Method for constructing MSTN gene knockout porcine primary cells

Abstract

The invention discloses a method for constructing MSTN (myostatin) gene knockout porcine primary cells, which comprises the following steps: designing and constructing plasmids capable of efficiently knocking out MSTN genes by utilizing an efficient and simple gene modification technology TALEN (transcription activator-like effector nodules) technology; a gene editing target site is designed for a pig MSTN gene, the target site can be specifically recognized by Cas9 endonuclease, so that double-strand breakage is mediated, the gene is mutated in a non-homologous end connection mode under the action of a self-repairing system, then an sgRNA composition is designed, tRNA-sgRNA-sgRNA scaffold is used as a minimum repetitive unit, and the target site is specifically recognized by Cas9 endonuclease. The Cas9-CD163-MSTN polycistron vector is constructed by using a PTG / Cas9 strategy, so that the target MSTN gene is efficiently and accurately knocked out, and therefore, the Cas9-CD163-MSTN polycistron vector has a relatively good application prospect in pig germplasm improvement.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical technology, more particularly, it relates to a method for constructing MSTN gene knockout porcine primary cells. BACKGROUND

[0002] With the increasing attention to nutrition and health, the market demand for lean meat is also increasing. China is the world's largest pork producer and consumer, in the case of pig inventory reduction, per capita pork possession shows an upward trend. Muscle is the most important component of animal carcass, muscle production is one of the three major production directions (meat, egg, milk) in animal production, and muscle yield is an important economic trait of meat animals and the most important production direction in animal production. Therefore, for a long time, animal breeders have listed muscle production as the main research goal. At the same time, in the medical field, patients with muscle wasting and failure symptoms are increasing year by year, and the start of the project of constructing MSTN gene knockout porcine primary cells for patients is imminent.

[0003] Gene editing is a technology that precisely changes the specific genome DNA of an organism through fragment knockout, fragment insertion, and fragment editing to change its characteristics and functions. The main gene editing technologies include zinc finger nuclease (ZNF) technology, transcription activator-like effector nuclease (TALEN) technology, and clustered regularly interspaced short palindromic repeat (CRISPR) technology. The discovery and wide application of CRISPR / Cas9 gene editing technology enable the genome to more simply and efficiently complete base deletion, insertion, and replacement. Compared with other ZNF and TALEN technologies, the construction and use of the CRISPR / Cas9 system overcome the problems of long test cycle and small application range, and have great potential for simultaneous editing and modification of multiple genes.

[0004] Porcine reproductive and respiratory syndrome is a type of infectious disease that needs to be prevented and controlled, also known as blue ear disease, which is an acute infectious disease of pregnant sows abortion, piglets and fattening pigs pneumonia caused by porcine reproductive and respiratory syndrome virus (PRRSV). CD163 molecule is the most important and critical molecule in the life cycle of PRRSV, CD163 gene is located on chromosome 5, containing 18 exons, encoding 1096 amino acids. It is composed of 9 SRCRs (SRCR1-9), and the protein domain SRCR5 is essential for PRRSV infection. By knocking out the functional domain containing the seventh exon through gene editing, it can effectively resist PRRSV infection.

[0005] MSTN gene is located in chromosome 15, contains 3 exons, encodes 375 amino acids, MSTN is a protein produced by animal muscle cells, which can inhibit the growth of muscle cells, not only inhibits the proliferation and differentiation of muscle cells, but also determines the number of muscle fibers, is a negative regulator of muscle growth rate and lean meat rate. Introducing mutations in the MSTN signal peptide region can significantly down-regulate the expression of MSTN gene, increase the number of muscle fibers and promote muscle growth. SUMMARY

[0006] The purpose of the present application is to provide a method for constructing MSTN gene knockout of pig primary cells, which solves the problems of imprecision and low efficiency when multiple genes are simultaneously knocked out by existing gene editing.

[0007] To achieve the above purpose, the present application provides the following technical scheme: in the first aspect, the present application provides a method for constructing MSTN gene knockout of pig primary cells, comprising the nucleic acid sequences shown in SEQ. No. 3-4, further comprising sgRNA composition.

[0008] Further, the sgRNA composition includes sgRNA1, sgRNA2, sgRNA3, sgRNA4; wherein the nucleotide sequence of sgRNA1 is shown in SEQ ID No: 5-6, the nucleotide sequence of sgRNA2 is shown in SEQ ID No: 7-8, the nucleotide sequence of sgRNA3 is shown in SEQ ID No: 9-10, and the nucleotide sequence of sgRNA4 is shown in SEQ ID No: 11-12.

[0009] In the second aspect, the present application provides a multi-cistronic tRNA-sgRNA for knocking out pig MSTN gene, which is obtained by operable connection of fragments including tRNA-above sgRNA1-sgRNA scaffold, tRNA-above sgRNA2-sgRNA scaffold, tRNA-above sgRNA3-sgRNA scaffold, and tRNA-above sgRNA4-sgRNA scaffold; wherein the nucleotide sequence of tRNA is shown in SEQ ID No: 13.

[0010] Further, the nucleotide sequence of the multi-cistronic tRNA-sgRNA is shown in SEQ ID No: 14.

[0011] In a third aspect, the present application provides a multi-cistronic vector for knocking out a pig MSTN gene, which is obtained by operably connecting any one of the multi-cistronic tRNA-sgRNA described above to a pSpCas9(BB)-2A-Puro vector as a backbone.

[0012] In a fourth aspect, the present application provides a preparation method of a pig MSTN gene mutant cell line for knocking out, comprising the following steps: 1) transforming the multi-cistronic vector described above into a host bacterium, screening positive host bacteria, and extracting a plasmid; 2) transfecting the plasmid into a pig somatic cell, and obtaining a pig CD163, MSTN gene mutant cell line after screening positive cells.

[0013] Further, in step 2), the pig somatic cell comprises a pig kidney fibroblast cell.

[0014] In a fifth aspect, the present application provides a MSTN gene mutant cell line prepared by any one of the preparation methods described above.

[0015] Further, the MSTN gene mutation is a double-site editing fragment deletion.

[0016] In a sixth aspect, the present application provides application of any one of the sgRNA compositions for knocking out a pig MSTN gene, any one of the multi-cistronic tRNA-sgRNA for knocking out a pig MSTN gene, the multi-cistronic vector for knocking out a pig MSTN gene, and the pig MSTN gene mutant cell line in pig germplasm improvement.

[0017] The present application has the following beneficial effects: Different from the prior art, the present application designs a gene editing target site for a pig MSTN gene, which can be specifically recognized by a Cas9 endonuclease, thereby mediating a double-strand break, and under the action of a self-repairing system, the gene is mutated by a non-homologous end joining method, then an sgRNA composition is designed, and a tRNA-sgRNA-sgRNA scaffold is used as a minimum repeating unit, and a PTG / Cas9 strategy is used to construct a Cas9-MSTN multi-cistronic vector, thereby realizing efficient and precise knockout of a target gene, and therefore, the present application has a good application prospect in pig germplasm improvement. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 FIG. 1 is a schematic diagram of a gene editing target site on a MSTN gene in the present application; Figure 2 FIG. 2 is a schematic diagram of a multi-cistronic tRNA-sgRNA insertion site in a pSpCas9(BB)-2A-Puro plasmid in the present application; Figure 3A multi-cistronic vector map for knocking out a pig MSTN gene in the present application; Figure 4 A working principle diagram of a multi-cistronic tRNA-sgRNA in the present application; Figure 5 An electrophoretogram of DNA extracted from a MSTN gene mutant cell line in Example 3 of the present application, wherein, from left to right lane, in order: the first lane: DL2000bp DNA Marker; the second lane: CD163 gene negative control; the third lane is a CD163 knockout band; the fourth lane is a MSTN gene negative control; the fifth lane is a MSTN knockout band; Figure 6 A MSTN gene mutation site sequencing diagram in a MSTN gene mutant cell line in Example 3 of the present application. DETAILED DESCRIPTION

[0019] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0020] It should be noted that, unless otherwise specified, all technical and scientific terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0021] In order to solve the problems of imprecision and low efficiency when multiple genes are simultaneously knocked out by existing gene editing, the present application provides an sgRNA composition, a vector and an application thereof for knocking out pig CD163 and MSTN genes.

[0022] In the present application, the inventors have researched and found the editing sites of pig MSTN genes, and the double editing sites of the pig MSTN genes are located at 4883bp-4906bp and 4629bp-4652bp of NC_010457.5.

[0023] The schematic diagram of the above specific gene editing target site on the MSTN gene is shown in Figure 1 .

[0024] For the above editing sites, the present application provides an sgRNA composition for knocking out pig MSTN genes, which comprises sgRNA1, sgRNA2, sgRNA3, sgRNA4; wherein the nucleotide sequence of sgRNA1 is shown as SEQ ID No: 5-6, the nucleotide sequence of sgRNA2 is shown as SEQ ID No: 7-8, the nucleotide sequence of sgRNA3 is shown as SEQ ID No: 9-10, and the nucleotide sequence of sgRNA4 is shown as SEQ ID No: 11-12.

[0025] The nucleotide sequence of sgRNA1 is as follows: sgRNA1-F: 5'-CAGGAAACCCAGGCTGGTTG-3' (SEQ ID No: 5) sgRNA1-R: 5'-CAACCAGCCTGGGTTTCCTG-3' (SEQ ID No: 6) The nucleotide sequence of sgRNA2 is as follows: sgRNA2-F: 5'-AGTCTGCTCAAGTGAGACCC-3' (SEQ ID No: 7) sgRNA2-R: 5'-GGGTCTCACTTGAGCAGACT-3' (SEQ ID No: 8) The nucleotide sequence of sgRNA3 is as follows: sgRNA3-F: 5'-GCCATGGTAGTAGATCGCTGT-3' (SEQ ID No: 9) sgRNA3-R: 5'-CCATGGTAGTAGATCGCTGTG-3' (SEQ ID No: 10) The nucleotide sequence of sgRNA4 is as follows: sgRNA4-F: 5'-GCTGTCGTTACCCTCTAACTG-3' (SEQ ID No: 11) sgRNA4-R: 5'-CAGTTAGAGGGTAACGACAGC-3' (SEQ ID No: 12) In some embodiments, the editing site of the pig MSTN gene comprises a nucleotide sequence as shown in SEQ ID Nos: 3-4.

[0026] The nucleotide sequence of the editing site of the pig MSTN gene is as follows: Editing site 3: 5'-GCCATGGTAGTAGATCGCTGTGGG-3' (SEQ ID No: 3) Editing site 4: 5'-GCTGTCGTTACCCTCTAACTGTGG-3' (SEQ ID No: 4) The application further provides a multi-cistronic tRNA-sgRNA for knocking out a pig MSTN gene, the multi-cistronic tRNA-sgRNA is obtained by operable connection of fragments including tRNA-abovementioned sgRNA1-sgRNA scaffold, tRNA-abovementioned sgRNA2-sgRNA scaffold, tRNA-abovementioned sgRNA3-sgRNA scaffold and tRNA-abovementioned sgRNA4-sgRNA scaffold; wherein the nucleotide sequence of the tRNA is shown in SEQ ID No: 13.

[0027] The nucleotide sequence of the tRNA (SEQ ID No: 13) AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGC The application further provides a multi-cistronic vector for knocking out a pig MSTN gene, the multi-cistronic vector is obtained by operable connection of a pSpCas9(BB)-2A-Puro (PX459 for short) vector as a skeleton and the above multi-cistronic tRNA-sgRNA.

[0028] The insertion site of the multi-cistronic tRNA-sgRNA in the pSpCas9(BB)-2A-Puro plasmid is shown in Figure 2 .

[0029] In the application, the multi-cistronic vector for knocking out a pig MSTN gene is constructed by seamless cloning, and the specific method comprises the following steps: constructing a multi-cistronic expression cassette by taking the above sgRNA1-F, sgRNA2-F, sgRNA3-F and sgRNA4-F as a repeating unit of tRNA-sgRNA-sgRNA scaffold, operable connection of homologous arms on both sides of the expression cassette, enzyme cutting of the above PX459 vector by BbsI enzyme, and operable connection of the above expression cassette with the homologous arms to obtain a Cas9-MSTN multi-cistronic vector.

[0030] The multi-cistronic vector for knocking out a pig MSTN gene is shown in Figure 3 .

[0031] In the application, the multi-cistronic vector for knocking out a pig MSTN gene provides a new research idea for synchronous and precise modification of multiple genes.

[0032] The application further provides a preparation method of a pig MSTN gene mutant cell line, comprising the following steps: 1) transforming the above multi-cistronic vector into a host bacterium, screening positive host bacteria, and extracting a plasmid; and 2) transfecting the plasmid into pig somatic cells, screening positive cells, and obtaining a pig MSTN gene mutant cell line.

[0033] In the application, the host bacterium in step 1) can be a prokaryotic host (for example, Escherichia coli) or a eukaryotic host (for example, yeast or higher plants), for example, can be Escherichia coli DH5a. Moreover, the method for transformation is not particularly limited, preferably comprises a heat shock method, and after transformation, recovery is performed, culture is performed on an LB plate containing ampicillin (Amp), a single colony is selected to an LB culture medium containing Amp for continuous culture, and the bacterial solution is sent to a company for sequencing detection using a U6 primer (5'-CCGTAACTTGAAAGTATTTCG-3' (SEQ ID No: 15)). The positive single colony with correct sequencing is subjected to large-scale culture, and the plasmid is extracted.

[0034] In some embodiments, in step 1), the total concentration of the plasmid is 5000 ng / 100 ml.

[0035] In some embodiments, in step 2), the pig somatic cells comprise pig kidney fibroblasts.

[0036] It should be noted that the type of pig somatic cells in the application is not particularly limited, and a conventional type of pig somatic cells in the prior art can be selected, for example, the pig somatic cells in the application can be pig kidney fibroblasts.

[0037] The application further provides a MSTN gene mutant cell line prepared by any one of the preparation methods.

[0038] In some embodiments, the MSTN gene mutations are all caused by site editing and fragment deletion.

[0039] In the application, the MSTN gene mutation caused by double-site editing and fragment deletion refers to the deletion of a fragment between editing site 3 and editing site 4.

[0040] The MSTN gene mutant cell line model in the application provides new and reliable research materials for the improvement of economic traits of pigs.

[0041] The application finally provides the sgRNA composition for knocking out the pig MSTN gene, the multi-cistronic tRNA-sgRNA for knocking out the pig MSTN gene, the multi-cistronic vector for knocking out the pig MSTN gene, and the application of the pig MSTN gene mutant cell line in pig germplasm improvement.

[0042] In the present application, by using the above-mentioned multi-gene editing technology, not only new and reliable research materials are provided for the improvement of economic traits of pigs, but also new research means and ideas are provided for simultaneous and precise modification of multiple genes, which plays a very important role in pig breeding.

[0043] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0044] The experimental methods not specified in the embodiments are generally carried out according to the conventional experimental methods in the field of molecular biology, including but not limited to the experimental methods described in Molecular Cloning: A Laboratory Manual by M.R. Green, Molecular Biology by Robert F. Weaver, or the experimental methods suggested by the manufacturers of reagent kits and instrument equipment. The reagents and biological materials used in the embodiments can be obtained from commercial channels if not otherwise specified.

[0045] Embodiment 1 Construction of Cas9-CD163-MSTN multi-cistronic vector inserted with pig MSTN gene editing target site The main reagents and materials used in the present embodiment are as follows: The pSpCas9(BB)-2A-Puro vector plasmid was preserved by the Animal Embryo Engineering and Molecular Breeding Hubei Key Laboratory of Hubei Academy of Agricultural Sciences; the single nucleotide chain, primers used in the experiment and E. coli DH5a competent cells were purchased from Shanghai Sangon Biotech Co., Ltd.; the BbsI restriction endonuclease was purchased from Thermo; the plasmid extraction was performed according to the instructions of the small-scale medium-purity plasmid extraction kit provided by Beijing Tiangen Biotech Co., Ltd.; the DNA gel recovery kit was purchased from Nucliens; and the sequencing was commissioned by Biomics Biotech Engineering (Shanghai) Co., Ltd.

[0046] The Cas9-CD163-MSTN multi-cistronic vector is based on the pSpCas9(BB)-2A-Puro vector as a skeleton, and then the sgRNA sequence is designed according to the PTG strategy and inserted, and the specific sgRNA sequence and sequencing primer sequence are as described above, which are synthesized by Aoke (Wuhan) Biotechnology Co., Ltd. and Biomics Biotech Engineering (Shanghai) Co., Ltd., respectively.

[0047] The construction method of the Cas9-CD163-MSTN multi-cistronic vector is as follows: 1) Four editing sites corresponding to the pig MSTN gene (editing site 1 (SEQ ID No: 1), editing site 2 (SEQ ID No: 2), editing site 3 (SEQ ID No: 3), editing site 4 (SEQ ID No: 4)) were designed sgRNA (sgRNA1, sgRNA2, sgRNA3, sgRNA4), respectively, and an oligonucleotide chain (multicistronic tRNA-sgRNA (SEQ ID No: 14)) was designed by using PTG strategy to connect sgRNA and t-RNA. Homologous arms were added at both ends to make the oligonucleotide chain complementary to the cohesive ends of the vector plasmid. The above oligonucleotide chain was synthesized by Wuhan Bio-Technology Co., Ltd. and connected to the pSpCas9 (BB)-2A-Puro vector by seamless cloning. The connection product was packaged, transported and stored in glycerol bacteria, dry powder form, and stored at -20°C for standby; 2) The synthesized connection product sample was diluted to 10 mmol / L working solution, and 20 mL system was prepared. The connection product was transformed into E. coli DH5a competent cells. 5 mL of the connection product and 50 mL of the DH5a competent cells were mixed and incubated on ice for 30 min. After 42°C heat shock for 90 s, it was immediately placed on ice for 2 min; 3) Add 1 mL of antibiotic-free medium, and recover at 37°C on a constant temperature shaker at 200 rpm / min for 45 min; 4) Centrifuge at 8000 rpm / min for 1 min on a table centrifuge to precipitate the bacteria, then remove 900 ml of LB medium. After mixing the remaining 100 mL sample, it was spread on an LB plate containing ampicillin (100 ng / mL Amp) and incubated at 37°C overnight. 5) Pick a single colony into LB medium containing 100 ng / mL Amp for further culture. The bacterial solution was sent to the company for sequencing detection using U6 primer (5'-CCGTAACTTGAAAGTATTTCG-3' (SEQ ID No: 15)). Positive host bacteria were obtained, and the recombinant plasmid was extracted for standby.

[0048] Example 2 Screening of pig MSTN gene mutant cell lines The steps for screening pig MSTN gene mutant cell lines are as follows: 1) Cell plating: Ningxiang kidney fibroblasts were inoculated in a cell culture six-well plate, and the growth density was about 80% before electroporation transfection. 2) Digestion of cells: when the cells grow to about 80% confluence and have good morphology, the cells are digested with 0.25% trypsin (normal cell culture six-well plate is generally digested with 200 mL-500 mL / well of 0.25% trypsin, and when the cells are observed to be round and detached from contact and some cells are suspended under a microscope, the digestion is terminated by adding a medium containing serum), and the adherent cells are completely detached and dispersed into single cells by repeated pipetting; 3) Collection and rinsing of cells: the cell suspension after digestion and blowing is collected in a 1.5 mL sterile centrifuge tube, the cells are resuspended and rinsed with DPBS, centrifuged at 1500 rpm for 3 min, the supernatant is discarded, and the cells are resuspended with electroporation buffer (KCl 120 mM, CaCl2 0.15 mM, Hepes 25 mM, EDTA 2 mM, anhydrous MgCl2 5 mM, and K2HPO4 10 mM, pH 7.6) for rinsing, centrifuged again at 1500 rpm for 3 min, and the supernatant is discarded; an appropriate amount of electroporation buffer is added to 5 mg of recombinant plasmid (prepared in Example 1) in a 100 mL system (cell amount is 1 x 10), and the cells are resuspended by gentle pipetting to mix uniformly; 4) Transfection of cells by electroporation: the electroporator is started in advance when the cells are digested, and the voltage, pulse time, and pulse number parameters are set for pre-running, the cell electroporation mixture is placed in a sterile clean electroporation cup of appropriate size, and the cells are transfected by electroporation at 220 V / cm, 3 ms, and one pulse, and after the electroporation is completed, the cells are cultured with DMEM medium containing 12% FBS; 5) Cell screening and culture: the cells are cultured for 48 h after electroporation to recover normal growth state, and the cells are cultured and screened with 12% FBS / DMEM screening medium containing 2 μg / mL Puromycin, and the new screening medium is replaced every day to make the cells into single cells, and after the single cells after screening proliferate into cell clusters, single clones are picked and cultured.

[0049] Example 3 Sequencing verification of porcine MSTN gene mutant cell line The pair of specific primers for detecting MSTN are MSTN-F and MSTN-R, and the expected length of the original PCR product is about 727 bp, and the length of the band after deletion is about 427 bp.

[0050] The nucleotide sequences of the primers for detecting MSTN are as follows: MSTN-F: 5'-GCATTGGGATACTCAAACTG-3' (SEQ ID No: 18) MSTN-R: 5'-GCATACTCCAGGCATGTAGC-3' (SEQ ID No: 19) The above primers were synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd., and were divided, transported and stored in the form of dry powder. The primers were diluted to a 10 μmol / L solution with sterilized ddH2O, and were stored at -20°C for standby use.

[0051] The sequencing verification steps of the pig MSTN gene mutant cell line are as follows: 1) The genomic DNA of the monoclonal cell line (prepared in Example 2) was extracted according to the instructions of the mammalian genomic DNA extraction kit of Tiangeng Biochemical Technology Co., Ltd. The concentration was detected using a nucleic acid concentration detector, and the integrity was detected by agarose gel electrophoresis. Finally, the concentration was adjusted to 500 ng / μL for standby use for PCR detection; The 25 μL PCR reaction system is as follows: PowerPol 2x PCR Mix 12.5 μL, upstream primer (10 μmol / L) 0.5 μL, downstream primer (10 μmol / L) 0.5 μL, DNA template (500 ng / μL), and ddH2O to 25 μL. After adding the above components on ice and thoroughly mixing, the following program was performed on a PCR instrument: 98°C pre-denaturation for 5 min; 98°C denaturation for 10 s, 59°C annealing for 30 s, 72°C extension for 30 s, 32 cycles; 72°C final extension for 5 min; 4°C storage.

[0052] 2) 5 μL of the PCR reaction product was electrophoresed in a 2% agarose gel at a voltage of 120 V for 30 min, and the band size was observed in a gel imager, as shown in Figure 5 .

[0053] As can be seen from Figure 5 , the target band size is as expected.

[0054] 3) The remaining product was sent to Shenguo Bioengineering (Shanghai) Co., Ltd. for sequencing to confirm the accurate sequence of gene editing, as shown in Figure 6 .

[0055] As can be seen from Figure 6 , the MSTN gene in the mutant cell line is edited at the two sgRNA-guided preset sites, with a total deletion of 304 bp, which can cause a frameshift mutation and effective editing.

[0056] Example 4 Application of the Pig MSTN Gene Mutant Cell Line in Pig Germplasm Improvement The MSTN gene mutant cell line obtained in Example 3 was used as a nuclear transfer donor cell, which was implanted into an enucleated oocyte to prepare a recombinant cloned embryo and was transplanted into a mother to obtain a gene edited pig with simultaneous knockout of the MSTN gene through pregnancy.

[0057] The trait of the gene edited pig is better improved, and the pig can not only resist infection of PRRSV, but also promote muscle growth.

[0058] In summary, the gene editing method in the application can efficiently and accurately knockout two target genes at the same time, and therefore has a good application prospect in pig germplasm improvement.

[0059] It should be noted that each of the above embodiments belongs to the same inventive concept, and the description of each embodiment has its own emphasis. If not fully described in an individual embodiment, the description can be referred to in other embodiments.

[0060] The above-described embodiments only express the implementation of the application, and the description is more specific and detailed, but it should not be construed as limiting the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the application, a number of modifications and improvements can be made, which are within the scope of protection of the application. Therefore, the protection scope of the patent of the application should be subject to the appended claims.

Claims

1. A method for constructing MSTN gene knockout porcine primary cells, characterized in that, It includes the nucleic acid sequences shown in SEQ. NO. 3-4, and also includes an sgRNA composition.

2. The method for constructing MSTN gene knockout porcine primary cells according to claim 1, characterized in that, The sgRNA composition includes sgRNA1, sgRNA2, sgRNA3, and sgRNA4; wherein the nucleotide sequence of sgRNA1 is shown in SEQ ID No:5-6, the nucleotide sequence of sgRNA2 is shown in SEQ ID No:7-8, the nucleotide sequence of sgRNA3 is shown in SEQ ID No:91-0, and the nucleotide sequence of sgRNA4 is shown in SEQ ID No:11-12.

3. The method for constructing MSTN gene knockout porcine primary cells according to claim 2, characterized in that, It also includes polycistronic tRNA-sgRNA, which is operatively ligated from the following fragments: tRNA-sgRNA1-sgRNA scaffold, tRNA-sgRNA2-sgRNA scaffold, tRNA-sgRNA3-sgRNA scaffold, and tRNA-sgRNA4-sgRNA scaffold; wherein the nucleotide sequence of the tRNA is shown in SEQ ID No:

13.

4. The method for constructing MSTN gene knockout porcine primary cells according to claim 3, characterized in that, The nucleotide sequence of the polycistronic tRNA-sgRNA is shown in SEQ ID No:

14.

5. The method for constructing MSTN gene knockout porcine primary cells according to claim 4, characterized in that, It also includes a polycistronic vector, which is obtained by operably linking the pSpCas9(BB)-2A-Puro vector as a backbone to the polycistronic tRNA-sgRNA described in claim 3 or 4.

6. The method for constructing MSTN gene knockout porcine primary cells according to claim 5, characterized in that, It also includes a method for preparing a porcine MSTN gene mutant cell line, comprising the following steps: 1) Transform the polycistronic vector of claim 5 into host bacteria, screen for positive host bacteria, and extract plasmids; 2) The plasmid was transfected into pig somatic cells, and positive cells were screened to obtain the pig CD163 and MSTN gene mutant cell lines.

7. The method for constructing MSTN gene knockout porcine primary cells according to claim 6, characterized in that, In step 2), the porcine somatic cells include porcine kidney fibroblasts.

8. The method for constructing MSTN gene knockout porcine primary cells according to claim 6 or 7, characterized in that, A method for preparing a pig MSTN gene mutant cell line was used to prepare an MSTN gene mutant cell line.

9. The method for constructing MSTN gene knockout porcine primary cells according to claim 8, characterized in that, The MSTN gene mutations in the MSTN gene mutant cell lines were all due to two-site editing resulting in fragment deletion.

10. The sgRNA composition for knocking out the porcine MSTN gene according to claim 1 or 2, the polycistronic tRNA-sgRNA for knocking out the porcine MSTN gene according to claim 3 or 4, the polycistronic vector for knocking out the porcine MSTN gene according to claim 5, and the application of the porcine MSTN gene mutant cell line according to claim 9 in porcine germplasm improvement.

Images