Preparation method and application of vitronectin, stromal cell-derived factor-1 or fusion protein hydrogel thereof
By constructing a fusion protein hydrogel of polinecin and stromal cell-derived factor-1, the problems of cumbersome stem cell culture and SDF1 diffusion and degradation in existing technologies have been solved, enabling the promotion of stem cell recruitment and proliferation under serum-free conditions, which can be applied to the field of tissue repair.
Patent Information
- Application Number
- CN202511116439.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-11
- Publication Date
- 2025-11-18
AI Technical Summary
Existing tissue-engineered skin repair technologies require co-culturing with stem cells, which increases the complexity and time involved. Furthermore, in vitro culture of stem cells carries risks of damage to stem cells and contamination. The rapid diffusion and degradation of SDF1 within the scaffold limits its sustained impact.
A fusion protein (VTN-SDF1) of vilinkin (VTN) and stromal cell-derived factor-1 (SDF1) was constructed using a gene recombination method and prepared into a hydrogel. VTN was used as a sustained-release carrier of SDF1 to form a multifunctional in situ induced tissue repair material, which promotes the adhesion of stem cells and maintains their stemness.
It has been shown that it can promote the recruitment and survival of stem cells under serum-free conditions, promote the proliferation and migration of multiple cell types, accelerate tissue repair, and be applied to skin wound healing, cartilage repair, osteoarthritis treatment and bone defect repair.
Smart Images

Figure CN120965890A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a preparation method and application of a fibronectin (VTN) and stromal cell-derived factor-1 (SDF1) fusion protein (VTN-SDF1) hydrogel. BACKGROUND
[0002] The skin is directly in contact with the external environment, and will be damaged due to different factors.
[0003] Tissue engineered skin provides a new treatment mode for skin wound healing in clinic. However, most of the reported tissue engineered skin needs to be co-cultured with seed cells, especially stem cells or progenitor cells in vitro, to promote the repair of tissue defects. This method increases the step of cell culture, makes the repair process cumbersome, and also prolongs the repair time. In addition, in vitro culture of stem cells will damage their stemness and homing ability, and there is also a risk of contamination. Therefore, this hinders the rapid personalized customization of tissue engineering and its application in clinic.
[0004] In situ induced tissue regeneration technology has great potential in using endogenous stem cells for tissue repair. In situ induced tissue regeneration uses endogenous stem cells for tissue repair, avoiding the limitations of co-culturing scaffold materials with living stem cells. In this process, aptamers, functional peptides and growth factors are usually used to modify the scaffold to capture endogenous stem cells in the body. Stromal cell-derived factor-1 (SDF1) is a kind of chemotactic cytokine, which is a powerful chemotactic factor, and is of great significance to in situ induced tissue regeneration.
[0005] SDF1 is composed of 68 amino acids, and usually forms two pairs of disulfide bonds by four conserved cysteine residues to form its special structure. SDF1 is a small molecule protein with important role in biology, which has six subtypes (alpha, beta, gamma, delta, epsilon, zeta), and the molecular weight is about 8-12 kDa. There have been studies on the application of SDF1 in tissue engineering, but direct blending incorporation is a common method to introduce SDF1 into the scaffold. SDF1 will quickly diffuse and degrade, limiting its sustained influence on stem cell recruitment. In order to solve this problem, researchers have tried various methods, such as chemical fixation of SDF1 and co-coating with other growth factors, to enhance the effect of tissue repair. However, these methods, although solving the problem of endogenous stem cell recruitment, ignore how stem cells firmly settle in the defect site, maintain vigorous division and proliferation capacity during tissue repair, and stop growing after completing repair. Therefore, finding a controllable release carrier for SDF1 can enhance the local growth of stem cells, maintain stem cell stemness in the short term, and achieve perfect matching of material degradation and repair rate.
[0006] There is a protein in the extracellular matrix-vitronectin (VTN), a kind of adhesive multifunctional glycoprotein, exists in the extracellular matrix and plasma, synthesized in the liver and secreted into the plasma, can be used as the main controller of the extracellular environment. The N-terminal of VTN binds to a cell receptor binding site characterized by Arg-Gly-Asp (RGD) sequence, and the SMB, RGD domain can promote cell adhesion. VTN is known to promote cell adhesion, migration and matrix degradation by binding to integrin, etc., thereby promoting tissue repair and regeneration. According to the relevant reports, VTN-mediated signal transduction can change the actin cytoskeleton, focal adhesion formation and ECM gene expression, thereby affecting the characteristics of cell adhesion and migration downstream. VTN is also a "nourishing factor" for the culture of some mesenchymal stem cells and induced pluripotent stem cells. Vitronectin can also promote the survival of mesenchymal stem cells under serum deprivation stress, thereby being applied to the culture of clinical-grade stem cells.
[0007] In addition, VTN is not only an ECM protein, but also a rich protein circulating in plasma. VTN is expressed in plasma at a high concentration (200-700 μg / mL) and also exists in different human tissues. Its large amount of existence in vivo does not cause immune response of the body. Most of the circulating blood is in the form of VTN monomer, while the VTN combined with extravascular cells is a multimer. Studies have reported that the inactive form of VTN in blood is converted to its active form after injury, and active VTN regulates the balance between coagulation and fibrinolysis system and plays a key role in tissue remodeling. Vitronectin regulates fibrinolysis during wound healing, strengthens wound contraction and controls the size and number of microvessels in early healing wounds to control the formation of vascular thrombosis. VTN has been shown to promote endothelial cell migration by interacting with leukocyte Mac-1 during adhesion and extravasation. Although ECM-derived VTN is polymerized in response to various types of tissue injury, and this transformation is involved in the functional changes of blood vessels, such as angiogenesis.
[0008] The various functions of VTN can assist in strengthening the role of SDF1α in tissue repair, promote stem cell adhesion, maintain stem cell stemness in the short term, promote vascular regeneration and accelerate repair. Therefore, VTN is used as a sustained-release carrier of SDF1, and a fusion protein of VTN and SDF1 is constructed to form an integrated and multifunctional in-situ induced tissue repair material.
[0009] In recent years, researchers have tried to use gene recombination to construct slow-release protein and growth factor fusion proteins to optimize the complex process of slow-release protein and growth factor, so as to effectively control the release of growth factor. Studies have shown that by skillfully designing the coding sequence of the fusion protein, adding suitable connecting peptides such as (G)n, (GGGGS)n between proteins, a fusion protein with functional activity and effective slow-release growth factor can be prepared, and it has been successfully used for tissue defect repair. At present, there is no research report on recombinant VTN-SDF1 fusion protein at home and abroad. SUMMARY
[0010] In order to overcome the shortcomings of the prior art, the purpose of the present application is to provide a preparation method and application of a vitronectin (VTN) and stromal cell-derived factor-1 (SDF1) fusion protein (VTN-SDF1) hydrogel. Vitronectin and stromal cell-derived factor-1 are fused through a flexible linker, and the obtained fusion protein is cross-linked to form a hydrogel. The hydrogel has the functions of recruiting stem cells and maintaining the stemness of stem cells in situ, and can be applied to skin tissue wound healing, cartilage repair, osteoarthritis clinical treatment, and bone defect repair. It has important significance for wound healing, body injury repair and regeneration.
[0011] In order to achieve the above purpose, the technical scheme adopted by the present application is: A VTN-SDF1 fusion protein based on vitronectin and stromal cell-derived factor-1, characterized in that the fusion protein VTN-SDF1 is prepared by artificial recombination and microbial exogenous expression of vitronectin (VTN), a flexible linker, a tag protein and stromal cell-derived factor-1 (SDF1), wherein: The vitronectin is full-length or a partial functional domain or a functional polypeptide of human or animal origin. The stromal cell-derived factor-1 is full-length or a partial functional domain or a functional polypeptide of human or animal origin.
[0012] The tag protein serves as a purification agent and is one or more of HIS tag, SUMO tag or GST tag.
[0013] The flexible linker connects the vitronectin and the stromal cell-derived factor-1, and is a highly repetitive polypeptide with the functions of connection, folding promotion and activity enhancement.
[0014] The fusion protein is followed by one of GFP (green fluorescent protein), RFP (red fluorescent protein) and YFP (yellow fluorescent protein) for tracking.
[0015] A vitronectin, stromal cell-derived factor-1 or its fusion protein hydrogel, characterized in that the vitronectin, stromal cell-derived factor-1 or its fusion protein is crosslinked by an enzyme or a chemical crosslinking agent or a gel adhesive to obtain the hydrogel.
[0016] The hydrogel is obtained by crosslinking the fusion protein with an enzyme, and is prepared by crosslinking the fusion protein with transglutaminase (TGase) or an oxidase.
[0017] The oxidase is one of tyrosinase, laccase, peroxidase or sulfhydryl oxidase.
[0018] The hydrogel is obtained by crosslinking the fusion protein with a chemical crosslinking agent, and is prepared by crosslinking the fusion protein with glutaraldehyde, proanthocyanidin or genipin.
[0019] The hydrogel is obtained by crosslinking the fusion protein with a gel adhesive, and is prepared by crosslinking the fusion protein with polyvinyl alcohol, carbomer, chitosan, gelatin, hyaluronic acid or trehalose.
[0020] The hydrogel has a porous three-dimensional network structure with a pore size of 30 nm-300 um, which can be applied to drug delivery systems, stem cell recruitment and culture, and medical beauty filling.
[0021] A preparation method of a hydrogel material based on a vitronectin, stromal cell-derived factor-1 fusion protein, characterized in that the method comprises the following steps: First step: separately design the vitronectin gene sequence (VTN) and the stromal cell-derived factor-1 (SDF1) gene sequence, and then artificially recombine and microbially exogenously express the separately designed vitronectin, flexible linker, tag protein and separately designed stromal cell-derived factor-1 gene sequence to obtain a fusion protein (VTN-SDF1); Second step: double enzyme digestion of the synthesized fusion protein gene fragment and the vector pET28a(+); Third step: recovery of the target fragment after double enzyme digestion by gel recovery; Fourth step: connection of the recovered target fragment, followed by plate screening to obtain positive clones, and sequencing to detect complete correctness; Fifth step: shake the positive clone with correct sequencing and extract the plasmid, and then introduce it into the competent (BL21(DE3)) of E.coli by heat shock to carry out plate culture, and the competent can express the fusion protein; Sixth step: pick the colony after transformation and plate culture, and when the OD600 of the bacterial liquid is 0.6-0.8, add IPTG inducer to induce for 4-6h, and then collect the bacterial liquid by centrifugation to obtain bacterial slurry for standby; Seventh step: lyse the bacterial slurry, break by ultrasonic, and select different purification modes according to whether the protein is in supernatant or precipitate to separate and purify the protein; Eighth step: desalt the purified protein, and obtain the freeze-dried fusion protein by freeze-drying.
[0022] Further, other prokaryotic expression vectors or eukaryotic expression vectors can be selected in vitro, and prokaryotic cells and eukaryotic cells are selected according to the expression vectors.
[0023] Further, the material of the VTN-SDF1 hydrogel based on the fusion protein of vitronectin (VTN) and stromal cell-derived factor-1 (SDF1) is applied to skin, cartilage repair, osteoarthritis or bone defect repair and other tissues.
[0024] Compared with the prior art, the beneficial effects of the present application are that: The VTN-SDF1 hydrogel based on the fusion protein has good biocompatibility, no death case in the animal functional and safety experiment, and the cell proliferation and migration of the present application show significant compared with the control group, and the tissue has no necrosis symptoms; the present application uses the method of gene recombination to construct the fusion protein of slow-release protein and growth factor, so as to optimize the complex process of slow-release protein and growth factor, thereby effectively controlling the release of growth factor. The present application uses the method of genetic engineering to construct a new type of VTN-SDF1 fusion protein, and verifies its biological activity and evaluates its ability to promote skin defect repair through in vitro and in vivo experiments. The VTN of the present application can assist in strengthening the effect of SDF1 in tissue repair, promote the adhesion of stem cells, maintain the stemness of stem cells in the short term, promote the recruitment and survival of stem cells in the absence of serum, promote the proliferation and migration of multiple cell types, promote vascular regeneration to accelerate repair, etc. The present application can be applied to skin tissue wound healing, cartilage repair, clinical treatment of osteoarthritis and bone defect repair, and has important significance for wound healing, body damage repair and regeneration. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 It is the structure diagram of the fusion vitronectin and stromal cell-derived factor-1 hydrogel in the examples of the present application; wherein, Figure 1 The A diagram in the figure includes vitronectin, flexible linker protein and stromal cell-derived factor-1, and a cross-linking bond.Figure 1 Figure 2B includes vitronectin, flexible linker protein, and stromal cell-derived factor-1, plus chitosan or gelatin or other gelling agents.
[0026] Figure 2 Figure 1 is a schematic diagram of the method for obtaining the hydrogel of the fusion vitronectin and stromal cell-derived factor-1 in the present application; wherein, Figure 2 Figure 2A is an enzyme cross-linking method; Figure 2 Figure 2B is a hydrogel adhesion method.
[0027] Figure 3 Figure 3 is a double enzyme digestion verification diagram of the fusion vitronectin and stromal cell-derived factor-1 expression plasmid in the present application; 1 is the original plasmid; 2 is the double enzyme digestion of the original plasmid; 3 is the double enzyme digestion of the original plasmid.
[0028] Figure 4 Figure 4 is a SDS-PAGE and Western-Blot diagram of the induced expression of the fusion protein VTN-SDF1 and VTN in the prokaryotic system in the present application; wherein, M is a protein marker; Figure 4 Figure 4A is a SDS-PAGE diagram of the induced expression of the fusion protein VTN-SDF1, 1 before induction, 2 after induction, 3 ultrasonic supernatant, 4 ultrasonic precipitate; Figure 4 Figure 4B is a WB diagram of the induced expression of the fusion protein VTN-SDF1, the bands are the same as in Figure 4A; Figure 4 Figure 4C is a SDS-PAGE diagram of the induced expression of the fusion protein VTN, the bands are the same as in Figure 4A; Figure 4 Figure 4D is a WB diagram of the induced expression of the fusion protein VTN, the bands are the same as in Figure 4A; A and B are one case of the fusion vitronectin and stromal cell-derived factor-1, and can also be fusion of other vitronectin and stromal cell-derived factor-1 of different lengths; wherein C and D are one case of the fusion vitronectin corresponding to the fusion protein, and can also be different length vitronectin and fusion protein corresponding to the fusion protein.
[0029] Figure 5 Figure 5 is the result of co-culturing the fusion protein with endothelial cells in the present application; wherein, Figure 5 Figure 5A shows that the fusion protein is co-cultured with endothelial cells for 1 day, 2 days, and 3 days, and the phenotype of the endothelial cells after adding the fusion protein is compared with the control group (no fusion protein added in the culture medium), showing consistent effects and the cells are more and more dense. Figure 5 Figure 5B is the result of CCK-8 quantitative detection of endothelial cell proliferation. Figure 5 Figure 5C is a migration diagram of endothelial cells; Figure 5 Figure 5D is the migration rate of endothelial cells, compared with the control group, the fusion protein can significantly promote the migration of endothelial cells; Figure 5 Figure 5E is a diagram of the formation of endothelial cell blood vessels; Figure 5Fig. 6A-Fig. 6H are the statistical diagrams of the number of tubes, the number of branches and the number of nodes of the endothelial cell tube forming blood vessels.
[0030] Figure 6 The test results of cell compatibility in the application; wherein the BMSCs are rabbit-derived bone marrow mesenchymal stem cells; wherein the HDF is human-derived dermal cells; Figure 6 Fig. 6A is the result of co-culturing BMSCs with the fusion protein, and the CCK-8 quantitative detection is used at 1st day, 3rd day, 5th day, and the CCK-8 quantitative detection, the number of cells in the VTN-SDF1 group is obviously higher than that in the control group; Figure 6 Fig. 6B is the result of co-culturing HDF with VTN-SDF1, and the CCK-8 quantitative detection is used at 1st day, 2nd day, 3rd day, and the number of cells in the VTN-SDF1 group is obviously higher than that in the control group; Figure 6 Fig. 6C, 6D are the results of crystal violet staining and ImageJ analysis that the fusion protein VTN-SDF1 can significantly promote the migration of BMSCs and the statistical diagram; Figure 6 Fig. 6E, 6F are the results of crystal violet staining and ImageJ analysis that the fusion protein VTN-SDF1 can significantly promote the migration of HDF and the statistical diagram.
[0031] Figure 7 The test results of stem cell recruitment in the application; the cells are fixed at 12h and crystal violet staining is performed, and it is found that the number of cells in the VTN-SDF1 group is obviously higher than that in the VTN group and the control group.
[0032] Figure 8 The application obtains chitosan (CS) hydrogel loaded with fusion protein VTN-SDF1 (referred to as VTN-SDF1@CS), VTN hydrogel (referred to as VTN@CS) and chitosan hydrogel (referred to as CS); wherein, Figure 8 Fig. 6A shows the macroscopic diagram before and after gelation; Figure 8 Fig. 6B is a hydrogel electron microscope diagram; Figure 8 Fig. 6C shows the evaluation of the water contact angle of CS, VTN@CS and VTN-SDF1@CS; Figure 8 Fig. 6D is a FTIR spectrum.
[0033] Figure 9 The fusion protein in the application is the wound healing condition and wound healing rate; wherein, Figure 9 Fig. 6A is the wound healing condition; Figure 9 Fig. 6B is the wound healing rate.
[0034] Figure 10 The fusion protein in the application is the HE and MASSON staining in wound healing; wherein, Figure 10 Fig. 6A is HE; Figure 10Figure 8B is a graph of the micro-CT results of the fusion protein in the invention for the repair of bone defects.
[0035] Figure 11 Figure 8B is a graph of the micro-CT results of the fusion protein in the invention for the repair of bone defects.
[0036] Figure 12 Figure 8B is a graph of the micro-CT results of the fusion protein in the invention for the repair of bone defects. Figure 12 Figure 8A is a three-dimensional reconstruction graph of the subchondral bone thickness at 8 weeks (8W). Figure 12 Figure 8B is a graph of the micro-CT results of the fusion protein in the invention for the repair of bone defects.
[0037] Figure 13 Figure 8B is a graph of the micro-CT results of the fusion protein in the invention for the repair of bone defects. DETAILED DESCRIPTION
[0038] The invention is further described below in conjunction with examples.
[0039] The invention uses genetic engineering methods to construct a new VTN-SDF1 fusion protein, and verifies its biological activity and evaluates its ability to promote skin defect repair through in vitro and in vivo experiments. VTN can assist in strengthening the role of SDF1 in tissue repair, promote stem cell adhesion, maintain stem cell stemness in the short term, promote stem cell survival in the absence of serum, promote the proliferation and migration of multiple cell types, promote vascular regeneration to accelerate repair, etc. Therefore, the invention uses VTN as a sustained-release carrier for SDF1, constructs a fusion protein of VTN and SDF1, and forms a one-piece, multifunctional in-situ tissue repair material with hydrogel.
[0040] Hydrogel, as a very hydrophilic soft material, has the following advantages: (1) it has both solid and liquid behavior, which is reflected in its ability to shape according to the shape it adapts and maintain a certain shape and volume, while the liquid can diffuse or penetrate from the hydrogel; (2) it has a flexible and porous three-dimensional structure that allows nutrients and oxygen to diffuse effectively, can carry and release cytokines, growth factors, chemotactic factors and drugs, and promote tissue repair. Hydrogel is widely used in minimally invasive treatment of tissue damage, especially in the repair of joint damage, which has a very high incidence at present. However, due to the special anatomical structure of articular cartilage, stem cells are difficult to penetrate and repair cartilage tissue. It has been reported that SDF1 can recruit bone marrow mesenchymal stem cells to penetrate the cartilage layer, and stem cells differentiate into chondrocytes in the cartilage environment to complete cartilage repair. Therefore, the hydrogel containing SDF1 prepared in the invention is not only applied to skin damage repair, but also tried to be applied to bone defect repair, articular cartilage repair and osteoarthritis treatment.
[0041] The following examples are provided as explanations of the present invention, but the present invention is not limited to the following examples.
[0042] like Figure 1 As shown: This invention provides a hydrogel material containing vitrin (VTN), stromal cell-derived factor-1 (SDF1), or their fusion protein (VTN-SDF1). The hydrogel has a porous three-dimensional network structure and can function in skin wounds, cartilage, and other damaged areas. Its pore size is 30 nm-300 μm. The hydrogel is obtained through biological, physical, or chemical cross-linking methods or by loading vitrin (VTN), stromal cell-derived factor-1 (SDF1), or their fusion protein (VTN-SDF1) onto other hydrogel matrices. The recombinant protein is prepared through artificial recombination and exogenous expression by microorganisms.
[0043] like Figure 1 As shown: The recombinant protein described in the embodiments of the present invention is not limited to prokaryotic expression, but can also be expressed in eukaryotes. There are no special requirements for the host and corresponding promoter for the expression of the recombinant protein.
[0044] like Figure 1 As shown: The recombinant protein described in the embodiments of the present invention is not limited to VTN-SDF1, but may also be vitrin (VTN) or stromal cell-derived factor-1 (SDF1).
[0045] like Figure 1 As shown: The VTN-SDF1 fusion protein in the embodiments of the present invention also includes a flexible linker. The flexible linker is not limited to (GGGGS)n, n=1-6, but can also be (G)n, n=6-8, etc., where G is glycine and S is serine.
[0046] like Figure 1 As shown: The crosslinking described in the embodiments of the present invention includes physical crosslinking, chemical reagent crosslinking and enzyme crosslinking, including thermal crosslinking, microwave crosslinking, ultraviolet crosslinking, glutaraldehyde, proanthocyanidins, genipin crosslinking, TG enzyme crosslinking and oxidase crosslinking.
[0047] like Figure 1 As shown: The hydrogel described in the embodiments of the present invention is not limited to chitosan, but may also be gelatin, hyaluronic acid, trehalose, carbomer, polyvinyl alcohol, F127 and quaternary ammonium tannic acid chitosan gel, etc.
[0048] In the embodiments of the present invention, the sequence order of the recombinant protein gene or the upstream and downstream relationship of the protein can be changed.
[0049] In this embodiment of the invention, the sequences of the linker connecting the two and other recombinant proteins are not limited; the purification method of the recombinant protein and the corresponding purification linker tag are not limited. Example
[0050] Construction of eukaryotic expression plasmid of vitronectin, cell matrix-derived factor-1 and fusion protein thereof.
[0051] Step one: Obtain and optimize the natural VTN full-length gene sequence (1437bp, Pichia pastoris preferred, as follows) for synthesis, the sequence is as follows:
[0052] Step two: Obtain and optimize the natural SDF1 full-length gene sequence (282bp, Pichia pastoris preference, as follows) for synthesis, the sequence is as follows: ATGAACGCTAAGGTAGTGGTTGTCCTGGTACTAGTGTTGACGGCGCTGTGTTTGAGTGATGGGAAGCCAGTCTCACTTTCTTATCGGTGCCCGTGCCGTTTCTTTGAGTCCCATGTAGCACGAGCTAACGTGAAACACCTCAAAATATTAAATACACCCAATTGTGCGCTTCAAATTGTTGCCAGACTAAAGAACAATAATAGGCAAGTTTGTATAGACCCTAAACTCAAGTGGATTCAAGAGTACCTCGAAAAAGCCTTAAACAAGCGCTTTAAAATGTGA.
[0053] Step three: Connect the natural VTN protein gene with SDF1 gene sequence through flexible linker and perform synthesis (1746bp, Pichia pastoris preference, as follows), the sequence is as follows: Embodiments
[0054] Prokaryotic expression plasmid construction and verification of vitronectin, cell matrix-derived factor-1 and its fusion protein.
[0055] Step one: obtain and optimize the natural VTN partial functional gene sequence (864bp, E. coli preference, as follows) for synthesis, the sequence is as follows: GATCAAGAATCATGTAAAGGAAGGTGCACAGAGGGCTTTAATGTCGATAAAAAATGCCAATGTGATGAATTGTGCTCCTATTACCAGAGCTGCTGCACCGACTACACCGCAGAATGCAAACCGCAAGTGACTCGCGGTGATGTGTTTACGATGCCGGAAGATGAGTACACGGTGTACGATGATGGCGAAGAGAAGAACAATGCCACCGTTCATGAACAGGTGGGCGGTCCGAGCTTGACCAGCGATCTGCAAGCTCAGAGCAAAGGTAATCCGGAGCAGACCCCGGTTTTGAAGCCCGAGGAGGAAGCGCCTGCACCAGAGGTGGGTGCTAGCAAGCCGGAAGGCATCGACTCTCGTCCGGAGACGCTGCATCCGGGTCGTCCGCAGCCGCCGGCGGAAGAGGAACTGTGCTCTGGTAAACCGTTTGACGCCTTCACCGATCTGAAGAACGGTTCCCTGTTCGCCTTCCGCGGTCAGTACTGCTATGAACTGGACGAGAAAGCAGTTCGTCCAGGTTATCCGAAACTTATCCGCGATGTTTGGGGTATCGAAGGTCCGATTGACGCTGCGTTCACTCGCATTAACTGCCAAGGTAAGACCTATTTGTTCAAGGGCTCCCAATACTGGCGTTTCGAGGACGGCGTTTTAGACCCTGACTATCCGCGTAACATCAGCGACGGTTTCGATGGTATCCCGGATAACGTAGACGCTGCGCTGGCGCTGCCGGCGCACAGCTATAGCGGCAGAGAACGTGTTTACTTCTTTAAGGGTAAACAGTACTGGGAGTACCAGTTTCAGCATCAGCCGTCGCAAGAAGAGTGCGAAGGCTCGAGCTTGTCTGCGGTTTTTGAGCACTTTGTCGAC.
[0056] Step two: Obtain and optimize the sequence of the natural SDF1 partial functional gene (219bp, E. coli preferred, as follows) for synthesis, as follows: CCAGTGAGCCTGAGCTATCGTTGTCCGTGTCGTTTCTTTGAGTCCCACGTGGCGCGCGCAAATGTCAAACATCTGAAGATCCTCAACACCCCGAATTGTGCGCTGCAAATTGTTGCGCGCCTGAAGAACAACAACCGTCAGGTCTGTATTGACCCGAAACTGAAGTGGATTCAAGAATACCTGGAAAAGGCGTTGAACAAACGTTTCAAGATGGTCGAC.
[0057] Step three: The natural VTN partial functional gene sequence is connected with the SDF1 partial functional gene sequence through a flexible linker and synthesized (1113bp, Escherichia coli preferred, as follows), and the sequence is as follows:
[0058] Step four: select the appropriate enzyme cutting site after optimization of both ends, here the prokaryotic use (BamH I / Hind III), sent to the third party company synthesis, the synthesized target gene is stored in pET28a. By double enzyme digestion of blank expression vector and the target gene storage vector, 37℃, 2h, after DNA gel electrophoresis, cut the gel recovery after enzyme cutting gene fragments, under the action of T4 ligase for half an hour, then into the TOP10 competent and incubation plate culture 12h, pick single clone and sequencing, sequencing success of single clone is the strain carrying the target protein expression vector. Finally, the strain is expanded, and the plasmid is extracted, which can obtain vitronectin, stromal cell-derived factor-1 and its fusion protein expression vector. Example
[0059] Induced expression and purification of vitronectin, stromal cell-derived factor-1 and its fusion protein.
[0060] Step one: construction and verification of prokaryotic expression plasmid of vitronectin, stromal cell-derived factor-1 and its fusion protein; Step two: vitronectin, stromal cell-derived factor-1 and its fusion protein expression vector is introduced into the competent cells of the E. coli protein expression system by the way of prokaryotic heat shock transformation (42℃ water bath for 90 seconds). Single colony is picked from the transformation plate and inoculated into 10mL LB liquid medium containing 100μg / mL kanamycin, 37℃, 220 rpm for about 5h until the bacterial solution is obviously turbid, OD600 is about 0.6-0.8. Add 10μL 100μg / mL IPTG, 37℃, 220rmp induction culture for 4h. Collect the bacterial solution, centrifuge to collect the supernatant and precipitate, and detect the supernatant and precipitate samples by SDS-PAGE / WB gel electrophoresis (as shown in the figure) respectively. Figure 4 Step three: the bacterial slurry obtained in step two can be lysed by bacterial lysis. Before lysis, wash the bacterial body once with purified water. Add lysis buffer to the collected bacterial body at a ratio of 1:10-1:20 (w / v). After suspension, high pressure homogenization treatment is carried out, then centrifugation at 8000r for 30min, discard the supernatant, collect the precipitate, weigh, calculate the proportion of inclusion body protein in bacterial body. Lysis buffer: 50mM Tris, 0.5mM EDTA, 50mM NaCl, pH 8.0.
[0061] To the above precipitate, add washing liquid 1 at a ratio of 1:20-1:30 (w / v), stir at a constant speed for 30 min, centrifuge at 8000 rpm for 30 min at 4°C, discard the supernatant, and collect the precipitate; under the same conditions, respectively, carry out washing 2 and washing 3, then weigh, and determine the weight of the inclusion body protein after washing. Washing liquid 1: 50 mM Tris, 0.1 M NaCl, 0.1 mM EDTA, 5% glycerol, 0.1 mM DTT, 1% Triton X-100, pH 8.0; washing liquid 2: 50 mM Tris, 0.1 M NaCl, 0.1 mM EDTA, 5% glycerol, 0.1 mM DTT, 1 M urea, pH 8.0; washing liquid 3: 50 mM Tris, 0.1 M NaCl, 5% glycerol, 1 M urea, pH 8.0.
[0062] To the above washed inclusion body, add denaturing liquid at a ratio of about 1:20-1:30 (w / v), adjust the pH to 9.00±0.02 (adjust the pH after adding the protein) at 25±1°C, and stir at a constant speed at 25°C overnight; then centrifuge at 12000 rpm for 30 min at 25°C, and take the supernatant. Measure the protein concentration. Denaturing liquid: 50 mM Tris, 8 M urea, 20 mM DTT, pH 9.00±0.02 (add DTT before adding the protein).
[0063] Dilute the denaturing liquid to a refolding liquid at a volume ratio of about 1:20-1:30 (the volume of the denaturing liquid, the pH is ignored). After placing the refolded protein liquid at 4°C for 48 hours, desalt it using a dialysis bag. Then freeze-dry and store; Refolding liquid: 50 mM Tris, 150 mM NaCl, 0.5 M L-Arg, 0.1 mM GSSG, 1 mM GSH, 10% glycerol, pH 8.0±0.02; dialysis liquid: water.
[0064] In this example, vitronectin is used as a control group. Example
[0065] Verification of the cell functionality of vitronectin, cell matrix-derived factor-1, and fusion protein thereof.
[0066] Step 1: Construction and verification of prokaryotic expression plasmids of vitronectin, cell matrix-derived factor-1, and fusion protein thereof; Step 2: Induced expression and purification of vitronectin, cell matrix-derived factor-1, and fusion protein thereof; Step three: Purification of freeze-dried samples, the experiment of dissolving filtration was carried out. The 12 mm of the crawling piece was put into the 12 hole plate, and the ultraviolet sterilization was carried out overnight; when the cell culture reached about 80% of the density, the cells were digested and centrifuged to dilute the cells to 1x10 5 / ml; the cell suspension was seeded on the crawling piece in the 12 hole plate according to the proportion of 1 ml / hole, and the protein solution of VTN, VTN-SDF1 with the concentration of 100 μg / ml prepared by DMEM was added for culture, and PBS was washed for 3 times at the 1st day, the 2nd day and the 3rd day of culture respectively, and 4% PFA was fixed at 4°C overnight; after PBS washing, the first antibody (5% BSA dilution) was applied, and the incubation was carried out at 4°C overnight; after PBS washing, the second antibody was incubated at 37°C for 1h; after PBS washing, the AMCA staining solution was added, and the staining was carried out at room temperature for 20 min; after PBS washing, the DAPI staining solution was added, and the staining was carried out at room temperature for 8-10 min; after PBS washing for 3 times with 5 min each time, 80% of the glycerol was added for mounting, and the observation and photographing were carried out under the confocal microscope to obtain the A graph of figure Figure 5 . The cell culture reached about 80% of the density, the cells were digested and centrifuged, and the cell suspension was diluted to 2x10 4 / ml; according to 100 μl / every hole, the cell suspension was added in the 96 hole plate, then according to the proportion of 100 μl / every hole, the VTN, VTN-SDF1 recombinant protein solution with the concentration of 100 μg / ml, 200 μg / ml prepared by the culture medium and the ordinary culture medium alone as the control group were added, and each group had 6 repeats; at the 1st day, the 2nd day and the 3rd day, the culture medium was removed, 100 μl / every hole of the culture medium containing 10% CCK-8 was added, and the incubation was carried out in the 37°C incubator for 2h, and the OD value at 450 nm was measured by using the enzyme label instrument to obtain the B graph of figure Figure 5 . The cell culture reached about 80% of the density, the cells were digested and centrifuged, and the cell suspension was diluted to 2x10 6 / ml, and the cell suspension was added in the 12 hole plate according to 1 ml / every hole, and the cell was placed in the 37°C incubator for 12h; after the cell adhered, the 1% FBS culture medium was replaced for starvation treatment for 12h, the cross line was drawn vertically to the hole plate by using the gun head of 10 μL pipette gun, the culture medium was removed, and PBS was washed for 3 times. The suspended cells were removed; the VTN, VTN-SDF1 recombinant protein solution prepared by DMEM was added, and the culture was carried out in the 37°C, 5% CO2 incubator for 48h, and then the cells were fixed by 4% PFA, and then the cells were stained by crystal violet. After washing with ddH2O, the photographing was carried out at the cross point in the hole plate by using the inverted fluorescence microscope to obtain the C graph of figure Figure 5 . The migration area was analyzed by using the Image J software, and the migration rate was calculated Figure 5D graph. The Matrigel was dissolved at 4°C the day before, 96-well plates, 200 μl were pre-cooled at 4°C overnight, and the Matrigel was added to the 96-well plates at a ratio of 100 μl / well, and the plates were placed in a 37°C incubator for 40 min to allow the gel to set. Care was taken to ensure that no air bubbles were present when the Matrigel was added. The HUVECs were cultured until the cell density was about 80%, and the cells were digested and centrifuged, and the cells were resuspended in 20% FBS complete medium and counted. The cell suspension was diluted to 3 x 10 6 / ml. After the Matrigel gel set, the cell suspension was added to the 96-well plates at a ratio of 100 μl / well, and the cells were added vertically at the center point. Protein solutions of VTN, VTN-SDF1 prepared in DMEM were added, and DMEM was used as a control group, with 3 replicates in each group. The plates were placed in a 37°C, 5% CO2 cell incubator for 8 h, and inverted fluorescence microscopy was used to photograph the HUVECs to determine the number of tubes formed. Figure 5 E graph, and the number of vessels was analyzed using ImageJ software. Figure 5 F graph, the intersection of the vessels Figure 5 G graph and the number of vessel branches Figure 5 H graph (as shown in the figure). Figure 5
[0067] In this example, vitronectin was used as a control group. Example
[0068] Cellular functional verification of vitronectin, stromal cell-derived factor-1 and their fusion proteins.
[0069] Step 1: Prokaryotic expression plasmid construction and verification of vitronectin, stromal cell-derived factor-1 and their fusion proteins; Step 2: Induced expression and purification of vitronectin, stromal cell-derived factor-1 and their fusion proteins; Step 3: The cell compatibility of the freeze-dried samples was tested using known methods in the prior art, such as cell proliferation, cell migration and stem cell recruitment. The test results are shown in the figures. BMSCs are rabbit-derived bone marrow mesenchymal stem cells; HDF is human dermal cells; and Figure 6 A graph in Figure shows the results of co-culturing BMSCs with the fusion protein. CCK-8 was used to quantitatively detect the number of cells at 1 day, 3 days and 5 days, and the number of cells in the VTN-SDF1 group was significantly higher than that in the control group. Figure 6 B graph in Figure shows the results of co-culturing HDF with VTN-SDF1. CCK-8 was used to quantitatively detect the number of cells at 1 day, 2 days and 3 days, and the number of cells in the VTN-SDF1 group was significantly higher than that in the control group. Figure 6 C and D graphs in Figure show that the fusion protein VTN-SDF1 can significantly promote the migration of BMSCs by crystal violet staining and ImageJ analysis. Figure 6 Figure 2A shows that the fusion protein VTN-SDF1 can significantly promote the migration of HDFs by crystal violet staining and ImageJ analysis. Figure 6 Figure 2B shows that the fusion protein VTN-SDF1 can significantly promote the recruitment of BMSCs. Figure 7 Figure 2C shows that the fusion protein VTN-SDF1 can significantly promote the recruitment of BMSCs.
[0070] The control group was used as the corresponding vitronectin. Embodiment
[0071] Preparation and characterization of vitronectin, stromal cell-derived factor-1 and its fusion protein hydrogel.
[0072] Step 1: Prokaryotic expression plasmid construction and verification of vitronectin, stromal cell-derived factor-1 and its fusion protein; Step 2: Induced expression and purification of vitronectin, stromal cell-derived factor-1 and its fusion protein; Step 3: (1) CS hydrogel: take 800 μl solution, add 100 μl DMEM, add 100 μl cell suspension, and dropwise add 100 μl 56% β glycerol sodium phosphate, mix well for standby.
[0073] (2) VTN hydrogel: take 800 μl, add 100 μl of 1 mg / ml VTN protein solution prepared by DMEM, add 100 μl of cell suspension, and dropwise add 100 μl of 56% β glycerol sodium phosphate, mix well for standby.
[0074] (3) VTN-SDF1 hydrogel: take 800 μl, add 100 μl of 1 mg / ml VTN-SDF1 recombinant fusion protein solution prepared by DMEM, add 100 μl of cell suspension, and dropwise add 100 μl of 56% β glycerol sodium phosphate, mix well for standby.
[0075] Step 4: Characterization test of freeze-dried samples. Obtained in the present application are chitosan (CS) hydrogel loaded with fusion protein VTN-SDF1 (referred to as VTN-SDF1@CS), VTN hydrogel loaded with VTN (referred to as VTN@CS) and chitosan hydrogel (referred to as CS); wherein, Figure 8 Figure 2A shows the macroscopic view before and after gelation; Figure 8 Figure 2B is an electron microscope graph of the hydrogel; Figure 8 Figure 2C shows the evaluation of the water contact angle of CS, VTN@CS and VTN-SDF1@CS; Figure 8 Figure 2D is the FTIR spectrum (as shown). Figure 8 Embodiment
[0076] Wound healing application of vitronectin, stromal cell-derived factor-1 and fusion protein hydrogel.
[0077] Step one: prokaryotic expression plasmid construction and verification of vitronectin, stromal cell-derived factor-1 and fusion protein; Step two: induction expression and purification of vitronectin, stromal cell-derived factor-1 and fusion protein; Step three: preparation of VTN-SDF1@CS, VTN@CS and CS hydrogel; Step four: 32 four to six week old male c57 mice were purchased. The mice were randomly divided into CS, VTN@CS, VTN-SDF1@CS and blank control groups, 8 mice in each group. The hydrogel obtained in Example 6 was used. The mice were anesthetized with anesthetic, shaved and washed clean with water. After the skin was dried, a punch was used to make two 1 cm diameter circular wounds on the back of the mouse. CS hydrogel, VTN and VTN-SDF1 recombinant fusion protein containing hydrogel were placed at the wound respectively. The blank control group was not treated. The wound healing was recorded by taking pictures every day, and samples were taken at 0d, 3d, 7d, 14d and 21d to obtain Figure 9 Figure A in the middle, the healing rate was counted Figure 9 Figure B in the middle Figure 9 ).
[0078] Step five: fresh tissue samples at 3d, 7d, 14d and 21d were collected and fixed with 4% paraformaldehyde. After fixation, PBS was used for washing 6 times, 30 min each time. Dehydration, transparency, penetration, wax immersion, embedding, sectioning, spreading, fishing and baking were performed. Finally, HE and Masson staining were performed Figure 10 as shown), the results showed that the VTN-SDF1@CS group had obvious promotion of wound healing and acceleration of the transformation period of postoperative skin to normal skin compared with the CS group and the VTN@CS group. Example
[0079] Wound healing application of vitronectin, stromal cell-derived factor-1 and fusion protein hydrogel.
[0080] Step one: prokaryotic expression plasmid construction and verification of vitronectin, stromal cell-derived factor-1 and fusion protein; Step two: induction expression and purification of vitronectin, stromal cell-derived factor-1 and fusion protein; Step three: preparation of VTN-SDF1@CS, VTN@CS and CS hydrogel; Step four: 32 male SD rats aged 4-6 weeks were purchased. The SD rats were randomly divided into VTN-SDF1@CS, VTN@CS, CS and normal groups. The rats were anesthetized with sodium pentobarbital, the hair on the leg of the rat was removed cleanly, and the meniscus was cut off at the joint site. The muscle and skin were sutured with absorbable suture. The body weight and joint width and height of the rats were measured and recorded. One week after the operation, the rats were injected with recombinant protein hydrogel every week, and the treatment lasted for 5 weeks. At 4W and 8W after treatment, samples were taken and fixed with 4% paraformaldehyde.
[0081] Step five: At 4W and 8W, the SD rats were subjected to behavioral tests. Before the experiment, the test box was confirmed to be clean and odorless, and special attention was paid to cleaning the feces and urine left by the experimental animals on the bottom of the test box. Set the corresponding parameters in the software, record the animal number, date, state, etc.; gently take the experimental animals out of the feeding cage, facing away from the experimenter; quickly place the experimental animals in the central area of the test box and immediately leave; turn on the animal behavior analysis software to automatically record the animal's activity in the box, usually for 5 minutes; after the experiment, place the experimental animals in the other feeding cages prepared in advance. Spray the instrument with alcohol to remove the odor and wipe it with a paper towel. Get the SD rat movement data in the software (as shown in the figure), the results show that the VTN-SDF1@CS group has significantly more movement trajectory and faster movement rate than the CS and VTN@CS groups. Figure 11
[0082] Step six: First, fix and trim the tissue samples after sampling, ensure that the sample size fits the scanning range of the Micro-CT scanner, and the sample surface should be clean and flat to avoid affecting the scanning results. Next, install the sample. Place the sample on the scanning table of the Micro-CT scanner and ensure that the sample is in the correct position to ensure the accuracy of the scan. Adjust the position and angle of the scanning table to place the sample in the best scanning position. Then, set the scanning parameters. Before performing Micro-CT scanning, you need to set the scanning parameters, including scanning mode, resolution, scanning range, etc. According to the characteristics of the sample and the information needed to be obtained, select appropriate scanning parameters to obtain high-quality images. Finally, reconstruct the image. Process the two-dimensional projection data obtained by scanning through computer software to reconstruct the three-dimensional image of the sample. During the reconstruction process, image enhancement, filtering and other operations can be performed to improve image quality and clarity. The final three-dimensional image can be used to analyze, measure and visualize the internal structure of the sample (as shown in the figure). Figure 12 The results show that the VTN-SDF1@CS group is closer to the BMD parameters of the normal joint at 4 weeks compared to the CS and VTN@CS groups, indicating that it can accelerate the healing period in joint repair. Embodiments
[0083] Application of vitronectin, stromal cell-derived factor-1 and its fusion protein hydrogel in repairing skull defects.
[0084] Step one: construction and verification of prokaryotic expression plasmid of vitronectin, stromal cell-derived factor-1 and its fusion protein Step two: induction expression and purification of vitronectin, stromal cell-derived factor-1 and its fusion protein Step three: preparation of VTN-SDF1@CS, VTN@CS and CS hydrogel Step four: 32 male SD rats aged 6-8 weeks were purchased. The SD rats were randomly divided into VTN-SDF1@CS, VTN@CS, CS and blank control groups. The rats were anesthetized with sodium pentobarbital, the hair on the head of the rats was removed cleanly, the middle position of the skull was found, 5mm diameter skull defects were made on both sides of the skull axis by trephine and ball drill, then the materials of each group were placed in the defects, the periosteum was sutured, and finally the head skin was sutured and disinfected. At 8W and 12W after operation, sampling was performed and fixed with 4% paraformaldehyde.
[0085] Step five: first, fix and trim the tissue samples after sampling, ensure that the size of the sample is suitable for the scanning range of the Micro-CT scanner, and the surface of the sample should be clean and flat to avoid affecting the scanning results. Next, install the sample. Place the sample on the scanning table of the Micro-CT scanner and make sure the position of the sample is correct to ensure the accuracy of the scan. Adjust the position and angle of the scanning table to place the sample in the best scanning position. Then, set the scanning parameters. Before performing Micro-CT scanning, you need to set the scanning parameters, including scanning mode, resolution, scanning range, etc. According to the characteristics of the sample and the information needed to be obtained, select appropriate scanning parameters to obtain high-quality images. Finally, reconstruct the image. Process the two-dimensional projection data obtained by scanning through computer software to reconstruct the three-dimensional image of the sample. During the reconstruction process, image enhancement, filtering and other operations can be performed to improve the image quality and clarity. Finally, the three-dimensional image obtained can be used to analyze, measure and visualize the internal structure of the sample Figure 13 As shown in the figure, the results show that the VTN-SDF1@CS group has new bone growth (purple circle) compared with the CS and VTN@CS groups at 8 weeks and 12 weeks, indicating that it can accelerate the healing period in skull defects.
Claims
1. A VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1, characterized in that: The fusion protein VTN-SDF1 was prepared by artificial recombinant protein (VTN), flexible adaptor, tag protein and stromal cell-derived factor-1 (SDF1) and exogenous expression by microorganisms.
2. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 1, characterized in that, The porphyrin is the full-length human or animal-derived protein, or a portion of its functional domains, or a functional polypeptide thereof.
3. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 1, characterized in that, The stromal cell-derived factor-1 is a full-length or partial functional domain or functional polypeptide of human or animal origin.
4. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 1, characterized in that: The steps for preparing hydrogels of vitrin, stromal cell-derived factor-1 or their fusion proteins are as follows: hydrogels are obtained by cross-linking vitrin, stromal cell-derived factor-1 or their fusion proteins through enzymes or chemical cross-linking agents or gel adhesives.
5. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 4, characterized in that: The hydrogel is obtained through enzymatic cross-linking. It is prepared by cross-linking a fusion protein with glutamyl transaminase (TG enzyme) or oxidase. The enzyme cross-links the protein into macromolecules, and the softness, hardness, and mechanical strength of the hydrogel can be adjusted by the concentration of the fusion protein.
6. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 5, characterized in that: The oxidase is one of tyrosinase, laccase, peroxidase or thiol oxidase.
7. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 4, characterized in that: The hydrogel is prepared by cross-linking the fusion protein with a chemical cross-linking agent, wherein the chemical cross-linking agent is glutaraldehyde, proanthocyanidins or genipin. The softness, hardness and mechanical strength of the hydrogel can be synergistically adjusted by the concentration of the fusion protein and the concentration of the cross-linking agent.
8. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 4, characterized in that: The hydrogel is prepared by crosslinking a fusion protein with a gel binder, wherein the gel binder is polyvinyl alcohol, carbomer, chitosan, gelatin, hyaluronic acid or trehalose. The fusion protein is thoroughly mixed and crosslinked with carbomer, and then sodium hydroxide or triethanolamine is added as a neutralizing agent to obtain the hydrogel. The softness, hardness and mechanical strength of the hydrogel can be synergistically adjusted by the concentration of the fusion protein and the concentration of the crosslinking agent.
9. The VTN-SDF1 fusion protein based on vitrin and stromal cell-derived factor-1 according to claim 4, characterized in that: The hydrogel has a porous three-dimensional network structure with a pore size of 30nm-300um, which is suitable for drug delivery systems, stem cell recruitment and culture, and cosmetic filling.
10. A method for preparing a hydrogel material based on a fusion protein of vitrin and stromal cell-derived factor-1, characterized in that, Includes the following steps: first step: The fusion protein (VTN-SDF1) was synthesized by artificial recombination and exogenous expression of the separately designed vitrin (VTN), flexible adaptor, tag protein and separately designed stromal cell-derived factor-1 (SDF1) gene sequences. Step 2: The synthesized fusion protein gene fragment and the vector pET28a(+) are double-digested with enzymes; Step 3: Recover the target fragment after double enzyme digestion using gel recovery; Step 4: Ligate the recovered target fragment, then perform plate screening to obtain positive clones, and sequence to verify complete accuracy; Step 5: Shake the correctly sequenced positive clones and extract the plasmids, then introduce them into competent E. coli cells (BL21(DE3)) via heat shock for plate culture. These competent cells can express the fusion protein. Step 6: Select colonies after transformation and plating for cultivation. When the OD600 of the bacterial solution reaches 0.6-0.8, add IPTG inducer and induce for 4-6 hours. Then collect the bacterial solution and centrifuge to obtain bacterial sludge for later use. Step 7: Lyse the bacterial sludge, break it down by ultrasound, and select different purification methods to separate and purify the protein depending on whether the protein is in the supernatant or in the precipitate. Step 8: The purified protein is desalted and then freeze-dried to obtain the lyophilized fusion protein.
11. The method for preparing a hydrogel material based on a fusion protein of vitrin and stromal cell-derived factor-1 according to claim 10, characterized in that, Other prokaryotic or eukaryotic expression vectors can be selected in vitro, and the expression host can be either prokaryotic or eukaryotic cells depending on the expression vector.
12. The application of a material based on a fusion protein (VTN-SDF1) hydrogel of vilinkin (VTN) and stromal cell-derived factor-1 (SDF1) in skin, cartilage repair, osteoarthritis, or bone defect repair and other tissues.