCR instrument, and the rate of fluorescence signal change was analyzed to obtain a rate spectrum for target differentiation.

[0040] The primer-probe combination or kit described in this invention can target one or more of 16 foodborne pathogens.

[0041] The 16 foodborne pathogens described in this invention include Yersinia enterocolitis, Campylobacter jejuni, Listeria monocytogenes, Vibrio cholerae, Salmonella, Staphylococcus aureus, Bacillus anthrax, Aeromonas hydrophila, Clostridium perfringens, Escherichia coli O157:H7, Vibrio parahaemolyticus, Clostridium botulinum type A, Enterobacter sakazalii, Klebsiella pneumoniae, and Shigella flexneri. Flexneri and Pseudomonas cocovenenans subsp. Farino fermentans.

[0042] Specifically, the primer-probe combination of the present invention is as follows:

[0043] upstream primer F for the Yersinia enterocolitica ail gene:

[0044] GGCAGTAATAAGTTTGGTCATGGTGATGTTGA SEQ ID NO.1;

[0045] Downstream primer R for the Yersinia enterocolitica ail gene:

[0046] CCATAAAGGCTAACATATTCGTTGATGCGGAA SEQ ID NO.2;

[0047] Downstream probe of the Yersinia enterocolitica ail gene:

[0048] CGACGACCGAGGCAAGATGGCCCCATTGTTACTGAATAG SEQ ID NO.3;

[0049] Yersinia enterocolitica hairpin probe for the AIL gene: FAM-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGAGCCTCGGTCGTCG-C7-NH2 SEQ ID NO.4;

[0050] Upstream primer F for Campylobacter jejuni P3251_05760 gene: AGGTACGCCTAAACCTATAGCTCCTTCTCSEQ ID NO.5;

[0051] Downstream primer R for Campylobacter jejuni P3251_05760 gene: TGATACCTTAAGTGCAGCCTGTGAAAGAATSEQ ID NO.6;

[0052] Downstream probe of Campylobacter jejuni P3251_05760 gene: GACCGACAGCCACCTTGCTCATCTTTAGGATSEQ ID NO.7;

[0053] Hairpin probe for Campylobacter jejuni P3251_05760 gene: FAM-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGATGGCTGTCGGTC-C7-NH2 SEQ ID NO.8;

[0054] Upstream primer F for the hly gene of Listeria monocytogenes: ACGGAGGTTCCGCAAAAGATGAAGT SEQ ID NO. 9;

[0055] Listeria monocytogenes hly gene downstream primer R: TTTCAAAATATCGCGTAAGTCTCCGAGGTT SEQ ID NO.10;

[0056] Downstream probe of the hly gene in Listeria monocytogenes: ACCAGAACATGCCGTCGATGATTTG SEQ ID NO.11;

[0057] Listeria monocytogenes hly gene hairpin probe: FAM-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGATGTTGCTGGT-C7-NH2 SEQ ID NO.12;

[0058] Upstream primer F for the OmpW gene of Vibrio cholerae: GGCTTTGATTATATGCTCAATGATAGCTGGTTCC SEQ ID NO.13;

[0059] The downstream primer R for the OmpW gene of Vibrio cholerae is: GGTTGCCGTTGTTTCAATATTGGCATACC SEQ ID NO.14;

[0060] Downstream probe of Vibrio cholerae OmpW gene: GAACAGACGACACACAGAAGCGTTGAGGAACCAG SEQ ID NO.15;

[0061] Hairpin probe for Vibrio cholerae OmpW gene: FAM-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGATCGTCTGTTC-C7-NH2 SEQ ID NO.16;

[0062] Salmonella invA gene upstream primer F: GGCGCCAAGAGAAAAAGATGTCATTAACCTT SEQ ID NO.17;

[0063] Salmonella invA gene downstream primer R: CGATTTATGACAAATATAACGCGCCATTGCT SEQ ID NO.18;

[0064] Salmonella invA gene downstream probe: GCCGAGGCAGGCGTGTGGAGCATATTCGTGGAGCAAT SEQ ID NO.19;

[0065] Salmonella invA gene hairpin probe: VIC-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGACGCCTGCCTCGGC-C7-NH2 SEQ ID NO.20;

[0066] upstream primer F for the Staphylococcus aureus E3S67_02300 gene: AGGTAAGACAGAAATGATGTTTCAAGGCATTCAA SEQ ID NO.21;

[0067] The downstream primer R of the Staphylococcus aureus E3S67_02300 gene is: TCTACACGCGGTGACACAATAGCTATATTATCTC (SEQ ID NO.22).

[0068] Downstream probe of Staphylococcus aureus E3S67_02300 gene: CGCAGGAGGAATATGCAAGACGACAGG SEQID NO.23;

[0069] Hairpin probe for the Staphylococcus aureus E3S67_02300 gene: VIC-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGATCCTCCTGCGTG-C7-NH2 SEQ ID NO.24;

[0070] Upstream primer F for the Bacillus anthracis FOC03_12560 gene: GCGGATTTGTCACAAATGAGCAAAGGTT SEQ ID NO.25;

[0071] Downstream primer R for Bacillus anthracis FOC03_12560 gene: TGGTGCATTACATACCCCAAAGGTACAC SEQ ID NO.26;

[0072] Downstream probe of Bacillus anthracis FOC03_12560 gene: CAGGACCAGCACCCACAGCGGCTAAAGAGACC SEQID NO.27;

[0073] Hairpin probe for Bacillus anthracis FOC03_12560 gene: VIC-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGATGCTGGTCCTG-C7-NH2 SEQ ID NO.28;

[0074] Upstream primer F for the AHaerA gene of Aeromonas hydrophila: CGCTCCAAGATCCCGGTGAAGATC SEQ ID NO.29;

[0075] Downstream primer R for Aeromonas hydrophila AHaerA gene: GGCCTTGAATTCATAGGGATAGGAGATGTCA SEQID NO.30;

[0076] Downstream probe of Aeromonas hydrophila AHaerA gene: CACGACGAACCGAGCTCTACAAGGCTGACATCTCCSEQ ID NO.31;

[0077] Hairpin probe for Aeromonas hydrophila AHaerA gene: VIC-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGAGTTCGTCGTG-C7-NH2 SEQ ID NO.32;

[0078] upstream primer F for the cpa gene of Clostridium perfringens: AGATTTGTAAGGCGCTTATTTGTGCCG SEQ ID NO.33;

[0079] Downstream primer R for the Clostridium perfringens cpa gene: ACTTTAGTTGATGCCCCAGCCCA SEQ ID NO.34;

[0080] Downstream probe of Clostridium perfringens cpa gene: CCAGAAGACAATAGGCTAGTTGCTAGCGCGG SEQ ID NO.35;

[0081] Clostridium perfringens CPA gene hairpin probe: VIC-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGATGTCTTCTGG-C7-NH2 SEQ ID NO.36;

[0082] upstream primer F for the *E. coli* O157:H7 rfbE gene:

[0083] GGAACAAAACCATGTGCAATATGCAACTACTG SEQ ID NO.37;

[0084] downstream primer R of E. coli O157:H7 rfbE gene:

[0085] CCTTCCGATATACCTAACGCTAACAAAGCTAAATG SEQ ID NO.38;

[0086] Downstream probe of E. coli O157:H7 rfbE gene:

[0087] CAGGCGACGGACGGTAAGTAATGGAACGGTTGCTCTTCATT SEQ ID NO.39;

[0088] Escherichia coli O157:H7 rfbE gene hairpin probe: TXR-TCTT(BHQ2)AGCCGGTTTTCCGGCTAAGACGTCCGTCGCCTG-C6-Spacer SEQ ID NO.40;

[0089] Upstream primer F for the gyrB gene of Vibrio parahaemolyticus: ACTTACCGTCATGGTGAGCCTGAA SEQ ID NO.41;

[0090] The downstream primer R for the gyrB gene of Vibrio parahaemolyticus is: ACCGGTTTTATCCGTATCACCCACA SEQ ID NO.42;

[0091] Downstream probe of Vibrio parahaemolyticus gyrB gene: GCAGGACACGGAAGCGCCTCTAGCG SEQ ID NO.43;

[0092] Hairpin probe for Vibrio parahaemolyticus gyrB gene: TXR-TCTT(BHQ2)AGCCGGTTTTCCGGCTAAGATCCGTGTCCTGC-C6-Spacer SEQ ID NO.44;

[0093] upstream primer F for the Clostridium botulinum LarB gene: TGGCTTATCTACAAGACCGCCTACAAC SEQ ID NO.45;

[0094] Clostridium botulinum LarB gene downstream primer R: AGTTATTGTGGTAGCAGCAGGAATGGA SEQ ID NO.46;

[0095] Clostridium botulinum LarB gene downstream probe: CCACGACGGACGCTGGCCAAAGCCCCT SEQ ID NO.47;

[0096] Clostridium botulinum LarB gene hairpin probe: TXR-TCTT(BHQ2)AGCCGGTTTTCCGGCTAAGATCCGTCGTGG-C6-Spacer SEQ ID NO.48;

[0097] Upstream primer F for the 23S ribosomal RNA gene of Enterobacter sakazakii: TCAAACTCGCAGCACGAAGACTTCTSEQ ID NO.49;

[0098] The downstream primer R for the Enterobacter sakazakii 23S ribosomal RNA gene is: CACCGTGTACGCTTGTTCGCT SEQ ID NO. 50;

[0099] Downstream probe of Cronobacter sakazakii 23S ribosomal RNA gene: ACAGCCACAGTTCGGGTTGTGAGGTTAAGCGAA SEQ ID NO.51;

[0100] Enterobacter sakazakii 23S ribosomal RNA gene hairpin probe: TXR-TCTT(BHQ2)AGCCGGTTTTCCGGCTAAGACTGTGGCTGT-C6-Spacer SEQ ID NO.52;

[0101] upstream primer F for the sstT gene of Klebsiella pneumoniae: GCCTGCCATATTGATGGTCGCC SEQ ID NO.53;

[0102] The downstream primer R for the Klebsiella pneumoniae sstT gene is: GCGGAATTCTGGATCGCGACACC SEQ ID NO.54;

[0103] Klebsiella pneumoniae sstT gene downstream probe: CGGAGAGCCGCGGAGACCCCAGTGGAATAGAGACCGAATAG SEQ ID NO.55;

[0104] Klebsiella pneumoniae sstT gene hairpin probe: Cy5-TCTT(BHQ2)AGCCGGTTTTCCGGCTAAGATCTCCGCGGCTCTCCG-C6-Spacer SEQ ID NO.56;

[0105] Upstream primer F for the ybhA gene of Shigella flexneri: CCCAGTTCATGTTCGACATGCTTACCA SEQ ID NO. 57;

[0106] The downstream primer R for the ybhA gene of Shigella flexneri: GCCCTGACGCACGATGACA SEQ ID NO.58;

[0107] Downstream probe of the ybhA gene in Shigella flexneri: CAGAGCACGCAGAATGCCGCAATTGCAGCA SEQ ID NO. 59;

[0108] Shigella flexneri ybhA gene hairpin probe: Cy5-TCTT(BHQ2)AGCCGGTTTTCCGGCTAAGATCTGCGTGCTCTG-C6-Spacer SEQ ID NO.60;

[0109] Upstream primer F for the *Pseudomonas cocovenenans* tRNA-Ala gene: GAATCCAACCAGACCCACCAATTGTC SEQ ID NO. 61;

[0110] Downstream primer R for the *Pseudomonas cocovenenans* tRNA-Ala gene: GCCCCCATACAGAGACGTCTCA SEQ ID NO. 62;

[0111] Downstream probe of *Pseudomonas cocovenenans* tRNA-Ala gene: CCGGACACGACTGGCGGTAGAAACCTGAGACGTSEQ ID NO.63;

[0112] Hairpin probe for the tRNA-Ala gene of *Pseudomonas cocovenenans*: Cy5-TCTT(BHQ2)AGCCGGTTTTCCGGCTAAGATCGTGTCCGG-C6-Spacer SEQ ID NO.64.

[0113] The kit described in this invention comprises: PCR reaction buffer 1×; dNTPs 0.2mM; upstream primer 0.1–0.5μM; downstream primer 0.1–0.5μM; Taq enzyme 0.15–1.5U; downstream probe 0.05–0.5μM; hairpin probe 0.1–0.4μM; FEN 14000U; template ≥10 1 copies / μL; total volume 20μL.

[0114] This invention first designs upstream primer F and downstream primer R for different target amplifications, performing multiplex PCR amplification in a single tube to obtain the amplification products of the target amplifications. The multiplex amplification reaction system also contains multiple pairs of upstream and downstream probes designed for different target amplifications, as well as hairpin probes with different fluorescent labels. The upstream and downstream probes can hybridize with their respective targets, forming a triple-base overlap structure (called the invasion structure) where the 3' end of the upstream probe invades the hybridization region of the downstream probe. The FEN1 enzyme can specifically recognize this structure and cleave the 5' Flap fragment of the downstream probe. This process is the first step of the invader reaction. To reduce the complexity of the system, this invention uses the upstream primer F as the upstream probe UP. In the first step of the invader reaction, the Flap fragment is independent of the target sequence and can be artificially designed, with different targets corresponding to different Flap fragment sequences. Furthermore, each Flap fragment, after being cleaved, can hybridize with a corresponding hairpin probe labeled with a fluorescent group and a quencher group, forming an invasion structure again. This triggers the FEN1 enzyme to cleave the fluorescent labeling group of the hairpin probe, producing fluorescence—this is the second invader reaction. When designing Flap fragments, the optimal annealing temperatures for hybridization between Flap fragments corresponding to different targets and hairpin probes can be designed to be different, thus ensuring that the optimal reaction temperature for FEN1 enzyme cleavage of hairpin probes corresponding to different targets varies.

[0115] The mechanism of the present invention is as follows Figure 1 and Figure 2As shown, the 16 targets of this invention include Yersinia enterocolitica, Campylobacter jejuni, Listeria monocytogenes, Vibrio cholerae, Salmonella, Staphylococcus aureus, Bacillus anthrax, Aeromonas hydrophila, Clostridium perfringens, Escherichia coli O157:H7, Vibrio parahaemolyticus, Clostridium botulinum type A, and Enterobacter sakazakii. This invention categorizes 16 targets into amplification stage targets and cooling stage targets, including *Sakazalii*, *Klebsiella pneumoniae*, *Shigella flexneri*, and *Pseudomonas cocovenenans* subsp. *farinofermentans*. Amplification stage targets: By designing the Tm values ​​of the Flap fragment and downstream probe to be close to the annealing temperature of PCR, the first and second invader reactions occur during the amplification stage. Ultimately, only the fluorescence signal needs to be collected during the amplification stage. Cooling stage targets: The downstream probe temperature remains close to the annealing temperature. The Tm value of the Flap fragment is designed to correspond to the temperature of the cooling stage, so only the first invader reaction occurs during the amplification stage. To better distinguish different targets, the Tm values ​​corresponding to the Flap fragments of different targets differ by 4-5℃. Figure 2 As shown, this invention obtains for the first time the fluorescence channels and theoretical characteristic temperature values ​​corresponding to 16 types of targets. Then, based on the different Tm values ​​corresponding to each target and the differences in the corresponding channels, different Tm values ​​are designed for them. Finally, during the cooling stage, the fluorescence signal of the target only needs to be collected during the cooling stage. At the same time, the fluorescence rate peak of the target during the cooling stage is obtained by differentiating the fluorescence signal with respect to temperature. The temperature corresponding to the peak value is called the characteristic temperature of the target. Different targets can be distinguished based on different characteristic temperatures.

[0116] Beneficial Effects: Compared with existing technologies, this invention has the following advantages: This invention innovatively proposes a new method for highly specific identification and detection of multiplex PCR products by measuring the reaction temperature difference corresponding to the maximum reaction rate when the Flap endonuclease FEN1 enzyme cleaves the fluorescent probe triggered by the target nucleic acid. It can achieve simultaneous detection in four fluorescent channels (FAM, TXR, VIC, Cy5) using a Q-PCR instrument under single-tube closed conditions. This invention has high detection sensitivity and good specificity, and can simultaneously detect 16 foodborne pathogens with quantitative potential, providing a basis for the diagnosis of foodborne diseases. It can play an important role in the fields of food safety, quality control, and the prevention and diagnosis of foodborne pathogen diseases. Attached Figure Description

[0117] Figure 1 This is a schematic diagram of the present invention;

[0118] Figure 2 A diagram illustrating the distribution location and characteristic temperature of each target in the fluorescence channel;

[0119] Figure 3 A single-weight result for Yersinia enterocolitica;

[0120] Figure 4 This is a single-weight result image of Campylobacter jejuni;

[0121] Figure 5 The images show the results of the four-way FAM channel; the top image shows the results of the amplification stage, and the bottom image shows the results of the cooling stage.

[0122] Figure 6 The results for the VIC channel are shown in five diagrams; the top diagram shows the results during the amplification stage, and the bottom diagram shows the results during the cooling stage.

[0123] Figure 7 The images show the results of the TXR channel in four quadrupoles; the top image shows the results of the amplification stage, and the bottom image shows the results of the cooling stage.

[0124] Figure 8 The images show the triplet results for the Cy5 channel; the top image shows the results during the amplification stage, and the bottom image shows the results during the cooling stage.

[0125] Figure 9 The above image shows the FAM results in the dual-channel 9-fold FAM and VIC setup; the top image shows the results during the amplification stage, and the bottom image shows the results during the cooling stage.

[0126] Figure 10 The image shows the VIC results in the FAM and VIC dual-channel 9-fold test; the top image shows the results during the amplification stage, and the bottom image shows the results during the cooling stage.

[0127] Figure 11The image shows the FAM results for the three channels (FAM, TXR, and Cy5) in 11 layers; the top image shows the results during the amplification stage, and the bottom image shows the results during the cooling stage.

[0128] Figure 12 The image shows the VIC results for the three channels (FAM, TXR, and Cy5) in 11 layers; the top image shows the results during the amplification stage, and the bottom image shows the results during the cooling stage.

[0129] Figure 13 The graph shows the Cy5 result in the three channels (FAM, TXR, and Cy5) in 11 layers; the top graph shows the result during the amplification stage, and the bottom graph shows the result during the cooling stage.

[0130] Figure 14 The above image shows the FAM results for the four channels (FAM, VIC, TXR, and Cy5) in a 16-fold configuration; the top image shows the results during the amplification stage, and the bottom image shows the results during the cooling stage.

[0131] Figure 15 The image shows the results of the VIC function in the four channels (FAM, VIC, TXR, and Cy5) in a 16-fold array; the top image shows the results of the amplification stage, and the bottom image shows the results of the cooling stage.

[0132] Figure 16 The image shows the TXR results for the four channels (FAM, VIC, TXR, and Cy5) in a 16-fold array; the top image shows the results during the amplification stage, and the bottom image shows the results during the cooling stage.

[0133] Figure 17 The image shows the Cy5 result in the four channels (FAM, VIC, TXR, and Cy5) in 16-fold arrays; the top image shows the result during the amplification stage, and the bottom image shows the result during the cooling stage.

[0134] Figure 18 The graph shows the sensitivity results of the target Campylobacter jejuni at 59℃ during the cooling phase.

[0135] Figure 19 The graph shows the sensitivity results of the target *Burkholderia cocovenenans* at 54℃ during the cooling phase.

[0136] Figure 20 The graph shows the sensitivity results of Listeria monocytogenes at 49℃ during the cooling phase.

[0137] Figure 21 The graph shows the sensitivity results of the target Vibrio cholerae at 45℃ during the cooling phase.

[0138] Figure 22 This is a graph showing the quantitative results of the target Escherichia coli O157:H7 during the amplification phase.

[0139] Figure 23 Linear graph for quantitative analysis of the target Escherichia coli O157:H7 during the amplification phase. Detailed Implementation

[0140] The following embodiments, in conjunction with the accompanying drawings, further illustrate the present invention. These embodiments are specific examples and are illustrative only, not representing all possibilities of the invention. The invention is not limited to the materials, reaction conditions, or parameters mentioned in these embodiments. Anyone experienced in the relevant field can implement the β-thalassemia single-tube multiplex gene detection described in this invention using other similar materials or reaction conditions, without departing from the basic concepts described in this invention. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the invention, and should not be construed as limiting the invention.

[0141] The experimental materials, reagents, reaction systems, and specific experimental procedures used in the embodiments of this invention are as follows:

[0142] 1. Experimental materials and reagents:

[0143] Real-time fluorescence PCR system (Q2000B, Langji Scientific Instruments Co., Ltd.), micro spectrophotometer (Nano-100, Hangzhou Aosheng Instrument Co., Ltd.), pH meter (Shanghai Bante Instrument Co., Ltd.). The reagents used in the experiment and their sources are as follows: PCR reaction buffer was prepared in the laboratory, and its components were: 300mM NaCl, 100mM Tris-HCl, 75mM MgCl2 and 0.5% Tween-20; chemical reagents (Tween-20, NaCl, MgCl2·6H2O) were purchased from Sinopharm Chemical Reagent Co., Ltd.; molecular biology reagents included Taq Hot Start DNA polymerase (TaKaRa R007A) and dNTPs (TaKaRa SD0304) from TaKaRa; FEN1 was expressed and purified in the laboratory (Establishment of expression and activity assay method of recombinant Flap endonuclease 1, Sheng Nan et al., Journal of Biotechnology); distilled water used in the experiment was Watson's product; the plasmid template of the present invention includes the insertion of the artificial sequences shown in SEQ ID NO.65 to SEQ ID NO.80 into the EcoRI / HindIII restriction sites of the pUC57 plasmid. All oligonucleotide probes and plasmid templates of this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd., wherein the powdered plasmid templates were diluted to 10 μL with distilled water. 7 Save after copying / microliter.

[0144] 2. The final concentrations of each component in the system are as follows:

[0145]

[0146] 3. Experimental Procedure

[0147] 1) Reagent preparation: Based on the number of target samples (n), take out the corresponding number (n+1) PCR eight-tube strips containing the amplification system. Thaw at room temperature and then briefly centrifuge; transfer the eight-tube strips to the sample processing area.

[0148] 2) Template dilution procedure: Take 10 from the -20℃ freezer 7 The template, at a concentration of 10 copies / µL, is melted, vortexed, and then diluted 10-fold with distilled water in the template dilution area until the final template concentration is 10-100 copies / µL.

[0149] 3) Add samples in the sample processing area: Use a pipette tip with a filter to add 1 μL each of the processed template and the negative control water to the PCR reaction tube containing the PCR reaction solution. Then add three drops of mineral oil to the surface of the system, cap the tube, centrifuge for a few seconds, and then transfer it to the amplification detection area.

[0150] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0151] 5) Loop parameter settings:

[0152] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0153] b) Amplification cycle: 60 cycles, each cycle consisting of denaturation at 94℃ for 15 seconds and annealing extension at 68-70℃ for 40 seconds;

[0154] c) Melting curve analysis: Subsequently, the temperature was reduced from 68-70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data were collected on a Q-PCR instrument, and the rate of fluorescence signal change was analyzed to obtain a rate spectrum for target differentiation.

[0155] 6) The negative control was distilled water: The amplification system was the same as the positive control, and the sample added was distilled water, and the result was negative; the positive control was to insert the synthetic artificial sequence shown in SEQ ID NO.65~SEQ ID NO.80 into the EcoRI / HindIII restriction site of the pUC57 plasmid, and the result was positive.

[0156] Among them, the synthetic sequence of Yersinia enterocolitica is SEQ ID NO. 65:

[0157]

[0158] Artificially synthesized sequence of Campylobacter jejuni SEQ ID NO. 66:

[0159] Synthetic sequence of Listeria monocytogenes SEQ ID NO. 67:

[0160]

[0161] Synthetic sequence of Vibrio cholerae SEQ ID NO.68:

[0162] Artificially synthesized Salmonella sequence SEQ ID NO.69:

[0163] Synthetic sequence of Staphylococcus aureus SEQ ID NO.70:

[0164] Synthetic sequence of Bacillus anthracis SEQ ID NO.71:

[0165] Synthetic sequence of Aeromonas hydrophila SEQ ID NO.72:

[0166] Synthetic sequence of Clostridium perfringens SEQ ID NO.73:

[0167] Synthetic sequence of Escherichia coli O157:H7 SEQ ID NO.74:

[0168] Synthetic sequence of Vibrio parahaemolyticus SEQ ID NO.75:

[0169] Synthetic sequence of Clostridium botulinum SEQ ID NO.76:

[0170]

[0171] Enterobacter sakazakii artificial sequence SEQ ID NO.77:

[0172] Synthetic sequence of Klebsiella pneumoniae SEQ ID NO.78:

[0173] Synthetic sequence of Shigella flexneri SEQ ID NO.79:

[0174] Synthetic sequence of *Pseudomonas cocovenenans* SEQ ID NO. 80:

[0175] Example 1

[0176] The detection of a single target in a single channel, taking Yersinia enterocolitica in the amplification phase of the FAM channel and Campylobacter jejuni in the cooling phase as examples.

[0177] The primer and probe sequences for *Yersinia enterocolitica* and *Campylobacter jejuni* are shown in SEQ ID NO. 1-8. Details are as follows:

[0178] upstream primer F for the Yersinia enterocolitica ail gene:

[0179] GGCAGTAATAAGTTTGGTCATGGTGATGTTGA (SEQ ID NO. 1);

[0180] Downstream primer R for the Yersinia enterocolitica ail gene:

[0181] CCATAAAGGCTAACATATTCGTTGATGCGGAA (SEQ ID NO. 2);

[0182] Downstream probe of Yersinia enterocolitica ail gene: CGACGACCGAGGCAAGATGGCCCCATTGTTACTGAATAG (SEQ ID NO.3);

[0183] Yersinia enterocolitica hairpin probe for the AIL gene: FAM-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGAGCCTCGGTCGTCG-C7-NH2(SEQ ID NO.4);

[0184] The upstream primer F for the Campylobacter jejuni P3251_05760 gene is: AGGTACGCCTAAACCTATAGCTCCTTCTC (SEQ ID NO.5);

[0185] The downstream primer R for the Campylobacter jejuni P3251_05760 gene is: TGATACCTTAAGTGCAGCCTGTGAAAGAAT (SEQ ID NO.6);

[0186] Downstream probe of Campylobacter jejuni P3251_05760 gene: GACCGACAGCCACCTTGCTCATCTTTAGGAT (SEQ ID NO.7);

[0187] Hairpin probe for Campylobacter jejuni P3251_05760 gene: FAM-TCTT(BHQ1)AGCCGGTTTTCCGGCTAAGATGGCTGTCGGTC-C7-NH2 (SEQ ID NO.8);

[0188] The templates for Yersinia enterocolitica and Campylobacter jejuni were pUC57 plasmids containing SEQ ID NO. 65 and SEQ ID NO. 66, respectively.

[0189] The final concentrations of each component in the reaction system are as follows:

[0190]

[0191]

[0192] Specific experimental steps:

[0193] 1) Reagent preparation: Two target samples were prepared. Four PCR eight-tube sets were prepared (one target corresponds to two tubes; one tube was marked with the target name on the edge of the cap, meaning only the corresponding target template was added to this tube subsequently; the second tube served as a negative control). The amplification system was contained in each tube. After thawing at room temperature, the tubes were briefly centrifuged. The eight-tube sets were then transferred to the sample processing area.

[0194] 2) Take out 10 of each of the two types of targets from a -20℃ freezer. 7 The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / µL, 10 for each target 3 Copy / micro-level template for later use.

[0195] 3) Add samples to the sample processing area: Use a pipette tip with a filter to pick up the processed Yersinia enterocolitica template (10 μL). 3 Add 1 μL (copies / µL) of the sample to a PCR reaction tube labeled with the corresponding target name and containing PCR reaction solution. Add 1 μL of distilled water to the negative control tube. The sample addition procedure for Campylobacter jejuni is the same. After adding the sample, add three drops of mineral oil to the surface of the system, cap the tube, centrifuge for a few seconds, and then transfer it to the amplification detection area.

[0196] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0197] 5) Loop parameter settings:

[0198] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0199] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 70°C;

[0200] c) Melting curve analysis: Subsequently, the temperature was reduced from 70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0201] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0202] The results are as follows: Figure 3 and Figure 4 As shown, from Figure 3 It can be seen that the target of Yersinia enterocolitica rises during the amplification phase and eventually reaches the plateau phase. Figure 4 It can be seen that the Campylobacter jejuni target normally elutes during the cooling phase, and the characteristic temperature of its characteristic peak is around 63℃.

[0203] Example 2

[0204] The FAM channel quadruple target detection, taking the FAM channel Yersinia enterocolitica, Campylobacter jejuni, Listeria monocytogenes and Vibrio cholerae as an example.

[0205] The primer and probe sequences for Yersinia enterocolitica, Campylobacter jejuni, Listeria monocytogenes, and Vibrio cholerae are shown in SEQ ID NO. 1-16.

[0206] The templates for the four targets, namely Yersinia enterocolitica, Campylobacter jejuni, Listeria monocytogenes, and Vibrio cholerae, are four pUC57 plasmids containing artificially synthesized sequences SEQ ID NO. 65-68, respectively.

[0207] The final concentrations of each component in the FAM single-channel reaction system are as follows:

[0208]

[0209] Specific experimental steps:

[0210] 1) Reagent preparation: Four target samples were prepared. Five PCR eight-tube sets were prepared (four tubes were labeled with the names of the four targets on the edge of the tube cap, meaning only the corresponding target template was added to each subsequent tube; the fifth tube served as a negative control). All tubes contained amplification material. After thawing at room temperature, the tubes were briefly centrifuged. The eight-tube sets were then transferred to the sample processing area.

[0211] 2) Take out 10 of each of the four target types from the -20℃ freezer.7 The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / µL, 10 for each target 3 Copy / micro-level template for later use.

[0212] 3) Add samples in the sample processing area: Use a pipette tip with a filter to collect 10 μL of the prepared templates for the four targets. 3 Add 1 μL (copies / µL) of the sample to four PCR reaction tubes labeled with the corresponding target name, each containing PCR reaction solution. Add 1 μL of distilled water to the negative control tube. After adding the sample, add three drops of mineral oil to the surface of the system, cap the tubes, centrifuge for a few seconds, and then transfer to the amplification detection area.

[0213] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0214] 5) Loop parameter settings:

[0215] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0216] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 70°C;

[0217] c) Melting curve analysis: Subsequently, the temperature was reduced from 70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0218] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0219] See the FAM channel 4-fold result chart. Figure 5 .according to Figure 5 The image above shows that Yersinia enterocolitica normally rises and reaches the plateau phase during the amplification phase. Figure 5 As shown in the figure below, Vibrio cholerae, Listeria monocytogenes, and Campylobacter jejuni elute sequentially as they decrease in temperature, demonstrating good differentiation based on characteristic temperature. This invention can simultaneously detect and differentiate four foodborne pathogens using the FAM channel.

[0220] Example 3

[0221] The VIC channel five-target detection, taking the VIC channel Salmonella, Staphylococcus aureus, Bacillus anthracis, Aeromonas hydrophila, and Clostridium perfringens as an example.

[0222] The primer and probe sequences corresponding to Salmonella, Staphylococcus aureus, Bacillus anthracis, Aeromonas hydrophila, and Clostridium perfringens are shown in SEQ ID NO. 17-36. The templates for the five targets—Salmonella, Staphylococcus aureus, Bacillus anthracis, Aeromonas hydrophila, and Clostridium perfringens—are five pUC57 plasmids each containing a synthetically produced sequence SEQ ID NO. 69-73.

[0223] The final concentrations of each component in the VIC single-channel reaction system are as follows:

[0224]

[0225] Specific experimental steps:

[0226] 1) Reagent preparation: Five target samples were prepared. Six PCR eight-tube strips were taken (five of which were labeled with the names of the five targets on the edge of the tube cap, meaning only the corresponding target template was added to each subsequent tube; the sixth tube served as a negative control). All tubes contained amplification system. After thawing at room temperature, the strips were briefly centrifuged. The eight-tube strips were then transferred to the sample processing area.

[0227] 2) Take out 10 samples of each of the 5 targets from the -20℃ freezer. 7 The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / µL, 10 for each target 3 Copy / micro-level template for later use.

[0228] 3) Add samples in the sample processing area: Use a pipette tip with a filter to collect 10 samples of the five processed target templates respectively. 3 Add 1 μL (copies / µL) of PCR reaction solution to five PCR reaction tubes labeled with the corresponding target names; add 1 μL of distilled water to the negative control tube. After adding the samples, add three drops of mineral oil to the surface of the system, cap the tubes, centrifuge for a few seconds, and then transfer to the amplification detection area.

[0229] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0230] 5) Loop parameter settings:

[0231] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0232] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 70°C;

[0233] c) Melting curve analysis: Subsequently, the temperature was reduced from 70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0234] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0235] See the VIC channel 5-fold result chart. Figure 6 .according to Figure 6 The above image shows that during the amplification phase, Salmonella normally rises and reaches the plateau phase. Figure 6 As shown in the figure below, *Clostridium perfringens*, *Aeromonas hydrophila*, *Bacillus anthracis*, and *Staphylococcus aureus* show peaks sequentially during the cooling phase, with good differentiation based on characteristic temperatures. This invention can simultaneously detect and differentiate five foodborne pathogens in a single channel.

[0236] Example 4

[0237] The TXR channel quadruple target detection was demonstrated using a quadruple assay targeting Escherichia coli O157:H7, Vibrio parahaemolyticus, Clostridium botulinum, and Cronobacter sakazakii.

[0238] The primer and probe sequences for Escherichia coli O157:H7, Vibrio parahaemolyticus, Clostridium botulinum, and Cronobacter sakazaki are shown in SEQ ID NO.37-52.

[0239] The templates for the four targets, namely Escherichia coli O157:H7, Vibrio parahaemolyticus, Clostridium botulinum, and Cronobacter sakazakii, were four pUC57 plasmids containing artificially synthesized sequences SEQ ID NO.74-77, respectively.

[0240] The final concentrations of each component in the TXR single-channel reaction system are as follows:

[0241]

[0242] Specific experimental steps:

[0243] 1) Reagent preparation: Four target samples were prepared. Five PCR eight-tube sets were prepared (four tubes were labeled with the names of the four targets on the edge of the tube cap, meaning only the corresponding target template was added to each subsequent tube; the fifth tube served as a negative control). All tubes contained amplification material. After thawing at room temperature, the tubes were briefly centrifuged. The eight-tube sets were then transferred to the sample processing area.

[0244] 2) Take out 10 of each of the four target types from the -20℃ freezer. 7The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / µL, 10 for each target 3 Copy / micro-level template for later use.

[0245] 3) Add samples in the sample processing area: Use a pipette tip with a filter to collect 10 μL of the prepared templates for the four targets. 3 Add 1 μL (copies / µL) of the sample to PCR reaction tubes labeled with the corresponding target name and containing PCR reaction solution; add 1 μL of distilled water to the negative control tube. After adding the sample, add three drops of mineral oil to the surface of the system, cap the tube, centrifuge for a few seconds, and then transfer to the amplification detection area.

[0246] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0247] 5) Loop parameter settings:

[0248] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0249] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 70°C;

[0250] c) Melting curve analysis: Subsequently, the temperature was reduced from 70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0251] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0252] See the TXR channel 4-fold result image. Figure 7 .according to Figure 7 The image above shows that E. coli O157:H7 normally rises and reaches the plateau phase during the amplification stage. Figure 7 As shown in the figure below, *Enterobacter sakazakii*, *Clostridium botulinum*, and *Vibrio parahaemolyticus* elute sequentially during the cooling phase, demonstrating good differentiation based on characteristic temperatures. This invention can simultaneously detect and differentiate four foodborne pathogens using the TXR channel.

[0253] Example 5

[0254] Cy5 channel triple target detection, taking the Cy5 channel triple experiment of Klebsiella pneumoniae, Shigella flexneri and Pseudomonas cocovenenans as an example.

[0255] The primer and probe sequences for Klebsiella pneumoniae, Shigella flexneri, and Pseudomonas cocovenenans are shown in SEQ ID NO. 53-64.

[0256] The templates for the three targets, Klebsiella pneumoniae, Shigella flexneri, and Pseudomonas cocovenenans, were three pUC57 plasmids containing synthetic sequences SEQ ID NO.78-80, respectively.

[0257] The final concentrations of each component in the Cy5 single-channel reaction system are as follows:

[0258]

[0259] Specific experimental steps:

[0260] 1) Reagent preparation: Three samples were prepared for the target assay. Four PCR eight-tube sets were prepared (three tubes were labeled with the names of the three targets on the edge of the tube cap, meaning only the corresponding target template was added to each subsequent tube; the fourth tube served as a negative control). All tubes contained amplification material. After thawing at room temperature, the tubes were briefly centrifuged. The eight-tube sets were then transferred to the sample processing area.

[0261] 2) Take out 10 of the three types of targets from the -20℃ freezer. 7 The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / µL, 10 for each target 3 Copy / micro-level template for later use.

[0262] 3) Add samples in the sample processing area: Use a pipette tip with a filter to collect 10 μL of the three processed target templates respectively. 3 Add 1 μL (copies / µL) of the sample to PCR reaction tubes labeled with the corresponding target name and containing PCR reaction solution; add 1 μL of distilled water to the negative control tube. After adding the sample, add three drops of mineral oil to the surface of the system, cap the tube, centrifuge for a few seconds, and then transfer to the amplification detection area.

[0263] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0264] 5) Loop parameter settings:

[0265] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0266] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 70°C;

[0267] c) Melting curve analysis: Subsequently, the temperature was reduced from 70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0268] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0269] See the triplet result chart for the Cy5 channel. Figure 8 .according to Figure 8 The above image shows that Klebsiella pneumoniae normally rises and reaches the plateau phase during the amplification stage. Figure 8 As shown in the figure below, *Pseudomonas cocovenenans* and *Shigella flexneri* elute sequentially during the cooling phase, demonstrating good differentiation based on characteristic temperature. This invention can simultaneously detect and differentiate three foodborne pathogens using the Cy5 channel.

[0270] Example 6

[0271] Simultaneous detection and differentiation of multiple targets in dual channels, taking the nine-fold experiment of FAM and VIC channels as an example.

[0272] Nine target primer-probe sequences for the FAM and VIC channels are shown in SEQ ID NO.1-36.

[0273] The templates for nine targets, including FAM, Yersinia enterocolitica of the VIC channel, Campylobacter jejuni, Listeria monocytogenes, Vibrio cholerae, Salmonella, Staphylococcus aureus, Bacillus anthracis, Aeromonas hydrophila, and Clostridium perfringens, are nine pUC57 plasmids containing artificially synthesized sequences SEQ ID NO. 65-73.

[0274] The final concentrations of each component in the FAM and VIC channel reaction system are as follows:

[0275]

[0276] Specific experimental steps:

[0277] 1) Reagent preparation: Nine target samples were prepared. Ten PCR eight-tube strips were taken (nine of which were labeled with the names of the nine targets on the edge of the tube cap, meaning only the corresponding target template was added to each subsequent tube; the tenth tube served as a negative control). All tubes contained amplification system. After thawing at room temperature, the strips were briefly centrifuged. The eight-tube strips were then transferred to the sample processing area.

[0278] 2) Template dilution procedure: Take out 10 μL of each of the 9 target types from the -20℃ freezer. 7The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / µL, 10 for each target 3 Copy / micro-level template for later use.

[0279] 3) Add samples in the sample processing area: Use a pipette tip with a filter to collect the prepared templates of the 9 targets (10... 3 Add 1 μL (copies / µL) of the sample to PCR reaction tubes labeled with the corresponding target name and containing PCR reaction solution; add 1 μL of distilled water to the negative control tube. After adding the sample, add three drops of mineral oil to the surface of the system, cap the tube, centrifuge for a few seconds, and then transfer to the amplification detection area.

[0280] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0281] 5) Loop parameter settings:

[0282] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0283] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 68°C;

[0284] c) Melting curve analysis: Subsequently, the temperature was reduced from 68℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0285] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0286] The results of the FAM and VIC dual-channel 9-fold experiments are shown below. Figure 9 and Figure 10 As shown. Figure 9 As shown in the image above, Yersinia enterocolitica normally rises and reaches the plateau phase during the amplification phase. Figure 9 As shown in the figure below, Vibrio cholerae, Listeria monocytogenes, and Campylobacter jejuni showed peaks sequentially during the cooling phase, with good differentiation of characteristic temperatures. Figure 10 As can be seen from the above image, Figure 10 As shown in the image above, Salmonella normally rises and reaches the plateau phase during the amplification phase. Figure 10 In the figure below, *Clostridium perfringens*, *Aeromonas hydrophila*, *Bacillus anthracis*, and *Staphylococcus aureus* show peaks sequentially during the cooling phase, with good differentiation based on characteristic temperatures. In summary, from... Figure 9 and Figure 10It is known that the present invention can simultaneously detect and distinguish a total of 9 kinds of foodborne pathogens through dual channels.

[0287] Example 7

[0288] Simultaneous detection and differentiation of multiple targets in three channels, taking an 11-fold experiment with FAM, TXR and Cy5 channels as an example.

[0289] The 11 target primer-probe sequences for the FAM, TXR, and Cy5 channels are shown in SEQ ID NO.1-16 and 37-64.

[0290] The templates for 11 targets, including Yersinia enterocolitica, Campylobacter jejuni, Listeria monocytogenes, Vibrio cholerae, Escherichia coli O157:H7, Vibrio parahaemolyticus, Clostridium botulinum, Enterobacter sakazakii, Klebsiella pneumoniae, Shigella flexneri, and Pseudomonas cocovenenans, are 11 pUC57 plasmids containing synthetic sequences SEQ ID NO. 65-68 and 74-80, respectively.

[0291] The final concentrations of each component in the FAM, TXR, and Cy5 channel reaction systems are as follows:

[0292]

[0293] Specific experimental steps:

[0294] 1) Reagent preparation: The number of target samples to be tested is 11. Take out 12 PCR eight-tube strips (11 of which are marked with the names of the 11 targets on the edge of the tube cap, meaning that each subsequent tube contains only the corresponding target template; the 12th tube serves as a negative control). All tubes contain amplification system. After thawing at room temperature, briefly centrifuge; transfer the eight-tube strips to the sample processing area.

[0295] 2) Template dilution procedure: Take out 10 templates corresponding to 11 different targets from the -20℃ freezer. 7 The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / µL, 10 for each target 3 Copy / micro-level template for later use.

[0296] 3) Add samples in the sample processing area: Use a pipette tip with a filter to collect the templates of the 11 pre-processed targets (10... 3 Add 1 μL (copies / µL) of the sample to PCR reaction tubes labeled with the corresponding target name and containing PCR reaction solution; add 1 μL of distilled water to the negative control tube. After adding the sample, add three drops of mineral oil to the surface of the system, cap the tube, centrifuge for a few seconds, and then transfer to the amplification detection area.

[0297] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0298] 5) Loop parameter settings:

[0299] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0300] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 68°C;

[0301] c) Melting curve analysis: Subsequently, the temperature was reduced from 68℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0302] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0303] The results of the 11-fold experiment for FAM, TXR, and Cy5 channels are as follows: Figures 11-13 As shown, Figure 11 The image above shows that Yersinia enterocolitica normally rises during the amplification phase and reaches the plateau phase. Figure 11 As shown in the figure below, Vibrio cholerae, Listeria monocytogenes, and Campylobacter jejuni showed peaks sequentially during the cooling phase, with good differentiation of characteristic temperatures. Figure 12 The above figure shows that E. coli O157:H7 normally rises and reaches the plateau phase during the amplification stage. Figure 12 As shown in the figure below, Enterobacter sakazakii, Clostridium botulinum, and Vibrio parahaemolyticus showed peaks sequentially during the cooling phase, with good differentiation of characteristic temperatures. Figure 13 The image above shows that Klebsiella pneumoniae normally rises and reaches the plateau phase during the amplification phase. Figure 13 The figure below shows that *Pseudomonas cocovenenans* and *Shigella flexneri* exhibit sequential peaks during the cooling phase, with good differentiation based on characteristic temperature. From... Figure 11-13 It is known that the present invention can simultaneously detect and distinguish 11 kinds of foodborne pathogens in three channels.

[0304] Example 8

[0305] Simultaneous detection and differentiation of multiple targets in four channels, taking the 16-fold experiment of FAM, VIC, TXR, and Cy5 channels as an example.

[0306] The 16 target primer-probe sequences for the FAM, VIC, TXR, and Cy5 channels are shown in SEQ ID NO.1-64.

[0307] The templates for 16 targets in the FAM, VIC, TXR, and Cy5 channels, including Yersinia enterocolitica, Campylobacter jejuni, Listeria monocytogenes, Vibrio cholerae, Salmonella, Staphylococcus aureus, Bacillus anthracis, Aeromonas hydrophila, Clostridium perfringens, Escherichia coli O157:H7, Vibrio parahaemolyticus, Clostridium botulinum, Enterobacter sakazakii, Klebsiella pneumoniae, Shigella flexneri, and Burkholderia cocovenenans, are 16 pUC57 plasmids containing synthetic sequences SEQ ID NO. 65-80.

[0308] The final concentrations of each component in the FAM, VIC, TXR, and Cy5 channel reaction systems are as follows:

[0309]

[0310]

[0311] Specific experimental steps:

[0312] 1) Reagent preparation: The number of target samples to be tested is 16. Take out 17 PCR eight-tube strips (16 of which are marked with the names of the 16 targets on the edge of the tube cap; each subsequent tube will contain only the corresponding target template, and the 17th tube will serve as a negative control). All tubes should contain amplification system. After thawing at room temperature, briefly centrifuge; transfer the eight-tube strips to the sample processing area.

[0313] 2) Template dilution procedure: Take 10 from the -20℃ freezer 7 The template (copies / µL) was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution zone until the final template concentration was 10. 3 Copy / microliter.

[0314] 3) Add samples in the sample processing area: Use a pipette tip with a filter to collect the prepared templates of the 16 targets (10... 3 Add 1 μL (copies / µL) of the sample to PCR reaction tubes labeled with the corresponding target name and containing PCR reaction solution; add 1 μL of distilled water to the negative control tube. After adding the sample, add three drops of mineral oil to the surface of the system, cap the tube, centrifuge for a few seconds, and then transfer to the amplification detection area.

[0315] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0316] 5) Loop parameter settings:

[0317] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0318] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 68°C;

[0319] c) Melting curve analysis: Subsequently, the temperature was reduced from 68℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0320] 6) Negative control: NTC: The amplification system is the same as the positive control, but the sample added is distilled water, and the result is negative; Positive control: The result is positive.

[0321] The results of the 16-fold experiment for FAM, VIC, TXR, and Cy5 channels are shown below. Figure 14-17 As shown. Figure 14 The image above shows that Yersinia enterocolitica normally rises during the amplification phase and reaches the plateau phase. Figure 14 As shown in the figure below, Vibrio cholerae, Listeria monocytogenes, and Campylobacter jejuni showed peaks sequentially during the cooling phase, with good differentiation of characteristic temperatures. Figure 15 The above image shows that Salmonella normally rises and reaches the plateau phase during the amplification phase. Figure 15 As shown in the figure below, Clostridium perfringens, Aeromonas hydrophila, Bacillus anthracis, and Staphylococcus aureus show peaks sequentially during the cooling phase, with good differentiation of characteristic temperatures. Figure 16 The above figure shows that E. coli O157:H7 normally rises and reaches the plateau phase during the amplification stage. Figure 16 As shown in the figure below, Enterobacter sakazakii, Clostridium botulinum, and Vibrio parahaemolyticus showed peaks sequentially during the cooling phase, with good differentiation of characteristic temperatures. Figure 17 The image above shows that Klebsiella pneumoniae normally rises and reaches the plateau phase during the amplification phase. Figure 17 The figure below shows that *Pseudomonas cocovenenans* and *Shigella flexneri* exhibit sequential peaks during the cooling phase, with good differentiation based on characteristic temperature. In summary, from... Figure 14-17 It is known that the present invention can simultaneously detect and distinguish 16 kinds of foodborne pathogens in four channels.

[0322] Example 9 Sensitivity Experiment

[0323] Taking Campylobacter jejuni at 59℃, Burkholderia cocovenenans at 54℃, Listeria monocytogenes at 49℃, and Vibrio cholerae at 45℃ as examples during the cooling phase.

[0324] Final concentrations of each component in the reaction system: Same as in Example 5, except that the concentration of the template used for sample addition is changed to 10, 10 2 10 3 Copy / microliter.

[0325] The templates for the four targets, Campylobacter jejuni, Pseudomonas cocovenenans, Listeria monocytogenes and Vibrio cholerae, were four pUC57 plasmids containing the artificial sequences SEQ ID NO.66, SEQ ID NO.80, SEQ ID NO.67 and SEQ ID NO.68, respectively.

[0326] Specific experimental steps:

[0327] 1) Reagent preparation: The number of target samples to be tested is 4, and each target needs to be tested at 10... 3 10 2 The fluorescence signal of the reaction was observed at a template concentration of 10 copies / µL. Therefore, 12 PCR eight-tube sets were taken (three tubes for each target, each tube marked with the target name and template concentration on the edge of the cap; each subsequent tube contained only the corresponding concentration of template for that target). The amplification system was contained within the tubes. After thawing at room temperature, the tubes were briefly centrifuged; the eight-tube sets were then transferred to the sample processing area.

[0328] 2) Template dilution procedure: Take out 10 μL of each of the four target types from the -20℃ freezer. 7 Template at a concentration of 10 copies / µL was melted, vortexed, and then diluted 10-fold with distilled water in the template dilution region until the final template concentration was 10 copies / µL. 10⁻¹⁰ copies / µL were used for each of the four targets. 3 Copy / micro-level template for later use.

[0329] 3) Add samples to the sample processing area: Use a pipette tip with a filter to pick up the prepared Campylobacter jejuni template (10, 10... 2 10 3 (Copies / µL), based on template concentration from low to high (10, 10) 2 10 3 Add 1 μL of each sample (copy / µL) sequentially to PCR reaction tubes containing PCR reaction solution, labeled with the corresponding target name and template concentration. The addition procedure for the other three targets is the same. After adding the samples, add three drops of mineral oil to the surface of the system, cap the tubes, centrifuge for a few seconds, and then transfer to the amplification detection area. Add 1 μL of distilled water (negative control) to each PCR reaction tube containing the PCR reaction solution.

[0330] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0331] 5) Loop parameter settings:

[0332] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0333] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 68°C;

[0334] c) Melting curve analysis: Subsequently, the temperature was reduced from 68℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a Q-PCR instrument, and fluorescence signal change rate analysis was performed to obtain rate maps for target differentiation.

[0335] The target sensitivity results for each temperature channel during the cooling phase of the 16-fold system are shown in [reference]. Figure 18-21 As shown, the sensitivity can reach as low as 10 copies / reaction, and there is no crosstalk from the other three fluorescence channels. It has good specificity and meets the detection standards for foodborne pathogens.

[0336] Example 10

[0337] The 16-fold system allows for the quantification of targets during the amplification phase, taking the TXR target Escherichia coli O157:H7 as an example.

[0338] Final concentrations of each component in the reaction system: Same as in Example 5, except that the concentration of the template used for sample addition is changed to 10, 10 2 10 3 10 4 10 5 10 6 10 7 Copy / microliter.

[0339] The template for Escherichia coli O157:H7 is the pUC57 plasmid containing the synthetic sequence SEQ ID NO.75.

[0340] Specific experimental steps:

[0341] 1) Reagent preparation: The quantity of the target sample to be tested is 1, which needs to be prepared in 10, 10 2 10 3 10 4 10 5 10 6 10 7 The fluorescence signal of the reaction was observed at a template concentration of 7 copies / µL. Therefore, 7 PCR eight-tube strips were taken out (marked on the edge of the tube cap with the concentration of the template to be added), containing the amplification system. After thawing at room temperature, the strips were briefly centrifuged; the eight-tube strips were then transferred to the sample processing area.

[0342] 2) Template dilution procedure: Take out 10 μL of each of the four target types from the -20℃ freezer. 7 The template, at a concentration of 10 copies / µL, was melted and vortexed. In the template dilution zone, it was diluted 10-fold with distilled water until the final template concentration was 10 copies / µL. Take 10, 10... 210 3 10 4 10 5 10 6 10 7 Copy / micro-level template for later use.

[0343] 3) Add samples to the sample processing area: Use a pipette tip with a filter to take samples of the processed template (10, 10...). 2 10 3 10 4 10 5 10 6 10 7 (Copies / µL), based on template concentration from low to high (10, 10) 2 10 3 10 4 10 5 10 6 10 7 Add samples in the order of copies / µL to PCR reaction tubes containing PCR reaction solution labeled with the corresponding template concentration, with each sample volume being 1µL; after adding the samples, add three drops of mineral oil to the surface of the system, cap the tubes, centrifuge for a few seconds, and then transfer them to the amplification detection area;

[0344] 4) Perform PCR amplification and detection in the amplification and detection area: Place the PCR reaction tube into the Q-PCR amplification instrument for amplification and detection;

[0345] 5) Loop parameter settings:

[0346] a) Pre-denaturation: Pre-denaturate at 94℃ for 2 min;

[0347] b) Amplification cycle: 60 cycles, each cycle consisting of 15 seconds of denaturation at 94°C and 40 seconds of annealing and extension at 68°C;

[0348] c) Melting curve analysis: Real-time fluorescence data were collected in 60 cycles on a Q-PCR instrument to obtain a spectrum of fluorescence intensity changes over time. A linear graph was obtained based on the different peak Ct values ​​of templates with different concentrations, thereby enabling target quantification.

[0349] See results Figure 22 and Figure 23 As shown in the figure, the detection method of the present invention has quantitative potential. The logarithm of the target concentration C is directly proportional to the number of cycles and exhibits good linearity.

Claims

1. A primer-probe combination for detecting foodborne pathogens, characterized in that, The primer-probe combination includes at least one or more of the following combinations; The upstream primer shown in SEQ ID NO.1, the downstream primer shown in SEQ ID NO.2, the downstream probe shown in SEQ ID NO.3, and the hairpin probe shown in SEQ ID NO.4; The upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.6, the downstream probe shown in SEQ ID NO.7 and the hairpin probe shown in SEQ ID NO.8; The upstream primer shown in SEQ ID NO. 9 and the downstream primer shown in SEQ ID NO. 10, the downstream probe shown in SEQ ID NO. 11 and the hairpin probe shown in SEQ ID NO. 12; The upstream primer shown in SEQ ID NO.13 and the downstream primer shown in SEQ ID NO.14, the downstream probe shown in SEQ ID NO.15 and the hairpin probe shown in SEQ ID NO.16; The upstream primer shown in SEQ ID NO.17 and the downstream primer shown in SEQ ID NO.18, the downstream probe shown in SEQ ID NO.19 and the hairpin probe shown in SEQ ID NO.20; The upstream primer shown in SEQ ID NO.21 and the downstream primer shown in SEQ ID NO.22, the downstream probe shown in SEQ ID NO.23 and the hairpin probe shown in SEQ ID NO.24; The upstream primer shown in SEQ ID NO.25 and the downstream primer shown in SEQ ID NO.26, the downstream probe shown in SEQ ID NO.27 and the hairpin probe shown in SEQ ID NO.28; The upstream primer shown in SEQ ID NO.29 and the downstream primer shown in SEQ ID NO.30, the downstream probe shown in SEQ ID NO.31 and the hairpin probe shown in SEQ ID NO.32; The upstream primer shown in SEQ ID NO.33 and the downstream primer shown in SEQ ID NO.34, the downstream probe shown in SEQ ID NO.35 and the hairpin probe shown in SEQ ID NO.36; The upstream primer shown in SEQ ID NO.37 and the downstream primer shown in SEQ ID NO.38, the downstream probe shown in SEQ ID NO.39 and the hairpin probe shown in SEQ ID NO.40; The upstream primer shown in SEQ ID NO.41 and the downstream primer shown in SEQ ID NO.42, the downstream probe shown in SEQ ID NO.43 and the hairpin probe shown in SEQ ID NO.44; The upstream primer shown in SEQ ID NO.45 and the downstream primer shown in SEQ ID NO.46, the downstream probe shown in SEQ ID NO.47 and the hairpin probe shown in SEQ ID NO.48; The upstream primer shown in SEQ ID NO.49 and the downstream primer shown in SEQ ID NO.50, the downstream probe shown in SEQ ID NO.51 and the hairpin probe shown in SEQ ID NO.52; The upstream primer shown in SEQ ID NO. 53 and the downstream primer shown in SEQ ID NO. 54, the downstream probe shown in SEQ ID NO. 55 and the hairpin probe shown in SEQ ID NO. 56; The upstream primer shown in SEQ ID NO. 57 and the downstream primer shown in SEQ ID NO. 58, the downstream probe shown in SEQ ID NO. 59 and the hairpin probe shown in SEQ ID NO. 60; The upstream primer as shown in SEQ ID NO. 61 and the downstream primer as shown in SEQ ID NO. 62, the downstream probe as shown in SEQ ID NO. 63 and the hairpin probe as shown in SEQ ID NO.

64.

2. The primer-probe combination for detecting foodborne pathogens according to claim 1, characterized in that, The downstream probe is connected to the Flap fragment and phosphorylated at the 3' end. The hairpin probe is labeled with a fluorescent group at the 5' end and a blocking group at the 3' end. Preferably, the first base at the 5' end of the hairpin probe is labeled with a fluorescent group, the fourth base at the 5' end is labeled with a quenching group, and the 3' end is labeled with a blocking group.

3. The primer-probe combination for detecting foodborne pathogens according to claim 2, characterized in that, The fluorescent reporter probe contains fluorescent groups including various commonly used fluorescent markers. Preferably, the fluorescent groups include FAM, VIC, ROX, TXR, CY3, or CY5. The quenching groups include various commonly used quenchers. Preferably, the quenching groups include BHQ-1, BHQ-2, DABCYL, or ECLIPE. The blocking groups include various commonly used blocking groups. Preferably, the blocking groups include C7-NH2 or C6-Spacer.

4. The primer-probe combination for detecting foodborne pathogens according to claim 1, characterized in that, The concentrations of the upstream and downstream primers are both 0.1–0.5 μM, the concentration of the downstream probe is 0.05–0.5 μM, and the concentration of the hairpin probe is 0.1–0.4 μM.

5. A single-tube multiplex detection kit for foodborne pathogens, characterized in that, The detection kit includes the primer-probe combination as described in any one of claims 1 to 4.

6. The single-tube multiplex detection kit for foodborne pathogens according to claim 5, characterized in that, The test kit also includes PCR Buffer, dNTPs, hot-start DNA polymerase, Flap endonuclease 1, negative control, and positive control.

7. The single-tube multiplex detection kit for foodborne pathogens according to claim 6, characterized in that, The concentration of the dNTPs was 0.2 mM.

8. The single-tube multiplex detection kit for foodborne pathogens according to claim 6, characterized in that, The concentration of the hot-start DNA polymerase is 0.15~1.5 U.

9. The single-tube multiplex detection kit for foodborne pathogens according to claim 6, characterized in that, The concentration of the Flap endonuclease 1 was 4000 U.

10. The single-tube multiplex detection kit for foodborne pathogens according to claim 6, characterized in that, The reaction procedure for the single-tube multiplex detection of foodborne pathogens is as follows: a) Pre-denaturation: 94 ℃ for 2 min; b) Amplification cycle: 60 cycles, each cycle consisting of 15 s denaturation at 94 °C and 40 s annealing extension at 68-70 °C; c) Melting curve analysis: Subsequently, the temperature was reduced from 68-70℃ to 35℃ at a cooling rate of -1℃ / step. Real-time fluorescence data was collected on a fluorescence PCR instrument, and the rate of fluorescence signal change was analyzed to obtain a rate spectrum for target differentiation.

Images