Enrichment primer, pathogenic microorganism enrichment kit, enrichment method and application thereof

Abstract

The invention provides a group of enrichment primers, a pathogenic microorganism enrichment kit, a pathogenic microorganism enrichment method and related application. The enrichment primer provided by the invention is as shown in a table 1, the amplification fragment of the enrichment primer and the enrichment kit provided by the invention on target pathogenic microorganisms is about 1kb, and compared with a conventional short amplification fragment, the detection accuracy of a long sequence amplified by the enrichment primer and the enrichment kit is higher. According to the enrichment method disclosed by the invention, the read length of a sequencing fragment is increased, and the capability of precise typing of microorganisms and drug-resistant / virulence genes is further improved. The enrichment primer, the kit and the enrichment method can be combined with a single molecule sequencing technology, the sequencing period is shortened, sample sequencing can be completed within one hour, the sample detection period is greatly shortened, and the enrichment primer, the kit and the enrichment method are more suitable for the field of clinical pathogen rapid detection.

Description

Technical Field

[0001] This invention relates to the field of pathogenic microorganisms, specifically to a set of enrichment primers, a pathogenic microorganism enrichment kit, a pathogenic microorganism enrichment method, and related applications. Background Technology

[0002] In recent years, with the widespread adoption of high-throughput gene sequencing technology, it has been widely used in the field of pathogen detection. Compared with traditional clinical pathogen detection methods (such as microbial culture), high-throughput gene sequencing technology is faster, more time-saving, and more accurate. It does not require doctors to make advance predictions about the infecting pathogens. It can directly extract the DNA / RNA of all microorganisms from environmental / clinical samples for sequencing, and can accurately and sensitively detect the DNA sequences of all microorganisms in the sample.

[0003] Currently, high-throughput gene sequencing technology refers to second-generation sequencing (NGS) or next-generation sequencing technologies. Its read lengths are relatively short, generally between 150 and 300 bp (some principles can achieve >600 bp, such as pyrosequencing), and the sequencing cycle is relatively long, typically several hours to tens of hours. Even the fastest high-throughput gene sequencer (such as the DNBSEQ-G99) has a minimum sequencing cycle of over 3 hours. The short read lengths limit sequencing accuracy, especially for identifying multidrug-resistant gene clusters and repetitive sequences on drug-resistant plasmids. The long sequencing cycle also cannot fully meet the application needs of rapid clinical pathogen detection. For infectious diseases where timeliness is crucial, every hour shortened in the detection cycle could potentially save a patient's life. Therefore, improving the sensitivity and timeliness of pathogen detection is an urgent problem to be solved. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides a set of enrichment primers, pathogenic microorganism enrichment kits, pathogenic microorganism enrichment methods, and related applications. The enrichment primers, kits, and methods provided by this invention can effectively improve the sensitivity of pathogenic microorganism detection.

[0005] In a first aspect, the present invention provides a set of enrichment primers, including at least one pair from the following four sets of primer pairs. Specifically:

[0006] Primer set 1 for enriching Streptococcus pneumoniae (Spn), as shown in SEQ ID NO.1 and SEQ ID NO.2, contains nucleotide sequences.

[0007] Primer pair 2 for enriching Cryptococcus gattii, as shown in SEQ ID NO.3 and SEQ ID NO.4, contains the nucleotide sequences.

[0008] Primer pair 3 for enriching adenovirus (AD), such as the nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6;

[0009] Primer pair 4 used for enriching Coxsackievirus (Cox), as shown in SEQ ID NO.7 and SEQ ID NO.8, contains nucleotide sequences.

[0010] Secondly, based on the above-mentioned enrichment primers, the present invention provides a pathogenic microorganism enrichment kit, which includes the enrichment primers of the first aspect.

[0011] Preferably, the kit also includes universal primers, which are nucleotide sequences as shown in SEQ ID NO.9 and SEQ ID NO.10.

[0012] Preferably, the above kit further includes amplification reagent 1 and amplification reagent 2, wherein amplification reagent 1 is used to perform one-step reverse transcription and primer amplification. In a specific embodiment of the present invention, amplification reagent 1 is preferably VAHTS One-Step RT-Multiplex Mix (U + Amplification reagent 2 is used to achieve efficient primer amplification. In one specific embodiment of the present invention, amplification reagent 2 is preferably Jupiter rTaq Multiplex.

[0013] Preferably, the above kit also includes magnetic beads and a dissolving solution, wherein the magnetic beads are sorting magnetic beads and the dissolving solution is nuclease-free water.

[0014] Thirdly, based on the enrichment primers provided in the first aspect, the present invention provides a method for enriching pathogenic microorganisms. The method includes extracting nucleic acids of pathogenic microorganisms from a sample, adding the enrichment primers provided in the first aspect to the extracted pathogenic microorganism nucleic acids for reverse transcription and a first PCR amplification, and adding universal primers provided in the kit provided in the second aspect to the amplification products of the reverse transcription and the first PCR amplification for a second PCR amplification.

[0015] Preferably, the above reverse transcription and first PCR amplification also include the addition of amplification reagent 1, VAHTS One-Step RT-Multiplex Mix (U + The second PCR amplification also included the addition of amplification reagent 2, which was Jupiter rTaq Multiplex.

[0016] Preferably, the above enrichment method further includes purifying the amplification product of the second PCR amplification using magnetic beads.

[0017] Fourthly, the present invention also provides the application of the enrichment primers provided in the first aspect, the kits provided in the second aspect, or the enrichment methods provided in the third aspect in the construction or detection of pathogenic microorganism libraries. Specifically, the pathogenic microorganisms involve at least one of Streptococcus pneumoniae, Cryptococcus guarfieldii, adenovirus, and Coxsackievirus.

[0018] The beneficial effects of this invention are as follows: The enrichment primers provided by this invention amplify target pathogenic microorganisms with a fragment length of approximately 1 kb, resulting in higher detection accuracy for long sequences compared to conventional short amplification fragments. The enrichment method of this invention increases the read length of sequencing fragments, thereby enhancing the ability to accurately genotype microorganisms and drug resistance / virulence genes. In particular, for viruses, non-tuberculous mycobacteria, multidrug-resistant gene clusters, repetitive sequences on drug-resistant plasmids, copy number variations in drug-resistant genes, and other organisms with high gene variation frequencies, high interspecies homology, or complex sequence structures, existing high-throughput gene sequencing methods with short read lengths cannot accurately identify these organisms. The enrichment primers, enrichment kits, and enrichment method provided by this invention effectively solve these problems.

[0019] Meanwhile, the enrichment primers, kits, and enrichment methods of this invention can be combined with single-molecule sequencing technology to solve the problems of short read lengths and long sequencing cycles in high-throughput gene sequencing technology. Compared with existing methods, the method of this invention shortens the sequencing cycle and can complete sample sequencing within 1 hour, greatly shortening the sample detection cycle. It is more suitable for the field of rapid clinical pathogen detection, especially for the diagnosis of critically ill patients. Studies have shown that for patients with sepsis and septic shock, the survival rate will decrease by an average of 7.6% for every 1 hour of delay in the application of appropriate antibacterial drugs. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the detection process and corresponding library preparation kit components used in Example 1;

[0021] Figure 2 The results of the detection of each species in Example 1 are shown on the horizontal axis, which represents each detected species. The vertical axis is the logarithm of the number of reads of each microorganism's genome compared to the 1M data volume. The results show that compared with conventional detection methods, the kit described in this invention has a 1000-20000-fold enrichment capacity for the target Spn, Gatti, AD, and Cox in the sample (the number of reads is increased to 1000-20000 times).

[0022] Figure 3 To compare the detection cycle of the process described in this kit in Example 1 with the conventional process, the horizontal axis represents the time taken by the process (min). The results show that the process described in this kit has an advantage in detection cycle compared with the conventional detection method, which can save about 7 hours.

[0023] Figure 4 The diagram shows a comparison of the library fragment lengths in the kit described in Example 1 and the conventional process. The vertical axis represents the library fragment length (bp) of each process. The results show that the library fragment length in the kit described in this example can reach about 1Kb compared to the conventional detection process. Detailed Implementation

[0024] Single-molecule sequencing is an emerging gene sequencing technology, primarily represented by nanopore sequencing. This technology utilizes electrical signals within nanopores to identify and sequence gene sequences, offering advantages such as low cost, high-speed sequencing, and direct sequencing. Since the advent of the first commercial nanopore sequencer in 2012, this technology has been widely applied in genomics and biomedical research. Numerous companies and research institutions have conducted in-depth research and development in this field, launching various types of nanopore sequencers. These continuous advancements have provided more efficient and accurate sequencing tools for genomics research, and have also brought new opportunities and challenges to areas such as personalized medicine and disease diagnosis and treatment.

[0025] This invention, through repeated research on detection methods for Streptococcus pneumoniae (Spn), Cryptococcus ganterii, adenovirus (AD), and Coxsackievirus (Cox), including library construction and sequencing on the MGISEQ platform, reveals that existing technologies, employing short-read optical signal sequencing, result in very long overall sequencing processes and short read lengths, failing to meet requirements. Therefore, this invention, through repeated screening, yields a set of enriched primers capable of long-read sequencing while meeting the requirements for accurate pathogen typing. These primers effectively enable long-read sequencing of Streptococcus pneumoniae, Cryptococcus ganterii, adenovirus, and Coxsackievirus, improving the accuracy of target gene detection. In particular, their combination with single-molecule sequencing technology saves significant detection time and yields a sufficient number of effective reads to meet requirements.

[0026] The enrichment primers used in this invention are shown in Table 1 below.

[0027] Table 1 Enrichment Primer Sequences

[0028] Primer number Primer name sequence SEQ ID NO.1 S.trep_2F TTTCTGTTGGTGCTGATATTGC ATACCACCGTAGTTAGCAGAAGAT SEQ ID NO.2 S.trep_2R ACTTGCCTGTCGCTCTATCTTC TCTTGCCAGATACGACCTACTATG SEQ ID NO.3 cry_gat1F TTTCTGTTGGTGCTGATATTGC AATCGACTGTTCCGTCTGCATTGA SEQ ID NO.4 cry_gat1R ACTTGCCTGTCGCTCTATCTTC CCATCATTGCCATCTCGACCG SEQ ID NO.5 AD_5F TTTCTGTTGGTGCTGATATTGCGAACGCCATAGACGCCATGAA SEQ ID NO.6 AD_5R ACTTGCCTGTCGCTCTATCTTC AACCATGTCTTGAAGCTCCTGATT SEQ ID NO.7 Cox_1F TTTCTGTTGGTGCTGATATTGC AACCAAGTGAACCGCTCCTTAAC SEQ ID NO.8 Cox_1R ACTTGCCTGTCGCTCTATCTTC GCGCCGTAACTGAGCATATCC

[0029] It should be noted that the above-mentioned enrichment primers can be used alone or in combination. It should be understood that, depending on the needs of the actual experiment, the above four pathogenic microorganisms can be detected individually, or two or more of the above four pathogenic microorganisms can be detected. Obviously, simultaneous detection with multiple primer sets can achieve the detection of multiple pathogenic microorganisms in a single experiment, thus being more efficient. This invention has conducted extensive experiments and confirmation on the specific selection of primer sequences. The enrichment primers provided by this invention exhibit excellent detection effects whether for the individual detection of each pathogenic microorganism or the simultaneous detection of all four. The mixed use of multiple primer pairs is independent and does not interfere with each other, and each pair can efficiently complete effective enrichment.

[0030] Based on the above-mentioned enrichment primers, the present invention further provides a pathogenic microorganism enrichment kit including the above-mentioned enrichment primers. In addition to including the nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.8 in Table 1 above, this kit enables simultaneous detection of four pathogenic microorganisms—Streptococcus pneumoniae, Cryptococcus grease, adenovirus, and Coxsackievirus.

[0031] In the above kit, there are no restrictions on the packaging concentration of the enrichment primers. Those skilled in the art can set the packaging concentration as needed. The four primer pairs can be packaged individually or in combination. If individual detection is required, individual packaging is recommended. It should be noted that the working concentration of the enrichment primers in the kit is 10-100 μM, preferably 30 μM. The working concentration refers to the amount of enrichment primers—the primer pairs corresponding to the pathogens to be detected—used in the PCR reaction system during PCR amplification at 30 μM (30 μmol / L).

[0032] In addition, to further improve the effective reads data in subsequent sequencing, in one specific embodiment of the present invention, the kit also includes universal primers, which are shown in Table 2.

[0033] Table 2 Universal Primer Sequences

[0034] Primer number Primer name sequence SEQ ID NO.9 G_F1 TTTCTGTTGGTGCTGATATTGC SEQ ID NO.10 G_R1 ACTTGCCTGTCGCTCTATCTTC

[0035] It should be noted that using universal primers to amplify the amplified products after enrichment primer amplification can effectively increase the content of enriched fragments and improve detection sensitivity.

[0036] In the above kit, there are no restrictions on the packaging concentration of the universal primers; those skilled in the art can set the packaging concentration as needed. It should be specifically noted that when using the kit, the working concentration of the universal primers is 10-100 μM, preferably 30 μM. The working concentration refers to the amount of universal primers used in the PCR reaction system during PCR amplification, which is 30 μM (30 μmol / L).

[0037] Furthermore, the kit also includes amplification reagent 1, amplification reagent 2, magnetic beads, and a dissolving solution. Amplification reagent 1 is used in conjunction with enrichment primers for reverse transcription and the first PCR amplification of the extracted pathogenic microbial nucleic acid. Amplification reagent 2 is used in conjunction with universal primers for a second PCR amplification of the amplification products after reverse transcription and the first PCR amplification. The magnetic beads and dissolving solution are used for magnetic bead purification of the amplification products after the second PCR amplification.

[0038] In another specific embodiment of the present invention, amplification reagent 1 is 5X VAHTS One-Step RT-Multiplex Mix (U + The amplification reagent 2 is Jupiter rTaq Multiplex 2X mix, the magnetic beads are sorted magnetic beads, and the dissolving solution is Nuclease-free Water.

[0039] The kit described in this invention can detect both DNA and RNA, and can achieve rapid library construction through one-step reverse transcription and enrichment amplification. The accompanying single-molecule sequencing platform can reduce the detection cycle of pathogenic microorganisms to less than 4 hours.

[0040] For specific applications of the enrichment primers, enrichment kits, and enrichment methods of this invention, please refer to [link / reference]. Figure 1 . Figure 1 The illustration shows the detection process and corresponding schematic diagrams of the kit components used in the embodiments. In this specific embodiment, the kit achieves the enrichment of the target microorganism by amplifying the nucleic acid sample containing the target microbial genome using enrichment primers. The specific enrichment method includes: nucleic acid extraction from the sample to be tested, reverse transcription and enrichment primer amplification, universal primer amplification, and magnetic bead purification. After purification, library construction and sequencing can be performed according to the selected sequencing platform (e.g., Nanopore platform sequencing) to analyze the microbial composition.

[0041] Besides Nanopore, other single-molecule sequencing platforms from other brands can also be used in conjunction with the method of this invention. The use of the Nanopore sequencing platform in this embodiment is merely one example of implementation. Figure 1 The diagram shown illustrates a microbial detection process based on the Nanopore sequencing platform. However, it should be understood that the kit described in this invention can also be implemented on other sequencing platforms, using their respective universal primers and sequencing adapters.

[0042] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. Specifically, the kit and its usage method of the present invention will be described in detail through embodiments. It should be understood that the embodiments are merely exemplary and should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1:

[0044] This embodiment uses the enrichment detection of Streptococcus pneumoniae (Spn), Cryptococcus ganatus (Gattii), adenovirus (AD), and Coxsackievirus (Cox) as an example. Simulated samples containing Spn, Gattiii, AD, and Cox were detected using conventional high-throughput gene sequencing methods and the kit described in this invention, respectively.

[0045] The overall detection process of the reagent kit described in this invention is as follows: Figure 1 As shown. It typically includes the following steps (it should be noted that the simulated sample configuration in this example uses known samples for detection because this is a validation example and a comparative experiment is required; in actual applications, sample configuration is not necessary, and can begin from step 2, sample nucleic acid extraction):

[0046] 1. Simulated sample preparation: Take inactivated samples of each bacterium, fungus, and virus, and add them to the sample matrix (physiological saline with a final concentration of 10). 5 In HeLa cells (cells / mL), a simulated sample was prepared to contain a final concentration of 10. 4 CFU / mLSpn, 10 4 CFU / mL Gattii, 10 4 cp / mL AD and 10 4 cp / mL Cox.

[0047] 2. Nucleic acid extraction from samples: Nucleic acid was extracted using a microbial extraction kit (magnetic bead method) according to the instructions, and the nucleic acid was reconstituted with RNase-Free ddH2O.

[0048] 3. Reverse transcription and enrichment primer amplification: Take 10 μL of the extracted nucleic acid, incubate at 65℃ for 5 min, and immediately cool on ice. Add amplification reagent 1 (5X VAHTS One-Step RT-Multiplex Mix (U + )) A total of 25 μL of primers (containing 4 primer pairs) were added to 30 μM. After vortexing and mixing, the mixture was incubated at 25 °C for 5 min and at 37 °C for 15 min. The first PCR amplification program was as follows: 94 °C for 2 min, 18 cycles (94 °C for 15 sec, 60 °C for 15 sec, 72 °C for 45 sec), 72 °C for 5 min, and 4 °C hold.

[0049] 4. Universal primer amplification: Add 25 μL of amplification reagent 2 (Jupiter rTaq Multiplex 2X mix) and 30 μM of universal primers to the amplification product from step 3. The second PCR amplification program is as follows: 94℃ for 2 min, 15 cycles (94℃ for 15 sec, 62℃ for 15 sec, 72℃ for 45 sec), 72℃ for 5 min, and 4℃ hold.

[0050] 5. Magnetic bead purification: After the reaction is complete, add 1x magnetic beads for purification. The specific reagents used are magnetic beads (purified according to the instructions) and dissolving buffer (redissolve the purified product according to the required sequencing volume).

[0051] 6. Nanopore platform sequencing: Perform pooling, sequencing adapter ligation, and sequencing according to the instructions of the Nanopore platform ligation sequencing kit SQK-LSK114.

[0052] 7. Data Analysis: The offline data were compared with the genomes of the added microorganisms. Reads that could only be matched with the corresponding species were counted, and the reads detected by each microbial species using both methods were statistically analyzed (e.g., ...). Figure 2 The results showed that, compared with conventional methods, the kit described in this invention has a 1,000-20,000-fold enrichment capacity for the target in the sample (reads increased by 1,000-20,000 times) under the same data volume.

[0053] The method described in this kit also has advantages in terms of detection cycle time. Compared with the conventional procedure, the procedure described in this kit saves approximately 7 hours (e.g., Figure 3 Furthermore, compared to conventional detection procedures, the library fragment length described in this kit can reach approximately 1Kb, enabling long-sequence sequencing (e.g., Figure 4 ).

[0054] It should be noted that the standard detection procedure used in this example is as follows:

[0055] 1. Simulated sample preparation: Same as the preparation process described above.

[0056] 2. Nucleic acid extraction from samples: Nucleic acid was extracted using a microbial extraction kit (magnetic bead method) according to the instructions, and the nucleic acid was reconstituted with RNase-Free ddH2O.

[0057] 3. Reverse Transcription & End Repair: Add 1 μL of N6 primer (10 μM) to the extracted nucleic acid, vortex to mix, and incubate at 94°C for 5 min, then immediately cool on ice. Add 7 μL of 5x first strand buffer (Invitrogen), 2 μL of dNTP™ extract (10 mM each), 3.5 μL of 0.1 M DTT (Invitrogen), 1.5 μL of RNase inhibitor, 1 μL of BST3.0 DNA polymerase, 1 μL of SuperScript II Reverse Transcriptase, 5 μL of DNA pol I, 1 μL of TaKaRa Taq, 1 μL of T4 polynucleotide kinase, and 1 μL of Tris-HCl buffer, and bring the volume to 50 μL with Nuclease-Free Water. Vortex to mix, and incubate at 25°C for 5 min, 37°C for 30 min, 72°C for 10 min, and 85°C for 2 min.

[0058] 4. MGISEQ platform library construction: Follow the MGISEQ platform library construction instructions to perform adapter ligation, magnetic bead purification, PCR amplification, and magnetic bead purification procedures.

[0059] 5. Sequencing and data analysis on the MGISEQ platform follow the same procedure as described above.

[0060] The above examples illustrate the present invention only to aid in understanding it and are not intended to limit the scope of the invention. Those skilled in the art can make various simple deductions, modifications, or substitutions based on the principles of this invention.

Claims

1. A set of enrichment primers, characterized in that, The enrichment primers include at least one of the following four sets of primer pairs; Primer pair 1: Nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; Primer pair 2: Nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; Primer pair 3: Nucleotide sequences as shown in SEQ ID NO. 5 and SEQ ID NO. 6; Primer pair 4: Nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.

8.

2. A pathogenic microorganism enrichment kit, characterized in that, The kit includes enrichment primers comprising nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.

8.

3. The kit according to claim 2, characterized in that, The working concentration of the enrichment primers in the kit is 10-100 μM, preferably 30 μM.

4. The kit according to claim 2, characterized in that, The kit also includes universal primers, which are nucleotide sequences as shown in SEQ ID NO.9 and SEQ ID NO.

10.

5. The kit according to claim 4, characterized in that, The working concentration of the universal primers in the kit is 10-100 μM, preferably 30 μM.

6. The reagent kit as described in claim 5, characterized in that, The kit also includes amplification reagent 1 and amplification reagent 2. Amplification reagent 1 is used to perform one-step reverse transcription and primer amplification, and amplification reagent 2 is used to perform primer amplification. Preferably, amplification reagent 1 is VAHTS One-Step RT-Multiplex Mix (U + The amplification reagent 2 is Jupiter rTaq Multiplex.

7. The kit according to claim 6, characterized in that, The kit also includes magnetic beads and a dissolving solution, wherein the magnetic beads are sorting magnetic beads and the dissolving solution is nuclease-free water.

8. A method for enriching pathogenic microorganisms, characterized in that, The method includes: Nucleic acid of pathogenic microorganisms was extracted from the sample. Enrichment primers were added to the extracted nucleic acid of pathogenic microorganisms for reverse transcription and first PCR amplification. Universal primers were added to the amplification products of reverse transcription and first PCR amplification for second PCR amplification. The enrichment primers are nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.8, and the universal primers are nucleotide sequences as shown in SEQ ID NO.9 to SEQ ID NO.

10.

9. The enrichment method as described in claim 8, characterized in that, The working concentration of the enrichment primers is 10-100 μM; the working concentration of the universal primers is 10-100 μM. Preferably, the working concentration of the enrichment primer is 30 μM, and the working concentration of the universal primer is 30 μM; Preferably, the reverse transcription and first PCR amplification further include the addition of amplification reagent 1, namely VAHTS One-StepRT-Multiplex Mix (U + The second PCR amplification also includes the addition of amplification reagent 2, which is Jupiter rTaq Multiplex.

10. The enrichment method as described in claim 8 or 9, characterized in that, The method also includes purifying the amplification products of the second PCR amplification using magnetic beads.

11. The application of the enrichment primers as described in claim 1, the kits as described in any one of claims 2-7, or the enrichment methods as described in any one of claims 8-10 in the construction or detection of pathogenic microorganism libraries, wherein the pathogenic microorganisms include at least one of Streptococcus pneumoniae, Cryptococcus grease, adenovirus, or Coxsackievirus.

Images