Molecular marker related to corn row grain number and application thereof

Abstract

The invention discloses a molecular marker related to corn row grain number and application thereof, the molecular marker is based on a corn ZmSBP20 gene promoter region, the ZmSBP20 is located on a corn chromosome 4, the physical position of the ZmSBP20 on a corn B73 reference genome Zm-B73-REFERENCE-NAM-5. 0 is Chr4: 246387302-246390553, the corresponding physical position of the molecular marker is Chr4: 246391202-246391344, and the ZmSBP20 is located on the corn ZmSBP20 gene promoter region. The base sequence of the InDel + genotype at the position is as shown in SEQ ID No.1, and the InDel-genotype at the position is deleted by 142 bp. The molecular marker has the characteristics of stable amplification, high detection efficiency and the like, can accurately, efficiently and stably distinguish the InDel + genotype from the InDel-genotype, can be widely applied to molecular marker-assisted selection of favorable variation sites of row grain number, and provides important technical support and theoretical basis for genetic improvement of corn yield.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of crop selection and breeding, and particularly relates to a molecular marker of a gene related to corn kernel number per row and application of the molecular marker in corn assisted breeding. ZmSBP20 BACKGROUND

[0002] As an important food, feed and industrial raw material crop, corn has surpassed rice and wheat to rank first in total yield, and plays a strategic role in ensuring food security and promoting agricultural economic development. However, with the continuous growth of global population, frequent extreme weather, rigid constraints on arable land resources and intensified biological stress, global food security is facing severe challenges. Therefore, increasing corn yield through genetic improvement to meet the growing demand for food has become a key scientific problem in corn breeding research.

[0003] Corn yield traits are complex quantitative traits controlled by micro-effect polygenes, and kernel number per row as a core component of grain yield, the analysis of its genetic regulatory network is the key to break through the yield bottleneck. In recent years, researchers have located multiple kernel number per row related loci in the corn genome through techniques such as mutant identification, linkage analysis, genome-wide association analysis and multi-omics, however, most of the genes discovered from mutant identification have not been systematically mined for functional haplotypes with breeding application potential, making it difficult to be directly applied to molecular design breeding. Therefore, it is of great significance to mine excellent allelic variations of corn kernel number per row regulatory genes, develop functional markers and apply them to breeding for corn molecular design breeding of high yield. SUMMARY

[0004] In view of the problem that the above-mentioned kernel number per row related loci are difficult to be directly applied to molecular design breeding, the application provides a molecular marker of a gene related to corn kernel number per row and application of the molecular marker in corn assisted breeding. ZmSBP20 The molecular marker can be widely applied to molecular marker assisted selection of favorable variation sites of kernel number per row, and provides important technical support and theoretical basis for genetic improvement of corn yield.

[0005] To achieve the above-mentioned purpose, the application provides a InDel molecular marker ZmSBP20-InDel-1876 related to corn kernel number per row, the InDel marker is located in the promoter region of a kernel number per row positive regulatory factor gene Zm00001eb208150, and the gene is located in the chromosome 20 of corn. ZmSBP20 ZmSBP20 ​​Located on chromosome 4 of maize, the physical location on the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 is Chr4: 246387302-246390553, and the corresponding physical location of the molecular marker is Chr4: 246391203-246391344, InDel - The genotype has a 142bp deletion at this position, InDel + The genotype at this position is shown in SEQ ID No. 1.

[0006] SEQ ID No. 1: GGCGTGTTCGGCTGGCTGCAAGCCGACACTGTTGCAGCTGTTTGGACTGCTGCAGCTGCAATCCATAGAGAGAAAAATACTGTAGAAGCCGCAGCCGCAGCCGGATTGCAGCCGCAGCAAGCCGCAGCGAACAAGCTGTACG.

[0007] The present invention also provides primers for detecting the InDel molecular marker associated with the number of kernels per row in maize, wherein the molecular marker is obtained by PCR amplification using the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0008] SEQ ID No.2 (ZmSBP20-InDel-1876F): 5'-TTGGCTGGTTGTGGTTGCT -3'; SEQ ID No. 3 (ZmSBP20-InDel-1876R): 5'-CACTGTGCCGCTGTACTCCT-3'.

[0009] This invention also provides an application of the above-mentioned InDel molecular marker or primer pair in assisted breeding to improve the number of kernels per row and ear length in maize, comprising the following steps: extracting DNA from the maize material to be tested, performing PCR amplification using the above-mentioned primer pair as primers; performing agarose gel electrophoresis after amplification, and if the detected nucleotide sequence length is 381 bp, it indicates an InDel insertion site (InDel...). + If the detected nucleotide sequence length is 239 bp, it indicates that the corresponding Indel site is a deletion (InDel). - ).

[0010] Furthermore, at the InDel site of the molecular marker, relative to the deletion type (InDel... - ), base insertion type (InDel) +) associated with higher kernel number per row. According to the variation site, the test population is divided into two types, and the two types have significant difference in kernel number per row and ear length. Among them, the insertion type of InDel site is identified as the excellent type of corn kernel number gene ZmSBP20 .

[0011] Through the above technical solutions, the following beneficial effects are achieved: 1. Based on association analysis, the present application mines a new InDel site significantly associated with and stable for corn kernel number per row, and develops a molecular marker based on the site, which can be widely used in molecular marker assisted breeding and whole genome selection breeding of corn kernel number per row, and speeds up the breeding process. 2. The molecular marker provided by the present application has the characteristics of stable amplification, high detection efficiency, etc., and can be directly distinguished by agarose gel electrophoresis, is simple to operate, greatly improves the detection efficiency, promotes the genetic improvement of corn yield traits, and helps the cultivation of high-yield new varieties. 3. By applying the molecular marker significantly associated with corn kernel number per row provided by the present application, it can be judged whether the efficiency variation of the corn kernel number per row of the test corn variety (line) exists, which greatly improves the selection efficiency and quality of the corn variety (line), maximally reduces the cost, directly realizes the identification of the target trait site in the corn germplasm resources and breeding offspring, and provides a reliable molecular marker for corn molecular marker assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 is ZmSBP20 a candidate gene association analysis diagram of genes and kernel number per row, and the circles and triangles represent SNPs and InDels, respectively; Figure 2 is the InDel + and InDel - genotype of kernel number per row (A) and ear length (B) phenotype comparison; Figure 3 is the InDel + and InDel - genotype electrophoresis detection result diagram of molecular marker ZmSBP20-InDel-1876; Figure 4 is the electrophoresis detection result diagram of molecular marker ZmSBP20-InDel-1876 applied to part of the inbred lines. DETAILED DESCRIPTION

[0013] The specific embodiments of the present application are described in detail below in combination with examples. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present application, and are not used to limit the present application.

[0014] Example 1: Discovery of the ZmSBP20-InDel-1876 site associated with row particle number In order to investigate ZmSBP20 Functional loci of genes affecting maize row kernel number were captured at specific sites in 291 maize inbred lines. ZmSBP20 The full-length genome was obtained and resequencing was performed, detecting a total of 293 SNPs and 276 insertions / deletions (InDels). The row-seed number phenotype of 291 maize inbred lines was then analyzed. ZmSBP20 Association analysis of candidate genes for variant sites and row number. Three Indel sites and one SNP site were identified in the promoter region that were significantly associated with row number, among which Indel-1876 was a 142 bp insertion / deletion. Figure 1 ) 。 Based on the above significant loci, the tested inbred lines can be divided into two haplotypes, with 77 inbred lines showing InDel at the Indel-1876 locus. + Genotype, 214 inbred lines are InDel - Genotype. To further clarify the effect of this Indel on the row grain number phenotype, the ear traits of inbred lines carrying the two haplotypes were compared. Analysis of variance showed that, compared with inbred lines carrying InDel... - Compared to haploid inbred lines, those carrying InDel + Haploid inbred lines showed a significantly increased number of rows ( p = 5.36 × 10 -13 ) and ear length ( p = 2.97 × 10 -24 This indicates that the variant site may affect ear length and row grain number. Figure 2 ).

[0015] Example 2: Application of molecular markers related to row number 1. Molecular marker development based on ZmSBP20 The InDel-1876 variant in the gene promoter region was used to develop a primer pair using Primer 5 software. The nucleotide sequence of this primer pair is as follows: ZmSBP20-InDel-1876F: 5'-TTGGCTGGTTGTGGTTGCT -3'; ZmSBP20-InDel-1876R: 5'-CACTGTGCCGCTGTACTCCT-3'.

[0016] 2. Identification of the ZmSBP20-InDel-1876 locus genotype A natural population of 209 maize inbred lines is selected, and the above developed molecular marker is used for genotype identification, specifically including the following steps: (1) PCR amplification (i) The genomic DNA of the maize inbred line to be tested is used as a template, and the designed upstream primer and downstream primer (ZmSBP20-InDel-1876F, ZmSBP20-InDel-1876R) are used for PCR amplification. The PCR amplification reaction system is 10 μL, specifically: 100 ng DNA template, 1 μL ZmSBP20-InDel-1876F (concentration of 10 μM), 1 μL ZmSBP20-InDel-1876R (concentration of 10 μM), 5 μL 2×Taq mix, ddH2O to 10 μL; (ii) The PCR amplification program is as follows: 1) 95°C pre-denaturation for 5 min; 2) 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C final extension for 5 min; (2) Gel electrophoresis After PCR is completed, the obtained PCR amplification product is electrophoresed on an agarose gel with a mass concentration of 1% for 15 min, and the genotype of the maize to be tested at the ZmSBP20-InDel-1876 site is determined according to the electrophoresis result, specifically: (i) If the nucleotide sequence length of the PCR amplification product is 381 bp, then the genotype of the maize inbred line to be tested at the ZmSBP20-InDel-1876 site is InDel + ; (ii) If the nucleotide sequence length of the PCR amplification product is 239 bp, then the genotype of the maize inbred line to be tested at the ZmSBP20-InDel-1876 site is InDel - ( Figure 3 ).

[0017] (3) Typing results In 209 maize inbred lines, the electrophoresis detection results of some samples are shown in Figure 4 , and the genotype identification results and ear traits of all samples are shown in Table 1.

[0018] Table 1 Genotype and phenotype of maize inbred lines

[0019] Among the 209 maize inbred lines detected, 53 inbred lines were InDel + at the ZmSBP20-InDel-1876 site, and 156 inbred lines were InDel - at the ZmSBP20-InDel-1876 site. Further comparison of the ear traits of the inbred lines of the two genotypes was performed, and statistical analysis was performed by using SPSS 19.0, and the comparison in Table 1 was InDel + , InDel - genotypes, and it was found that the inbred lines carrying the InDel + genotype had significantly more row number and ear length than the inbred lines carrying the InDel - genotype (Table 2).

[0020] Table 2 Comparison of ear traits of different genotypes at the ZmSBP20-InDel-1876 site in a maize inbred line population

[0021] The inbred lines carrying the InDel + allele had significantly increased row number and ear length, and the above results indicated that the InDel + was an excellent allelic variation of row number of maize, and the molecular marker ZmSBP20-InDel-1876 developed based on the site had important significance for genetic improvement of high-yield maize.

[0022] Functional genomics research has revealed the correlation between many InDel variation sites and phenotype variations. Meanwhile, InDel molecular markers have been widely used in molecular marker-assisted selection breeding (MAS) of different crops, and to a great extent, the efficiency of crop breeding has been improved. The present application successfully develops a molecular marker based on the natural variation in the promoter region of the maize ZmSBP20 gene, which is significantly associated with the row number of the female ear of maize, and the molecular marker designed for the site can accurately, efficiently and stably distinguish the InDel + genotype and the InDel - genotype, and the molecular marker can be widely used in molecular marker-assisted breeding of high-yield maize, and provides important technical support and theoretical basis for breeding new maize varieties with high yield and stable yield. The present application not only provides a new molecular tool for genetic improvement of maize yield, but also provides a new perspective for in-depth understanding of the molecular mechanism of row number of maize.

[0023] The preferred embodiments of the present application are described in detail above, but the present application is not limited to the specific details in the above-described embodiments, and various simple modifications can be made to the technical solutions of the present application within the technical concept of the present application, and these simple modifications all belong to the protection scope of the present application.

[0024] It should be further noted that any technically feasible combination of the various technical features described in the above embodiments is possible, provided that there is no contradiction, and the present application does not make any further statement on the various possible combinations.

[0025] Furthermore, any combination of the various embodiments of the present application is possible, provided that there is no contradiction, and it should be considered as disclosed by the present application.

Claims

1. An InDel molecular marker ZmSBP20-InDel-1876 that is significantly associated with the number of kernels per row in maize, this molecular marker is based on maize ZmSBP20 Gene promoter regions, characterized in that, The ZmSBP20 Located on chromosome 4 of maize, the physical location on the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 is Chr4:246387302-246390553, and the corresponding physical location of the molecular marker is Chr4:246391202-246391344, InDel + The genotype at this position has the base sequence shown in SEQ ID No. 1, InDel - The genotype is missing 142 bp at this position.

2. A primer set for detecting the InDel molecular marker of claim 1, characterized in that, The primer set includes a forward primer with a nucleotide sequence as shown in SEQ ID No.

2. ZmSBP20 -InDel-1876F, reverse primer with nucleotide sequence as shown in SEQ ID No. 3 ZmSBP20- InDel-1876R.

3. The application of the molecular marker as described in claim 1 or the primer set as described in claim 2 in assisted breeding to improve the number of kernels per row and ear length in maize.

4. A breeding method for increasing the number of kernels per row and ear length in maize, characterized in that, The process includes the following steps: using the genomic DNA of the maize inbred line to be tested as a template, PCR amplification is performed using the primer set described in claim 2; the amplification product is then subjected to agarose gel electrophoresis; and the inbred line to be tested is genotyped based on the size of the electrophoretic bands. If the electrophoretic band of the maize to be tested is 381 bp, then the maize material is designated as InDel. + Genotype; if the electrophoretic band of the maize inbred line to be tested is 239 bp, then the maize material is recorded as InDel. - Genotype; InDel + The number of kernels per row and ear length of the genotype maize inbred lines were significantly higher than those of InDel. - Genotype of inbred line.

5. The breeding method according to claim 4, characterized in that, The PCR amplification reaction system is as follows: 100 ng DNA template, 1 μL ZmSBP20-InDel-1876F, 1 μL ZmSBP20-InDel-1876R, 5 μL 2×Taq mix, and ddH2O to a final volume of 10 μL; The PCR amplification program is as follows: 1) Pre-denaturation at 95℃ for 5 min; 2) Denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, for 35 cycles; final extension at 72℃ for 5 min.

Images