Trichoderma reesei strain and application thereof in degrading fungaltoxin and inhibiting toxin-producing bacteria

Abstract

The invention discloses a Trichoderma reesei strain and an application of the Trichoderma reesei strain in degradation of mycotoxin and inhibition of toxin-producing bacteria. The Trichoderma reesei strain is a Trichoderma reesei strain GG-T40, and the preservation number is CCTCC (China Center for Type Culture Collection) NO: M20231843. The strain can synchronously and efficiently degrade eight kinds of mycotoxins such as AFB1, ZEN, T-2, ST, OTA, AOH, AME and TeA, and after the strain and the mycotoxins are co-cultured for 7 days, the removal rates of the eight kinds of toxins are all larger than or equal to 60%. The strain has strong bacteriostasis and toxin production inhibition effects, the toxin production inhibition rates of the strain to aspergillus flavus and fusarium graminearum are 62.5% and 74.4% respectively, and the strain can be applied to degradation of mycotoxin in agricultural products and food and inhibition of mildew and toxin production of the agricultural products and food.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of mycotoxin biodegradation and agricultural biological control, and particularly relates to a Trichoderma reesei strain and application of the strain in degrading mycotoxins and inhibiting toxin-producing bacteria. BACKGROUND

[0002] Mycotoxin contamination in agricultural products, food and feed poses a serious threat to global health and agricultural economy. Mycotoxins are mainly toxic secondary metabolites produced by fungi such as Aspergillus, Fusarium and Penicillium, and have strong carcinogenicity, immunosuppression and neurotoxicity. The most common mycotoxins include Aflatoxin B1 (AFB1), Zearalenone (ZEN), Deoxynivalenol (DON), Fumonisin (FBs), Ochratoxin (OTA), T-2 Toxin (T-2), Sterigmatocystin (ST), Alternariol (AOH), Alternariol monomethyl ether (AME), Tenuazonic acid (TeA) and Deoxynivalenol derivatives (3A-DON, 15A-DON).

[0003] These mycotoxins often do not exist alone in actual pollution, but show obvious co-contamination characteristics. Their coexistence can bring synergistic toxicity risk, complicating risk assessment and prevention and control work. Traditional physical and chemical detoxification methods are low in efficiency, high in cost or destroy nutritional quality, and it is urgent to develop effective, sustainable and multi-target control strategies for mycotoxin management.

[0004] Biological detoxification technology (utilizing microorganisms or their enzyme preparations) possesses high specificity, environmental friendliness, and biosafety. Trichoderma, widely distributed in soil and plant rhizosphere, is a recognized safe fungus genus and has a long history of use as a biofertilizer, soil conditioner, and biocontrol agent. Studies have shown that most Trichoderma species can degrade fungal toxins through secreted metabolites, and due to their rapid growth rate, they can also control harmful fungi through mechanisms such as parasitism, competition, and metabolite-based antifungal activity. Although many Trichoderma species capable of degrading fungal toxins or inhibiting toxin-producing fungi have been reported, such as CN120399963A disclosing a new species of Streptomyces antagonizing a broad spectrum of plant pathogenic fungi and its application; CN120249153A disclosing Streptomyces Knowlesi, a polyfungin B-producing fungus, and its application; and CN120399943A disclosing a strain of Streptomyces alogie and its application in the biocontrol of toxin-producing fungi, a Trichoderma species with high degradation efficiency, broad-spectrum activity, and combined antifungal and detoxifying properties is still lacking. Summary of the Invention

[0005] Therefore, the object of the present invention is to provide a strain of Trichoderma reesei ( Trichoderma This study describes the application of strain GG-T40 (Trichoderma spp.) in degrading mycotoxins and inhibiting toxin-producing fungi. This strain, screened from 65 Trichoderma strains, can simultaneously degrade eight mycotoxins and inhibit the mycelial growth and toxin production of toxin-producing fungi such as Aspergillus flavus and Fusarium graminearum. This strain can be used to degrade mycotoxins in agricultural products and food, and also to inhibit toxin production from mold growth in agricultural products and food.

[0006] To achieve the above objectives, the present invention provides the following technical solution: The present invention first isolates *Trichoderma reesei* from the rhizosphere soil of maize in Jinan City, Shandong Province. Trichoderma (spp.) GG-T40. This strain was deposited on October 9, 2023, at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China), with accession number: CCTCC NO: M20231843. This strain has the ability to degrade fungal toxins and inhibit toxin-producing bacteria.

[0007] The fermentation method of the above-mentioned Trichoderma reesei strain GG-T40 is characterized by culturing in PDB medium under dark conditions for 3-7 days at a temperature of 25-30℃ (preferably 28℃) and a humidity of 85-90% (preferably 90%), and then filtering the culture supernatant to obtain the fermentation broth.

[0008] This invention also provides a biological agent with *Trichoderma reesei* strain GG-T40 as the active ingredient. The active ingredient includes the *Trichoderma reesei* strain GG-T40, its fermentation broth, intracellular components, and active bacterial cells. The fermentation broth of strain GG-T40 is the primary component in the biological agent that degrades mycotoxins.

[0009] The application also provides an enzyme preparation for degrading mycotoxins, wherein the active ingredient of the enzyme preparation is an extracellular enzyme secreted by Trichoderma reesei strain GG-T40, and the enzyme preparation is prepared from a fermentation broth of the strain GG-T40.

[0010] The application provides an application of Trichoderma reesei strain GG-T40 or a biological microbial agent in simultaneously degrading multiple mycotoxins, wherein the mycotoxins are AFB1, ZEN, T-2, ST, OTA, AOH, AME, TeA and the like.

[0011] The application also provides an application of Trichoderma reesei strain GG-T40 or a biological microbial agent in inhibiting mycelial growth of toxin-producing fungi (Aspergillus flavus, Fusarium graminearum and the like) and toxin production (e.g., AFB1 production by Aspergillus flavus and DON production by Fusarium graminearum).

[0012] The application has the following technical effects: 1. Compared with the prior art, the application provides a Trichoderma reesei strain GG-T40, which can secrete high-activity extracellular enzymes and efficiently degrade eight kinds of mycotoxins, i.e., AFB1, ZEN, T-2, ST, OTA, AOH, AME and TeA, wherein after the strain is co-cultured with the mycotoxins for 7 days, the removal rate of the fermentation broth to the eight kinds of toxins with a concentration of 125 ppb is all greater than or equal to 60%, the removal rate of the fermentation broth to AFB1 with a concentration of 125 ppb is 100%, and the removal rate of the fermentation broth to AFB1 with a concentration of 15 ppm is still 90%. The strain has high degradation efficiency and strong broad-spectrum property to the mycotoxins, and has great application potential.

[0013] 2. The Trichoderma reesei strain GG-T40 has strong antibacterial and toxin-producing inhibiting effects, wherein the mycelial growth inhibition rates of the strain to Aspergillus flavus and Fusarium graminearum are 23.4% and 27.9% respectively, and the toxin production inhibition rates of the strain to Aspergillus flavus and Fusarium graminearum are 62.5% and 74.4% respectively. It is shown that the strain can be applied to degrade mycotoxins in agricultural products and food, and also can inhibit mold and toxin production of agricultural products and food. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 It is a colony picture of the strain GG-T40 after being cultured on a PDA plate for 7 days; Figure 2 It is a degradation rate of the strain GG-T40 to different mycotoxins, wherein A is a degradation rate of the strain GG-T40 to AFB1, ZEN, DON, 3A-DON, 15A-DON, T-2, FB1, FB2, ST, OTA, AOH, AME and TeA with a concentration of 125 ppb, and B is a degradation rate of the strain GG-T40 to AFB1 with different concentrations (50 ppb, 500 ppb, 10 ppm and 15 ppm); Figure 3Figure of AFB1 degradation rate of fermentation broth of strain GG-T40 after high temperature and high pressure treatment, proteinase K treatment, and proteinase K+SDS treatment, respectively; Figure 4 Figure of colonies of Aspergillus flavus and Fusarium graminearum after growing in PDA medium containing fermentation broth of strain GG-T40 for 7 days. DETAILED DESCRIPTION

[0015] The terms used in the present application have the meanings generally understood by those of ordinary skill in the art, unless otherwise defined. The present application is described in further detail below in conjunction with specific examples and with reference to the data. The following examples are merely for the purpose of illustration of the present application and do not limit the scope of the present application in any way.

[0016] Example 1: Isolation, purification and identification of the strain 1. Isolation and purification of the strain The strain of the present application is isolated from the rhizosphere soil of corn in Jinan, Shandong Province, and the specific isolation steps are as follows: (1) Take 10 g of the rhizosphere soil sample and dissolve it in a conical flask containing 90 mL of purified water, oscillate at 30 ℃ and 180 r / min for 15 min, and then incubate in a 90 ℃ water bath for 10 min. After cooling to room temperature, take the soil solution and dilute it in a test tube to prepare a suspension.

[0017] (2) Take 1 mL of the suspension and transfer it into 9 mL of sterile water as the first dilution, and continuously perform 5 dilution gradients. Using the coating method, take 100 μL of the suspension of each dilution gradient and evenly spread the dilution liquid on the Bengal red medium plate using an L-shaped coating rod. The Bengal red medium contains chloramphenicol and has an inhibitory effect on bacteria, which is beneficial for the isolation of fungi. Seal the plate with a sterilized sealing film and place it in a 28 ℃ incubator for 3 d. Observe the plate every day and check whether new colonies grow.

[0018] (3) According to the differences in colony morphology, color and size, use an inoculation loop to pick out the strain similar to Trichoderma reesei, and purify it on potato dextrose agar medium (PDA). If necessary, perform multiple purifications until a single strain appears. Subsequently, perform molecular biology identification to further determine the type of the strain.

[0019] Bengal red medium formula (containing chloramphenicol): 5.0 g of proteose peptone, 10.0 g of glucose, 1.0 g of potassium dihydrogen phosphate, 0.5 g of magnesium sulfate, 15 g of agar, 0.033 g of Bengal red, and 0.1 g of chloramphenicol per liter of medium.

[0020] 2. Identification of the strain Strain GG-T40 grew on PDA medium for 7 days, and the mycelium growth showed a radial expansion pattern, forming a circular colony of 8-9 cm on agar medium. The colony was initially white and fluffy, with a regular edge, and gradually turned light yellow as the culture time increased. A dense layer of conidia formed on the surface, and the mature colony showed a typical powdery appearance. Figure 1 ).

[0021] Molecular biology strain identification was performed by Shenzhen Huada Gene Technology Co., Ltd. (https: / / en.genomics.cn / ) based on the Internal transcribed spacer (ITS) sequence. The total DNA was extracted using the Fungal Genomic DNA Extraction Kit from Shenzhen Huada Gene Technology Co., Ltd. for amplification of the target gene ITS. The amplification was performed using universal primers ITS1 / ITS4, and the amplification program was as follows: 96°C for 5 min; 96°C for 30 s, 56°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 5 min. 3 μL of the PCR product was subjected to 1% agarose electrophoresis for product detection, and the band characteristics were observed. The amplification product was sent to Shenzhen Huada Gene Technology Co., Ltd. for sequencing, and the BLAST software was used to compare and analyze the sequence of the determined gene sequence with the NCBI database. The ITS sequence of the strain GG-T40 is shown as SEQ ID No. 1.

[0022] ITS sequence of GG-T40 (SEQ ID No. 1): TGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCTTCCGTCGCGGCTCTGTTTTACCTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC.

[0023] According to morphological characteristics and gene sequence alignment analysis results, strain GG-T40 was identified as Trichoderma reesei (Hypocrea lixii). Trichoderma The strain has been preserved in China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on October 9, 2023, and the preservation number is CCTCC NO: M20231843.

[0024] Example 2: Degradation effect of Trichoderma reesei strain GG-T40 on various mycotoxins The AFB1(or ZEN, DON, 3A-DON, 15A-DON, FB1, FB2, T-2, ST, OTA, AOH, AME, TeA) toxin is added to the sterilized PDB medium to make the final concentration 125 ppb; the PDB medium containing the mycotoxin is added to the 12-hole cell culture plate, 2 ml per hole; the puncher is used to take the circular mycelium block (about 6 mm in diameter) from the edge of the activated Trichoderma reesei strain GG-T40 colony, which is transferred to the 12-hole cell culture plate with a toothpick, one mycelium block per hole, and placed in the incubator (28°C, dark condition) for 7 days. The PDB without Trichoderma is used as a blank control, and three repeats are performed. After 7 days, the mycelium liquid is taken out with a disposable plastic rubber dropper and added to a 5-ml centrifuge tube. 0.2 mL of the mycelium liquid is mixed with 0.8 mL of acetonitrile solution (or methanol water 1:1), filtered through a 0.22 μM disposable filter membrane, and then detected by liquid chromatography-mass spectrometry to detect the content of AFB1(or ZEN, DON, 3A-DON, 15A-DON, FB1, FB2, T-2, ST, OTA, AOH, AME, TeA) toxin in the mycelium liquid, and the degradation rate of the strain to the mycotoxin is calculated.

[0025] Degradation rate (%) = 100 x (A1 - A2) / A1 Wherein, A1 is the average content of AFB1(or ZEN, DON, 3A-DON, 15A-DON, T-2, FB1, FB2, ST, OTA, AOH, AME, TeA) in the blank control group; A2 is the average content of AFB1(or ZEN, DON, 3A-DON, 15A-DON, FB1, FB2, T-2, ST, OTA, AOH, AME, TeA) in the experimental group.

[0026] The removal rate of strain GG-T40 to AFB1, ZEN, DON, 3A-DON, 15A-DON, FB1, FB2, T-2, ST, OTA, AOH, AME, TeA with a concentration of 125 ppb is shown in Figure 2 A (the AFB1 degradation rate is 100%, the ZEN degradation rate is 84.1%, the DON degradation rate is 4.15%, the 3A-DON degradation rate is 0.45%, the 15A-DON degradation rate is 42.77%, the FB1 degradation rate is -2.63%, the FB2 degradation rate is 6.08%, the T-2 degradation rate is 59.8%, the ST degradation rate is 99.4%, the OTA degradation rate is 73.5%, the AOH degradation rate is 76.5%, the AME degradation rate is 83.6%, and the TeA degradation rate is 70.0%); Figure 2B is the degradation rate of different concentrations of AFB1 (50 ppb, 500 ppb, 10 ppm, 15 ppm) at different culture times. After 7 days of culture, the degradation rates of AFB1 with concentrations of 50 ppb, 500 ppb, 10 ppm and 15 ppm were 100%, 97.7%, 93.5% and 90.2%, respectively. The degradation rates of the strain on AFB1, ZEN, T-2, ST, OTA, AOH, AME, TeA and other eight mycotoxins were all ≥60%, indicating that the strain can simultaneously and efficiently degrade these eight mycotoxins, and the degradation rate on high-concentration AFB1 (15 ppm) still reaches 90%, indicating that it has high toxin tolerance.

[0027] Example 3: Analysis of the degradation differences of different active components of Trichoderma reesei strain GG-T40 on AFB1 and ZEN (1) Extracellular metabolite component: GG-T40 strain was cultured in PDA medium in the dark for 5 days (culture temperature 28°C, culture humidity 90%), and 8 pieces of 6.0 mm diameter plugs were punched along the edge of the colony with a puncher and transferred into 100 mL of PDB medium. It was placed in a constant temperature shaker and cultured at 28°C with a shaking speed of 125 rpm for 7 days; after 10 days, the culture supernatant was collected, filtered with filter paper first, and then filtered with a 0.22 μM filter membrane, and the filtrate was used as the extracellular metabolite component (Extracellular Component, EC) of the strain; (2) Active mycelium: After filtration, the mycelium was collected and washed twice with PBS buffer; then, a part of the mycelium was resuspended in 100 mL of PBS buffer as the active cell component (Active Component, AC); (3) Intracellular metabolite component: the other part of the mycelium was freeze-dried, immediately ground in a mortar under liquid nitrogen environment after freeze-drying, then resuspended in sterilized PBS buffer (about 2.0 mL PBS per gram of mycelium), and broken using ultrasonic under ice bath conditions for 30 minutes. After centrifugation (4500 × g, 10 min, 4 °C), the supernatant was filtered with a 0.22 μM filter membrane, and the filtrate was used as the intracellular metabolite component (Intracelluar Component, IC); (4) AFB1 and ZEN standard were added to each component EC, AC, IC and control group PBS buffer to make the final concentration of AFB1 and ZEN 500 ppb, and incubated at 37°C for 36 h. 1.0 mL of each component was filtered through a 0.22 μM filter membrane, and the AFB1 concentration was determined by HPLC-FLD.

[0028] As shown in Table 1, the removal rates of AFB1 and ZEN by the extracellular metabolic components of strain GG-T40 were 91.5% and 92.5%, respectively, the removal rates of AFB1 and ZEN by the active bacteria were 8.6% and 16.2%, respectively, and the removal rates of AFB1 and ZEN by the intracellular metabolic components were 12.7% and 18.8%, respectively. The removal rates of AFB1 and ZEN by the extracellular metabolic components were significantly higher than those by the active bacteria and the intracellular metabolic components, indicating that the extracellular metabolic components played a major role in the removal of AFB1 and ZEN by strain GG-T40.

[0029] Table 1 Removal rates of AFB1 and ZEN by different cell components of Trichoderma reesei GG-T40

[0030] Note: *Different letters represent extremely significant differences, according to the Turkey ± Kramer multiple comparison analysis of one-way ANOVA, p < 0.001.

[0031] Example 4: Analysis of active components of extracellular metabolic components To study whether the degradation of mycotoxins by Trichoderma reesei strain GG-T40 is an enzymatic action, the extracellular metabolic products were treated with heat and proteinase K (> 30 U / mg). The extracellular metabolic products of strain GG-T40 were obtained according to the method described in Example 3. 5 mL of the solution of extracellular metabolic products was placed in an autoclave and treated at 121 °C for 30 min. 5 mL of the solution of extracellular metabolic products was added with proteinase K to a final concentration of 1 mg / mL and placed at 37 °C for 2 h. 5 mL of the solution of extracellular metabolic products was added with proteinase K and sodium dodecyl sulfonate (SDS) to final concentrations of 1 mg / mL and 1% (w / v), respectively, and placed at 37 °C for 5 h. The control group was treated with PBS buffer in the same way as the above experiments. AFB1 standard was added to the above prepared solution to a final concentration of 500 ppb, and the solution was placed at 37 °C in the dark for 24 h. The culture solution was collected with a syringe, filtered with a 0.22 μM filter membrane, and the AFB1 concentration in the sample was determined by HPLC-FLD. The degradation rate of AFB1 by different treatment solutions was calculated according to the following formula.

[0032] Degradation rate (%) = 100 × (C - S) / C Where C is the AFB1 concentration in the control group, and S is the AFB1 concentration in the experimental group.

[0033] As shown in Table 2, the removal rates of AFB1 and ZEN by the extracellular metabolic components of strain GG-T40 were 91.5% and 92.5%, respectively, the removal rates of AFB1 and ZEN by the active bacteria were 8.6% and 16.2%, respectively, and the removal rates of AFB1 and ZEN by the intracellular metabolic components were 12.7% and 18.8%, respectively. The removal rates of AFB1 and ZEN by the extracellular metabolic components were significantly higher than those by the active bacteria and the intracellular metabolic components, indicating that the extracellular metabolic components played a major role in the removal of AFB1 and ZEN by strain GG-T40. Figure 3The degradation rate of AFB1 by extracellular metabolites decreased from 92% to 85% after 121 ℃ heat treatment, and decreased to 65% after proteinase K treatment, and decreased to 24% after proteinase K+SDS treatment. The variance analysis result showed that the heat treatment had no significant effect on the degradation rate of AFB1, and the proteinase K treatment and the proteinase K+SDS treatment had significant effects on the degradation rate of AFB1. It is shown that the proteinase plays a major role in the degradation of AFB1 by the strain GG-T40, and it is speculated that the active ingredient in the extracellular metabolites is the proteinase and is the high-temperature-resistant proteinase.

[0034] Example 5: Effect of Trichoderma reesei strain GG-T40 on inhibiting the growth and toxin production of Aspergillus flavus and Fusarium graminearum (1) Preparation of fermentation broth of strain GG-T40: The strain GG-T40 was cultured in PDB medium in dark condition for 5 days, and the culture temperature was 28 ℃ and the culture humidity was 90%, to obtain the fermentation broth of strain GG-T40.

[0035] (2) Preparation of PDA medium containing fermentation broth of strain GG-T40: The PDA medium was prepared, and after 121 ℃ high-pressure sterilization for 30 min, it was cooled to 55 ℃. Under constant temperature of 55 ℃, 15 mL of liquid PDA medium and 5 mL of Trichoderma fermentation filtrate were taken, and after mixing evenly, they were quickly poured into a flat plate, and after waiting for cooling and solidification, 10 μL of Aspergillus flavus spore solution (1 × 10 7 spores / mL) or Fusarium graminearum block (diameter 6 mm) was added at the center of the flat plate. The flat plate without GG-T40 strain fermentation broth was inoculated with Aspergillus flavus or Fusarium graminearum as a blank control, and each group was repeated 3 times. After being cultured at 28 ℃ in dark condition for 7 days, the colony diameter of the toxin-producing fungus was measured, and the inhibition rate of strain GG-T40 on the toxin-producing fungus was calculated by the following formula.

[0036] Inhibition rate (%) = 100 × (R1-R2) / R1 Wherein, R1 is the colony diameter of the control group of toxin-producing fungus, and R2 is the colony diameter of the experimental group of toxin-producing fungus.

[0037] (3) After measuring the colony diameter of the toxin-producing fungus, punch the mycelium block from the inoculation point of the toxin-producing fungus with a puncher with a diameter of 8 mm at a regular distance along the radius of the colony growth. Transfer the mycelium (about 1 g) into a 15 mL centrifuge tube and accurately weigh. Add 5 mL of methanol-water (80:20, v / v) solution to each tube and place in a shaker for extraction for 1 h at room temperature at a speed of 250 rpm. Then centrifuge the sample, filter with double-layer filter paper, and determine the content of mycotoxin in the filtrate by ultra-high performance liquid chromatography. For the Aspergillus group, determine the content of AFB1; for the Fusarium group, determine the content of DON. The calculation formula of the inhibition rate of the toxin-producing inhibition of the strain GG-T40 strain is as follows: Inhibition rate (%) = 100 x (M1 - M2) / M1 Wherein, M1 is the content of mycotoxin produced by the growth of the toxin-producing fungus in the control group, and M2 is the content of mycotoxin produced by the growth of the toxin-producing fungus in the experimental group.

[0038] Figure 4 For the colony map of Aspergillus and Fusarium in the control group and the experimental group, it can be seen that the fermentation liquor of the strain GG-T40 can inhibit the mycelial growth of Aspergillus and Fusarium, and the inhibition rates are 23.4% and 27.9%, respectively. The results of toxin production inhibition are shown in Table 2. The metabolic products secreted by the strain GG-T40 can inhibit the production of AFB1 by Aspergillus, and the inhibition rate is 62.5%. It can also inhibit the production of DON by Fusarium, and the inhibition rate is 74.4%.

[0039] Table 2 Effect of metabolic products of Trichoderma reesei GG-T40 on AFB1 production by Aspergillus and DON production by Fusarium

Claims

1. A strain of Trichoderma reesei ( Trichoderma strain GG-T40 (spp.) is characterized by, The preservation number of the strain GG-T40 is CCTCC NO: M20231843.

2. The fermentation process of the Trichoderma reesei strain GG-T40 according to claim 1, characterized by, The fermentation liquid is obtained by filtering the culture supernatant after culturing the strain GG-T40 in PDB medium in dark condition for 3-7 days at a temperature of 25-30℃ and a humidity of 85-90%. 3.A bio-inoculant with the Trichoderma reesei strain GG-T40 as the active ingredient, wherein the active ingredient comprises the Trichoderma reesei strain GG-T40 and the fermentation liquid, intracellular components and active bacteria of the strain. 4.An enzyme preparation for degrading mycotoxins, wherein the active ingredient of the enzyme preparation is the extracellular enzyme secreted by the Trichoderma reesei strain GG-T40, and the enzyme preparation is prepared from the fermentation liquid of the strain GG-T40. 5.The application of the Trichoderma reesei strain GG-T40 of claim 1 or the bio-inoculant of claim 3 in simultaneously degrading multiple mycotoxins.

6. The use according to claim 5, characterized in that, The mycotoxins are AFB1, ZEN, T-2, ST, OTA, AOH, AME and TeA. 7.The application of the Trichoderma reesei strain GG-T40 of claim 1 or the bio-inoculant of claim 3 in inhibiting the mycelial growth of toxin-producing fungi and in inhibiting toxin production.

8. Use according to claim 7, wherein the compound is ###0002### The toxin-producing fungi are Aspergillus flavus and / or Fusarium graminearum.

Images