Nucleic acid assembly amplification chemiluminescence detection method based on double antibodies

Abstract

The invention relates to a double-antibody-based nucleic acid assembly amplification chemiluminescence detection method applied to the field of biological detection. The method comprises the following steps: S1, coupling a nucleic acid chain with a detection antibody; s2, coupling a signal molecule with a nucleic acid chain; s3, incubating the coupling products in S1 and S2 in a nucleic acid hybridization solution to obtain a luminous detection mother solution, and S4, directly replacing acridinium ester labeled antibody components or antibody coupled magnetic bead components with the obtained luminous detection mother solution for detection in a chemiluminescence immunoassay, and carrying out two different amplification detection operations from a magnetic bead end or a detection end. Dozens to hundreds of single antibody labels are realized, and the influence of interfering substances in a sample on detection is reduced while the chemiluminescence reaction sensitivity is improved.

Description

Technical Field

[0001] This invention relates to a nucleic acid assembly amplification chemiluminescence detection method, and more particularly to a nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies for application in the field of biological detection. Background Technology

[0002] Non-enzymatic nucleic acid amplification reactions (NDARs) are thermodynamically driven, allowing them to operate without enzymes. Their fundamental principle relies primarily on Toehold-mediated process chain displacement (TMSD) and branching migration. Due to their highly efficient signal amplification capabilities, NDARs have become a basic tool for biomarker detection and intracellular imaging.

[0003] Chinese invention patent CN111850097B discloses a signal amplification magnetic bead technology system for nucleic acid detection based on CRISPR technology and its application. It introduces a catalytic enzyme as a third-stage signal amplification system on the basis of the original two-stage signal amplification of nucleic acid amplification and non-specific arbitrary cleavage of Cas protein.

[0004] Chinese invention patent CN119061131A discloses a method for detecting low-abundance myocardial microRNA-155 using a tyramine signal amplification probe enhanced by Janus platinum nanozyme. This method incorporates Janus nanozyme to increase system stability and achieves efficient signal amplification, thus possessing the technical advantage of improved detection sensitivity.

[0005] In existing nucleic acid detection methods, in order to improve the sensitivity of chemiluminescence reactions, a large number of foreign substances, such as enzymes, are introduced into the sample, which leads to an increase in interfering substances. These substances may cause extension or amplification at non-specific sites, producing non-target nucleic acid fragments, increasing background signals, and resulting in a high signal-to-noise ratio in the detection results. Summary of the Invention

[0006] In view of the above-mentioned prior art, the technical problem to be solved by the present invention is how to improve the sensitivity of chemiluminescence reaction and reduce the influence of interfering substances in the sample on detection.

[0007] To address the above problems, this invention provides a nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies, the steps of which are as follows:

[0008] S1. The nucleic acid chain is coupled with the detection antibody. The nucleic acid chain includes a guide chain and a raw material chain. The two raw material chains H1 and H2 of the nucleic acid each have a complementary sequence. One of the raw material chains of the nucleic acid has a sequence that is complementary to the guide chain. The number of complementary bases and the annealing temperature of the raw material chain and the guide chain are greater than the number of complementary bases and the annealing temperature of the two raw material chains.

[0009] S2. The signal molecule is coupled to the nucleic acid chain. The signal molecule is an acrid ester for coupling with the raw material chain or a magnetic bead for coupling with the guide chain.

[0010] S3. Incubate the coupling products from S1 and S2 in nucleic acid hybridization solution to obtain the luminescent detection solution stock solution, wherein the hybridization solution is a mixture of 10 mM Tris and 400 mM sodium chloride.

[0011] S4. The obtained luminescent detection solution stock solution can be used directly to replace the acrid ester-labeled antibody component or the antibody-conjugated magnetic bead component in chemiluminescent immunoassay.

[0012] In the above-mentioned nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies, by performing two different amplification detection operations from the magnetic bead end or the detection end, the number of single antibody labels can be increased from tens to hundreds, thereby improving the sensitivity of the chemiluminescence reaction and reducing the influence of interfering substances in the sample on the detection.

[0013] As a further improvement of this application, when the signal molecule is acridinium ester, the T1 of one leading strand of the nucleic acid chain is labeled with -SH, and the two raw material strands of the nucleic acid chain are labeled with -NH2. In S1, the leading strand of the nucleic acid chain is coupled with the detection antibody, and in S2, the raw material strands of the nucleic acid chain are coupled with acridinium ester.

[0014] When the signal molecule is a magnetic bead, one guide strand of the nucleic acid chain is labeled with biotin (T1), and the two raw material strands of the nucleic acid chain are labeled with -SH. In S1, the guide strand of the nucleic acid chain is coupled to the detection antibody, and in S2, the raw material strands of the nucleic acid chain are coupled to the magnetic bead.

[0015] As a further improvement to this application, the steps for coupling the -SH-labeled strands in the nucleic acid are as follows:

[0016] S11. Dissolve the required amount of SMCC in DMSO to obtain a solution with a concentration of 2 mg / mL;

[0017] S12. Take 100 μg of antibody into the solution in S11, then place the antibody-containing solution into the sample well of a 50 kDa ultrafiltration tube, centrifuge twice, and then adjust the volume to 200 μL with PBS. Add the solution in S11 and stir the resulting mixture in the dark.

[0018] S13. Place the solution from S12 into the sample well of a 50 kDa ultrafiltration tube, centrifuge 3 times to separate the antibody from the SMCC, and then add PBS to bring the volume to 100 μL.

[0019] S14. Dissolve TCEP powder in PBS to obtain a solution with a concentration of 10 mg / mL. Treat the 5'-thio modified primers at a molar ratio of 10 μL: 100 μL. The primer concentration is 34 nM. Stir the obtained solution under light-protected conditions.

[0020] S15. Place the solution from S14 into the sample chamber of a 3kDA ultrafiltration tube, centrifuge 3 times, and collect the filtrate.

[0021] S16. Incubate the primers from S15 and the antibody from S13 at room temperature for 3 hours. After the reaction is complete, add NEM to the reaction tube to make the final concentration 1mM. Let it stand at room temperature to close the disulfide bonds of the primers that have not bound to the antibody. Aliquot 100μL / tube and store at -20℃ to avoid repeated freeze-thaw cycles.

[0022] As a further improvement of this application, when labeling the raw material chain with -SH, step S2 is as follows: when labeling the raw material chain with -SH, BSA is added to 20mM PBS buffer to make a final concentration of 1% BSA as the labeling buffer. Then, the biotinylated raw material chain and SA magnetic beads are added to the labeling buffer at a ratio of 1OD:10mg and shaken.

[0023] As a further improvement to this application, when the raw material chain is labeled as -NH2, the steps of S2 are as follows:

[0024] S21. Prepare a 25 mM NHS acridinium ester stock solution in distilled DMSO. Evaporate the probe and acridinium ester stock solution in a 1.5 ml conical polypropylene tube until dry at a molar ratio of 1:5.

[0025] S22, Prepare the additive solution;

[0026] S23. Vortex mix the added liquid and the dried object from S21, rotate in a microcentrifuge to bring the contents to the bottom of the test tube, and incubate.

[0027] S24. Sequentially add a DMSO solution of 25mM NHS acridine ester, H2O, and HEPES with a pH of 8 and a concentration of 1M to the solution in S23.

[0028] S25. Vortex and rotate the mixed solution after adding the ingredients in S24, and then incubate it again.

[0029] S26. Add 0.125M lysine to a mixture of HEPES and 50% DMSO at pH 8 and concentration of 0.1M, add it to the solution incubated in S25, and incubate at room temperature.

[0030] As a further improvement of this application, before the evaporation and drying process in S21, the solution is added in the following order: H2O, HEPES with pH 8 and a concentration of 1M, DMSO, and a DMSO ester solution of 25mM NHS acridine ester.

[0031] As a further supplement to this application, when labeling the raw material chain with -SH, the specific steps of S3 are as follows: the magnetic bead guide chain conjugate of S2 and the antibody raw material chain conjugate of S1 are incubated in nucleic acid hybridization solution at 37-45℃ for 1-2 hours at a nucleic acid molar ratio of 1:2-1:10. The ratio of guide chain to raw material chain is 1:2-1:200. After self-assembly, it becomes the luminescent detection solution mother liquor.

[0032] As a further supplement to this application, when the raw material chain is labeled with -NH2, the specific steps of S3 are as follows: the coupled guide chain and the raw material chain are incubated in nucleic acid hybridization solution at 37-45℃ for 1-2 hours. The ratio of guide chain to raw material chain is 1:2-1:200. After self-assembly, it becomes the luminescent detection solution mother liquor.

[0033] As a further addition to this application, the two raw material chains are one of the following: a stem-ring molecular beacon structure, a scorpion-like structure, or a linear structure.

[0034] In summary, by performing two different amplification detection operations from the magnetic bead end or the detection end, and by forming amplified assembly through chain displacement reaction, it is possible to detect the antibody-conjugated guide chain combined with the alternating assembly of the raw material chain, as well as the streptavidin magnetic bead-conjugated guide chain combined with the alternating assembly of the raw material chain. This allows for the labeling of a single antibody to reach tens to hundreds of labels, improving the sensitivity of the chemiluminescent reaction. Furthermore, the increased sensitivity allows for a reduction in the sample volume in the reaction system or an increase in the dilution factor, thus reducing the impact of interfering substances in the sample on the detection. Attached Figure Description

[0035] Figure 1 This is the overall flowchart of this application;

[0036] Figure 2 This is a schematic diagram illustrating the process of antibody and nucleic acid chain during the nucleic acid assembly signal amplification operation in this application;

[0037] Figure 3 This is a schematic diagram of the process for coupling the reactant chain with acridine ester when the signal molecule is acridine ester in this application;

[0038] Figure 4 This is a schematic diagram showing the curve fitting of the luminescent detection solution stock solution obtained from the detection end in this application using different concentrations of TM antigen for testing;

[0039] Figure 5This is a schematic diagram showing the curve fitting of the luminescent detection solution stock solution obtained from the magnetic bead end in this application using different concentrations of tPAIC antigen for testing. Detailed Implementation

[0040] The four embodiments of this application will now be described in detail with reference to the accompanying drawings.

[0041] First implementation method:

[0042] Figure 1 A nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies is shown, with the following steps:

[0043] S1. The nucleic acid chain is coupled with the detection antibody. The nucleic acid chain includes a guide chain and a raw material chain. The two raw material chains H1 and H2 of the nucleic acid each have a complementary sequence. One of the raw material chains of the nucleic acid has a sequence that is complementary to the guide chain. The number of complementary bases and the annealing temperature of the raw material chain and the guide chain are greater than the number of complementary bases and the annealing temperature of the two raw material chains.

[0044] S2. The signal molecule is coupled to the nucleic acid chain. The signal molecule is an acrid ester for coupling with the raw material chain or a magnetic bead for coupling with the guide chain.

[0045] S3. Incubate the coupling products from S1 and S2 in a nucleic acid hybridization solution to obtain a luminescent detection solution stock solution, wherein the hybridization solution is a mixture of 10 mM Tris (tris(hydroxymethyl)aminomethane) and 400 mM sodium chloride.

[0046] S4. The obtained luminescent detection solution stock solution can be used directly to replace the acrid ester-labeled antibody component or the antibody-conjugated magnetic bead component in chemiluminescent immunoassay.

[0047] When the signal molecule is acridinium ester, the T1 of one guide strand of the nucleic acid chain is labeled with -SH, and the two raw material strands of the nucleic acid chain are labeled with -NH2. In S1, the guide strand of the nucleic acid chain is coupled with the detection antibody, and in S2, the raw material strand of the nucleic acid chain is coupled with acridinium ester.

[0048] When the signal molecule is a magnetic bead, one guide strand of the nucleic acid chain is labeled with biotin (T1), and the two raw material strands of the nucleic acid chain are labeled with -SH. In S1, the guide strand of the nucleic acid chain is coupled to the detection antibody, and in S2, the raw material strands of the nucleic acid chain are coupled to the magnetic bead.

[0049] The following are the experimental results of the experimental group when the two raw material chains of nucleic acid are labeled -NH2 and a chemiluminescent detection method is used to amplify the nucleic acid assembly signal from the detection end. In this embodiment, the antibodies are thrombomodulin monoclonal coated antibody and thrombomodulin monoclonal detection antibody, and their sequences are as follows:

[0050] T1: SH-TTTTTTTTTTTAATTGGGTGCGGCTTAGGATCTGA

[0051] H1-1: NH2-GTTTCATCAGATCCCTAAGCCGCACAATTGGGTGCGGCTTAGGATCTGA

[0052] H1-2: NH2-GTGCGGCTTAGGATCTGATGAAACTCAGATCCTAAGCCGCACCCAATT

[0053] Based on the above, the steps for conjugating the -SH-labeled T1 guide chain with the detection antibody, that is, conjugating the -SH-labeled chain in the nucleic acid, are as follows (e.g. Figure 2 As shown):

[0054] S11. Take the required amount of SMCC (succinimide-4-cyclohexane-1-carbonate, a heterobifunctional cross-linking agent, often used in protein coupling experiments) and dissolve it in DMSO (dimethyl sulfoxide, an organic solvent) to obtain a solution with a concentration of 2 mg / mL.

[0055] S12. Take 100 μg of antibody (optional: 10 mM NEM blocked at 37℃ in the dark for 30 min, NEM is N-ethylmaleimide) into the solution in S11. The molar ratio of antibody to SMCC is 30:1. Then place the solution containing antibody into the sample well of a 50 kDa ultrafiltration tube and centrifuge twice at 14000 g for 10 min each time. Adjust the volume to 200 μL with PBS (phosphate buffer), add 10 μL of the solution in S11, and stir the resulting mixture in the dark for 60 min at a stirring speed of 800 rpm.

[0056] S13. Place the solution from S12 into the sample well of a 50 kDa ultrafiltration tube, centrifuge at 14000 g for 10 minutes each time to separate the antibody from SMCC, and then bring the volume to 100 μL with PBS.

[0057] S14. Dissolve TCEP (trichloroethyl phosphate, as a disulfide bond reducing agent, which can selectively reduce cysteine ​​disulfide bonds in proteins) powder in PBS to obtain a solution with a concentration of 10 mg / mL. Treat the 5'-thio modified primers at a molar ratio of 10 μL: 100 μL. The primer concentration is 34 nM. Stir the obtained solution at 25°C for 30 minutes under light-protected conditions.

[0058] S15. Place the solution from S14 into the sample chamber of a 3kDA ultrafiltration tube, centrifuge at 14000g three times for 15 minutes each time, and then collect the filtrate.

[0059] S16. Incubate the primers from S15 and the antibody from S13 at room temperature for 3 hours. After the reaction is complete, add NEM to the reaction tube to make the final concentration 1 mM. Let it stand at room temperature for 30 min to close the disulfide bonds of the primers that have not bound to the antibody. Aliquot 100 μL / tube and store at -20℃ to avoid repeated freeze-thaw cycles.

[0060] When the feedstock chain is labeled -NH2, the steps of S2 are as follows (e.g. Figure 3 As shown):

[0061] S21. Prepare a 25 mM NHS acridine ester (a chemiluminescent label containing an N-hydroxysuccinimide ester (NHS) active group) stock solution in distilled DMSO. Evaporate the probe and acridine ester stock solution in a 1.5 ml conical polypropylene tube until dry at a molar ratio of 1:5.

[0062] S22, Prepare the additive solution;

[0063] S23. Vortex mix the added liquid and the dried object from S21, rotate for 2 seconds in a microcentrifuge to bring the contents to the bottom of the test tube, and incubate at 37°C for 60 minutes.

[0064] S24. Sequentially add 3.0 μL of DMSO solution of 25 mM NHS acridine ester, 1.5 μL of H2O, and 0.5 μL of HEPES (4-hydroxyethylpiperazine ethanesulfonic acid, an amphoteric organic chemical buffer) with pH 8 and concentration of 1 M to the solution in S23.

[0065] S25. Vortex and rotate the mixed solution after adding S24 again, and incubate at 37°C for another 20 minutes.

[0066] S26. Add 5 μL of 0.125M lysine to a mixture of HEPES and 50% DMSO at pH 8 and concentration of 0.1M, and add it to the solution incubated in S25. Incubate at room temperature for 30 minutes.

[0067] Before the evaporation and drying process in S21, the solution is added in the following order: 3 μL H2O, 1 μL HEPES with pH 8 and a concentration of 1 M, 4 μL LDMSO, and 2 μL DMSO ester solution of 25 mM NHS acridine ester.

[0068] When labeling the raw material chain with -NH2, the specific steps of S3 are as follows: the coupled guide chain and the raw material chain are incubated in nucleic acid hybridization solution at 37-45℃ for 1 hour. The ratio of guide chain to raw material chain is 1:10, the final concentration of guide chain is 0.1mM, and the final concentration of the two raw material chains is 1mM. After self-assembly, it becomes the luminescent detection solution stock solution.

[0069] The two raw material chains are either stem-loop molecular beacon structures, scorpion-like structures, or linear structures.

[0070] When the raw material chain is labeled with -NH2, the resulting luminescent detection solution mother liquor can be directly used to replace the acrid ester-labeled antibody component in chemiluminescent immunoassay.

[0071] In this embodiment, the experimental group forms an amplified assembly through a chain displacement reaction, realizing the detection of antibody-conjugated guide chains binding to alternating assembly of raw material chains, achieving single antibody labeling of dozens to hundreds of acridinium ester molecules, and ultimately achieving signal amplification.

[0072] Second implementation method:

[0073] Unlike the first embodiment, this embodiment serves as the control group for the first embodiment. The detection antibody used in this embodiment is the same as that used in the first embodiment, and the operation method is as follows:

[0074] In an environment with 10 mM PBS buffer and pH 8.0, the detection antibody was labeled with acridinium ester at a molar ratio of 1:10. After standing at room temperature for 1 h, glycine with a final concentration of 1% was added for blocking. The antibody was purified using a desalting column to obtain acridinium ester-labeled antibody as the luminescent detection solution.

[0075] The control group mainly involved direct antibody labeling without nucleic acid assembly, with the aim of comparing its performance with signal amplification methods based on nucleic acid assembly. According to the experimental data in Table 1, nucleic acid assembly effectively amplified the signal.

[0076] In both the first and second embodiments, the final antibody concentration in the luminescent detection solution was 0.5 μg / mL. Thrombomotor™ antigen at a concentration of 0.5 TU / mL was used for testing (test results are shown in Table 1). Testing instrument: Shine i 1910. Blank values ​​are signal values ​​obtained from samples without TM antigen, and low values ​​are signal values ​​obtained from samples using TM antigen at a concentration of 0.5 TU / mL.

[0077] Table 1

[0078]

[0079]

[0080] In the first embodiment, the luminescent detection solution stock solution was tested with different concentrations of TM antigen and curve fitting was performed. The correlation coefficient reached 0.997. Specific experimental data are shown in Table 2, and the fitted curve is attached. Figure 4 :

[0081] Table 2

[0082]

[0083] The third implementation method:

[0084] In this embodiment, the two raw material chains are labeled -SH, and a chemiluminescent detection method is used to amplify the nucleic acid assembly signal from the magnetic bead end. The antibody types are tPAIC monoclonal coated antibody and tPAIC monoclonal detection antibody.

[0085] The sequence is as follows:

[0086] T3-b: biotin-TTTTTTTTTTAATGAAACTACCGACGCCGCCATA

[0087] H3-1S: SH-TATGGCGGCGTCGGTAGTTTCATTCCCTGTAATGAAACTACCGACGCC

[0088] H3-2S: SH-AATGAAACTACCGACGCCGCCATAGGCGTCGGTAGTTTCATTACAGGG

[0089] When labeling the raw material chain with -SH, the steps in S2 are as follows: add BSA (bovine serum albumin) to 20mM PBS buffer to make a final concentration of 1% BSA as the labeling buffer. Then, add the biotinylated nucleic acid raw material and SA magnetic beads (streptavidin-coated magnetic beads) to the labeling buffer at a ratio of 1OD:10mg. Shake at 37°C for 30min.

[0090] Subsequently, the antibody was labeled with acridinium ester at a molar ratio of 1:10 in 10mM PBS buffer at pH 8.0. After standing at room temperature for 1 hour, glycine was added to a final concentration of 1% for blocking. The antibody was purified using a desalting column to obtain acridinium ester-labeled antibody as the luminescent detection solution.

[0091] The purpose of this is to maintain the same acridine ester labeling process, so as to demonstrate the superiority of the magnetic bead end amplification process.

[0092] In this embodiment, step S1 is the same as step S1 in the first embodiment.

[0093] When the raw material chain is labeled -SH, the resulting luminescent detection solution mother liquor is used directly to replace the antibody-conjugated magnetic bead component in chemiluminescent immunoassay. Through chain displacement reaction, amplification assembly is formed, thereby realizing the detection of streptavidin magnetic bead-conjugated guide chain binding alternating assembly of raw material chains. This allows for the labeling of dozens to hundreds of antibodies at a single streptavidin site. Due to the increased radius of the conjugation complex and reduced spatial site group during the alternating extension process, the number of antibodies labeled per magnetic bead is increased, ultimately achieving signal amplification.

[0094] When labeling the raw material chain with -SH, the specific steps of S3 are as follows: the magnetic bead guide chain conjugate of S2 and the antibody raw material chain conjugate of S1 are incubated in nucleic acid hybridization solution at 42℃ for 1 hour at a nucleic acid molar ratio of 1:3. The ratio of guide chain to raw material chain is 1:10. After self-assembly, it becomes the luminescent detection solution stock solution.

[0095] Fourth implementation method:

[0096] This embodiment serves as the control group for the third embodiment. The detection antibody used in this embodiment is the same as that in the third embodiment, and the operating method is as follows:

[0097] In a 20mM PBS (pH 7.2) environment, biotin was conjugated with the antibody. 6.67 nmol of antibody and 133 nmol of biotin were added to a 100 μL system and reacted at room temperature in the dark for 1 h. After the reaction was completed, 50 mM ethanolamine (pH 7.0) was added and incubated for 10 minutes to quench unreacted NHS esters, and the final concentration of magnetic beads in this embodiment and the third embodiment was kept at 20 μg / mL.

[0098] The fourth implementation method was designed as a control group for the third implementation method to verify the superiority of the nucleic acid assembly signal amplification strategy. As shown in Table 3, compared with the traditional biotin-antibody direct conjugation method, the nucleic acid assembly method has advantages in signal amplification, sensitivity and specificity. This indicates that the nucleic acid assembly amplification chemiluminescence detection method is not only feasible, but also has good detection accuracy and sensitivity.

[0099] Both the third and fourth implementation methods used a 2 ng / mL concentration of t-PAIC antigen for testing. The experimental data are shown in Table 3, where the blank value is the signal value obtained by detecting samples without tPAIC antigen, and the low value is the signal value obtained by detecting samples with a concentration of 2 ng / mL tPAIC antigen.

[0100] Table 3

[0101]

[0102] In the third embodiment, the luminescent detection solution stock solution was tested with different concentrations of t-PAIC antigen and curve fitting was performed. The correlation coefficient reached 0.996. The fitted curve is shown in [Figure number missing]. Figure 5 The specific experimental data are shown in Table 4:

[0103] Table 4

[0104]

[0105]

[0106] Additionally, using the relevant strand substitution rate model (which is existing technology and will not be elaborated further), with a temperature condition of 42 degrees Celsius, we tested the relevant structures of different sequences to determine whether they were working. After extensive testing and adjustments of the sequences, we found three sets of nucleic acid sequences that could achieve the expected goal (assembly completed within 10-15 minutes).

[0107] Group 1:

[0108] T:CTTCAGGTTTGGGGAAGAGACAACAAC

[0109] H1-1:GGGGAAGAGACAAGGTTTTGTCTCTTCCCCAAACCT

[0110] H1-2: AAACCTTTGTCTCTTCCCCAGGTTTGGGGAAGAGACA

[0111] Group 2:

[0112] T2: TTTTTTTTTTAATTGGGTGCGGCTTAGGATCTGA

[0113] H2-1: GTGCGGCTTAGGATCTGATGAAACTCAGATCCTAAGCCGCACCCAATT

[0114] H2-2: GTTTCATCAGATCCTAAGCCGCACAATTGGGTGCGGCTTAGGATCTGA

[0115] Group 3:

[0116] T3: TTTTTTTTTTTCTACCTACCTAGCTCCGAATTCC

[0117] H3-1:GGAATTCGGAGCTAGGTAGGTAGAGTAATGCCGTCTACCTACCTAGCTCCG

[0118] H3-2:TCTACCTACCTAGCTCCGAATTCCCGGAGCTAGGTAGGTAGACGGCATTAC.

[0119] In light of current practical needs, the above-described embodiments adopted in this application are not limited to these. Any changes made within the scope of knowledge possessed by those skilled in the art without departing from the concept of this application still fall within the protection scope of this invention.

Claims

1. A nucleic acid assembly-amplified chemiluminescence detection method based on dual antibodies, characterized in that, The steps are as follows: S1. The nucleic acid chain is coupled with the detection antibody. The nucleic acid chain includes a guide chain and a raw material chain. The two raw material chains H1 and H2 of the nucleic acid each have a complementary sequence. One of the raw material chains of the nucleic acid has a sequence that is complementary to the guide chain. The number of complementary bases and the annealing temperature of the raw material chain and the guide chain are greater than the number of complementary bases and the annealing temperature of the two raw material chains. S2. The signal molecule is coupled to the nucleic acid chain. The signal molecule is an acrid ester for coupling with the raw material chain or a magnetic bead for coupling with the guide chain. S3. Incubate the coupling products from S1 and S2 in nucleic acid hybridization solution to obtain the luminescent detection solution stock solution, wherein the hybridization solution is a mixture of 10mM Tris and 400mM sodium chloride. S4. The obtained luminescent detection solution stock solution can be used directly to replace the acrid ester-labeled antibody component or the antibody-conjugated magnetic bead component in chemiluminescent immunoassay.

2. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 1, characterized in that: When the signal molecule is acridinium ester, one of the leading strands of the nucleic acid chain is labeled with -SH at T1, and the two raw material strands of the nucleic acid chain are labeled with -NH2. In S1, the leading strand of the nucleic acid chain is coupled to the detection antibody, and in S2, the raw material strands of the nucleic acid chain are coupled to acridinium ester. When the signal molecule is a magnetic bead, one guide strand of the nucleic acid chain is labeled with biotin (T1), and the two raw material strands of the nucleic acid chain are labeled with -SH. In S1, the guide strand of the nucleic acid chain is coupled to the detection antibody, and in S2, the raw material strands of the nucleic acid chain are coupled to the magnetic bead.

3. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 1, characterized in that, The steps in S1 are as follows: S11. Dissolve the required amount of SMCC in DMSO to obtain a solution with a concentration of 2 mg / mL; S12. Take 100 μg of antibody into the solution in S11, then place the antibody-containing solution into the sample well of a 50 kDa ultrafiltration tube, centrifuge twice, and then adjust the volume to 200 μL with PBS. Add the solution in S11 and stir the resulting mixture in the dark. S13. Place the solution from S12 into the sample well of a 50 kDa ultrafiltration tube, centrifuge 3 times to separate the antibody from the SMCC, and then add PBS to bring the volume to 100 μL. S14. Dissolve TCEP powder in PBS to obtain a solution with a concentration of 10 mg / mL. Treat the 5'-thio modified primers at a molar ratio of 10 μL: 100 μL. The primer concentration is 34 nM. Stir the obtained solution under light-protected conditions. S15. Place the solution from S14 into the sample chamber of a 3kDA ultrafiltration tube, centrifuge 3 times, and collect the filtrate. S16. Incubate the primers from S15 and the antibody from S13 at room temperature for 3 hours. After the reaction is complete, add NEM to the reaction tube to make the final concentration 1mM. Let it stand at room temperature to close the disulfide bonds of the primers that have not bound to the antibody. Aliquot 100μL / tube and store at -20℃ to avoid repeated freeze-thaw cycles.

4. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 2, characterized in that: When labeling the raw material chain with -SH, the steps in S2 are as follows: add BSA to 20mM PBS buffer to make a final concentration of 1% BSA as the labeling buffer, and then add the biotinylated raw material chain and SA magnetic beads to the labeling buffer at a ratio of 1OD:10mg, and shake.

5. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 2, characterized in that: When the feedstock chain is labeled -NH2, the steps of S2 are as follows: S21. Prepare a 25 mM NHS acridinium ester stock solution in distilled DMSO. Evaporate the probe and acridinium ester stock solution in a 1.5 ml conical polypropylene tube until dry at a molar ratio of 1:

5. S22, Prepare the additive solution; S23. Vortex mix the added liquid and the dried object from S21, rotate in a microcentrifuge to bring the contents to the bottom of the test tube, and incubate. S24. Sequentially add a DMSO solution of 25mM NHS acridine ester, H2O, and HEPES with a pH of 8 and a concentration of 1M to the solution in S23. S25. Vortex and rotate the mixed solution after adding the ingredients in S24, and then incubate it again. S26. Add 0.125M lysine to a mixture of HEPES and 50% DMSO at pH 8 and concentration of 0.1M, add it to the solution incubated in S25, and incubate at room temperature.

6. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 5, characterized in that: Before the evaporation and drying process in S21, the solution is added in the following order: H2O, HEPES at pH 8 and concentration of 1M, DMSO, and DMSO ester solution of 25mM NHS acridine ester.

7. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 4, characterized in that: When labeling the raw material chain with -SH, the specific steps of S3 are as follows: the magnetic bead guide chain conjugate of S2 and the antibody raw material chain conjugate of S1 are incubated in nucleic acid hybridization solution at 37-45℃ for 1-2 hours at a nucleic acid molar ratio of 1:2-1:

10. The ratio of guide chain to raw material chain is 1:2-1:

200. After self-assembly, it becomes the luminescent detection solution stock solution.

8. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 2, characterized in that: When labeling the raw material chain with -NH2, the specific steps of S3 are as follows: the coupled guide chain and the raw material chain are incubated in nucleic acid hybridization solution at 37-45℃ for 1-2 hours. The ratio of guide chain to raw material chain is 1:2-1:

200. After self-assembly, it becomes the luminescent detection solution stock solution.

9. The nucleic acid assembly amplification chemiluminescence detection method based on dual antibodies according to claim 1, characterized in that: The two raw material chains are one of the following: stem-loop molecular beacon structure, scorpion-like structure, or linear structure.

Images